microRNA information: hsa-miR-146a-5p

SectionIDlink
Mature name: hsa-miR-146a-5pmiRbase
Accession: MIMAT0000449miRbase
Precursor name: hsa-mir-146a miRbase
Precursor accession: MI0000477miRbase
Symbol: MIR146AHGNC
RefSeq ID: NR_029701GenBank
Sequence: UGAGAACUGAAUUCCAUGGGUU



Reported expression in cancers: hsa-miR-146a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-146a-5p

B cell lymphomaderegulation"MicroRNA 146a rs2910164 polymorphism and the risk ......"25370733qPCR
hsa-miR-146a-5p

bladder cancerupregulation"We found that miR-146a rs2910164 C allele was asso ......"22846912
hsa-miR-146a-5p

breast cancerdownregulation"We also show that low expression of miR-146a stron ......"25417703
hsa-miR-146a-5p

breast cancerdownregulation"Associations of miR 146a and miR 146b expression a ......"26406414
hsa-miR-146a-5p

cervical and endocervical cancerupregulation"Increased exosomal microRNA 21 and microRNA 146a l ......"24406730qPCR
hsa-miR-146a-5p

cervical and endocervical cancerupregulation"The occurrence of cervical cancer in Uygur women i ......"26464690qPCR
hsa-miR-146a-5p

colon cancerdownregulation"To present proof-of-principle application for empl ......"23741026qPCR; Microarray
hsa-miR-146a-5p

colon cancerdownregulation"Expression of miR 146a in colon cancer and its sig ......"24670457qPCR
hsa-miR-146a-5p

colorectal cancerdownregulation"Association of a genetic variant in microRNA 146a ......"24740563
hsa-miR-146a-5p

gastric cancerdownregulation"MicroRNA 146a is down regulated in gastric cancer ......"21347720qPCR
hsa-miR-146a-5p

gastric cancerderegulation"miRNA expression signature was first analyzed by r ......"21628394qPCR
hsa-miR-146a-5p

gastric cancerupregulation"Our previous studies have revealed that miR-146a i ......"22020746qPCR
hsa-miR-146a-5p

gastric cancerupregulation"The real-time PCR was used to evaluate the effect ......"23706078qPCR
hsa-miR-146a-5p

gastric cancerdownregulation"The clinical significance of downregulation of mir ......"24805774Microarray
hsa-miR-146a-5p

head and neck cancerdownregulation"Characterization of miR 146a and miR 155 in blood ......"26621153qPCR; Microarray
hsa-miR-146a-5p

kidney renal cell cancerdownregulation"Effect of a functional polymorphism in the pre miR ......"26323945
hsa-miR-146a-5p

liver cancerdownregulation"Expression and clinicopathological significance of ......"24172202qPCR
hsa-miR-146a-5p

liver cancerdownregulation"Previously we found that the expression of microRN ......"24895573
hsa-miR-146a-5p

liver cancerdownregulation"Growing evidence indicates that miR-146a is involv ......"25608619
hsa-miR-146a-5p

lung squamous cell cancerdownregulation"Aberrant expression of microRNA-146a miR-146a has ......"23555954
hsa-miR-146a-5p

lung squamous cell cancerupregulation"microRNA 146 up regulation predicts the prognosis ......"24448024in situ hybridization
hsa-miR-146a-5p

lung squamous cell cancerderegulation"In this study we evaluated the expression profiles ......"27533249
hsa-miR-146a-5p

lymphomadownregulation"Clinical and epidemiological data suggest that chr ......"22307176Reverse transcription PCR; in situ hybridization
hsa-miR-146a-5p

melanomaupregulation"Moreover as expected some discrepancies were also ......"20442294qPCR; Microarray
hsa-miR-146a-5p

melanomaupregulation"Interestingly miR-146a was upregulated in the seru ......"25951497
hsa-miR-146a-5p

ovarian cancerupregulation"We analyzed the miRNA expression profiles of prima ......"23554878qPCR
hsa-miR-146a-5p

pancreatic cancerdownregulation"Eighty-eight samples of ductal pancreatic adenocar ......"22850622qPCR
hsa-miR-146a-5p

pancreatic cancerdownregulation"Expression analysis of miR-146a in human PC tissue ......"24839931
hsa-miR-146a-5p

sarcomadownregulation"Similar analysis in mouse metastatic sarcomas reve ......"26044957
hsa-miR-146a-5p

thyroid cancerupregulation"Associations of miR 146a and miR 146b expression a ......"25524940
hsa-miR-146a-5p

thyroid cancerupregulation"Family of microRNA 146 Regulates RARβ in Papillar ......"27011326



Reported cancer pathway affected by hsa-miR-146a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-146a-5p

breast cancerApoptosis pathway"Overexpression of miR 146a in basal like breast ca ......"25123132RNAi
hsa-miR-146a-5p

breast cancerApoptosis pathway"Quercetin inhibits proliferation and invasion acts ......"25596948
hsa-miR-146a-5p

breast cancerApoptosis pathway"Catalpol suppresses proliferation and facilitates ......"26458573Flow cytometry; MTT assay
hsa-miR-146a-5p

colon cancercell cycle pathway; Apoptosis pathway"Expression of miR 146a in colon cancer and its sig ......"24670457Flow cytometry
hsa-miR-146a-5p

colorectal cancerWnt signaling pathway"Target resequencing to identify microRNA associate ......"26813595
hsa-miR-146a-5p

gastric cancerApoptosis pathway; cell cycle pathway"MicroRNA 146a is down regulated in gastric cancer ......"21347720MTT assay
hsa-miR-146a-5p

gastric cancerApoptosis pathway"Increased miR 146a in gastric cancer directly targ ......"22020746Flow cytometry; Western blot; Luciferase
hsa-miR-146a-5p

gastric cancerApoptosis pathway"Celastrol induces apoptosis of gastric cancer cell ......"23706078Western blot; Luciferase
hsa-miR-146a-5p

gastric cancerApoptosis pathway"MicroRNA 146a enhances Helicobacter pylori induced ......"25081668
hsa-miR-146a-5p

liver cancerApoptosis pathway"miR 146a suppresses the sensitivity to interferon ......"21982769
hsa-miR-146a-5p

liver cancerApoptosis pathway"Synergistic effect of MiR 146a mimic and cetuximab ......"24895573Western blot
hsa-miR-146a-5p

lung cancerApoptosis pathway"Effect and molecular mechanism of mir 146a on prol ......"27569893Luciferase; Western blot; MTT assay
hsa-miR-146a-5p

lung squamous cell cancerApoptosis pathway"miR 146a inhibits cell growth cell migration and i ......"23555954
hsa-miR-146a-5p

lung squamous cell cancerEpithelial mesenchymal transition pathway"MicroRNA 146a inhibits epithelial mesenchymal tran ......"26238771Cell migration assay; Luciferase
hsa-miR-146a-5p

lymphomaApoptosis pathway"MicroRNA 146a downregulates NFκB activity via tar ......"21610143
hsa-miR-146a-5p

melanomaNotch signaling pathway"miR 146a promotes the initiation and progression o ......"24550252
hsa-miR-146a-5p

ovarian cancerApoptosis pathway"miR 146a Inhibits Proliferation and Enhances Chemo ......"27131313
hsa-miR-146a-5p

prostate cancerApoptosis pathway"Demethylation of the miR 146a promoter by 5 Aza 2' ......"24885368Western blot; Cell Proliferation Assay
hsa-miR-146a-5p

prostate cancerApoptosis pathway"Hsa miR 146a 5p modulates androgen independent pro ......"26306811Western blot; Luciferase
hsa-miR-146a-5p

thyroid cancerApoptosis pathway"Nuclear factor kappaB contributes to anaplastic th ......"20061417
hsa-miR-146a-5p

thyroid cancerApoptosis pathway"MicroRNA 146a targets PRKCE to modulate papillary ......"23457043Luciferase



Reported cancer prognosis affected by hsa-miR-146a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-146a-5p

bladder cancerrecurrence"We found that miR-146a rs2910164 C allele was asso ......"22846912
hsa-miR-146a-5p

bladder cancerstaging; metastasis"At present inconsistent association between single ......"26458899
hsa-miR-146a-5p

breast cancermetastasis"Breast cancer metastasis suppressor 1 up regulates ......"19190326
hsa-miR-146a-5p

breast cancermetastasis"MicroRNA arrays were done comparing small RNAs tha ......"19585508
hsa-miR-146a-5p

breast cancertumorigenesis"Microarray-based techniques are being useful to ob ......"22167321
hsa-miR-146a-5p

breast cancertumorigenesis"MicroRNA-146a and -146b are encoded by two differe ......"22350993
hsa-miR-146a-5p

breast cancerdrug resistance"We identified un-described network clusters that c ......"23270413
hsa-miR-146a-5p

breast cancercell migration; metastasis"TRAIL induced miR 146a expression suppresses CXCR4 ......"23647548
hsa-miR-146a-5p

breast cancerdrug resistance; progression"Overexpression of miR 146a in basal like breast ca ......"25123132RNAi
hsa-miR-146a-5p

breast cancerpoor survival"BRCA1 regulation of epidermal growth factor recept ......"25417703
hsa-miR-146a-5p

breast cancermetastasis; progression"Aberrant plasma levels of circulating miR 16 miR 1 ......"26033453
hsa-miR-146a-5p

breast cancerpoor survival"miR 146a and miR 638 in BRCA1 deficient triple neg ......"26835710
hsa-miR-146a-5p

breast cancercell migration"MicroRNA 146a inhibits cell migration and invasion ......"27175941Luciferase
hsa-miR-146a-5p

breast cancermetastasis; progression; poor survival"We evaluated the expression levels of miR-21 miR-1 ......"27197674
hsa-miR-146a-5p

breast cancerpoor survival"Functional SNP in stem of mir 146a affects Her2 st ......"27434289
hsa-miR-146a-5p

cervical and endocervical cancertumorigenesis"Using miRNA array analyses for age-matched normal ......"18596939
hsa-miR-146a-5p

cervical and endocervical cancerprogression"The oncogenic proteins E6 E7 and E5 expressed by H ......"23189617
hsa-miR-146a-5p

cervical and endocervical cancertumor size; progression"The occurrence of cervical cancer in Uygur women i ......"26464690
hsa-miR-146a-5p

colon cancerstaging"To present proof-of-principle application for empl ......"23741026
hsa-miR-146a-5p

colon cancerdifferentiation; staging; tumor size; poor survival"Expression of miR 146a in colon cancer and its sig ......"24670457Flow cytometry
hsa-miR-146a-5p

colorectal cancerpoor survival; worse prognosis"A miR 146a polymorphism rs2910164 predicts risk of ......"23898084
hsa-miR-146a-5p

colorectal cancerdifferentiation"We genotyped the polymorphism of two common miRNA ......"24136745
hsa-miR-146a-5p

colorectal cancertumorigenesis"Association of a genetic variant in microRNA 146a ......"24740563
hsa-miR-146a-5p

colorectal cancertumorigenesis; progression"Target resequencing to identify microRNA associate ......"26813595
hsa-miR-146a-5p

esophageal cancerstaging"Five polymorphisms miR-146a rs2910164 miR-196a2 rs ......"24288122
hsa-miR-146a-5p

esophageal cancerprogression"Prognostic and diagnostic potential of miR 146a in ......"26794279
hsa-miR-146a-5p

gastric cancermetastasis"Differential expression of miRNAs was studied usin ......"20726036
hsa-miR-146a-5p

gastric cancerprogression; differentiation; tumor size; poor survival"MicroRNA 146a is down regulated in gastric cancer ......"21347720MTT assay
hsa-miR-146a-5p

gastric cancerworse prognosis; metastasis; poor survival"Clinical significance of miR 146a in gastric cance ......"21632853
hsa-miR-146a-5p

gastric cancerstaging"A functional polymorphism in Pre miR 146a is assoc ......"22455393
hsa-miR-146a-5p

gastric cancermetastasis"microRNA 146a targets the L1 cell adhesion molecul ......"22711166Transwell assay; Wound Healing Assay; Western blot; Luciferase
hsa-miR-146a-5p

gastric cancerpoor survival"We evaluated the association between three SNPs rs ......"22993637
hsa-miR-146a-5p

gastric cancermetastasis"MicroRNA 146a acts as a metastasis suppressor in g ......"23435376Luciferase
hsa-miR-146a-5p

gastric cancermetastasis; staging"In a pilot study serum levels of miR-21 miR-27a mi ......"23806809
hsa-miR-146a-5p

gastric cancerworse prognosis"The aim of the study was to investigated whether t ......"24379078
hsa-miR-146a-5p

gastric cancertumorigenesis; staging; metastasis; differentiation"The clinical significance of downregulation of mir ......"24805774
hsa-miR-146a-5p

gastric cancermetastasis"MicroRNA 146a enhances Helicobacter pylori induced ......"25081668
hsa-miR-146a-5p

gastric cancerstaging; worse prognosis"Common single-nucleotide polymorphisms SNPs in pre ......"25202115
hsa-miR-146a-5p

gastric cancerworse prognosis"Association of the miR 146a rs2910164 polymorphism ......"27267319
hsa-miR-146a-5p

gastric cancerprogression"In this study BARF1-expressing stomach cancer cell ......"27438138
hsa-miR-146a-5p

glioblastomapoor survival"Induction of microRNA 146a is involved in curcumin ......"26239619
hsa-miR-146a-5p

head and neck cancermetastasis"Characterization of miR 146a and miR 155 in blood ......"26621153
hsa-miR-146a-5p

kidney renal cell cancerstaging; poor survival"We genotyped four common miRNA SNPs i.e miR-146a r ......"24681820
hsa-miR-146a-5p

kidney renal cell cancerworse prognosis; poor survival"Effect of a functional polymorphism in the pre miR ......"26323945
hsa-miR-146a-5p

kidney renal cell cancermetastasis"Integrated microRNA and mRNA Signature Associated ......"26859141
hsa-miR-146a-5p

liver cancertumorigenesis"No association of pre microRNA 146a rs2910164 poly ......"21807077
hsa-miR-146a-5p

liver cancerdrug resistance"miR 146a suppresses the sensitivity to interferon ......"21982769
hsa-miR-146a-5p

liver cancerdrug resistance"The cell viability MTT assay was used to detect dr ......"23229111MTT assay
hsa-miR-146a-5p

liver cancerstaging; metastasis; tumorigenesis"Expression and clinicopathological significance of ......"24172202
hsa-miR-146a-5p

liver cancermalignant trasformation"Synergistic effect of MiR 146a mimic and cetuximab ......"24895573Western blot
hsa-miR-146a-5p

liver cancerimmune resistance"miR 146a is directly regulated by STAT3 in human h ......"25607648Luciferase
hsa-miR-146a-5p

liver cancermetastasis; progression; tumorigenesis; worse prognosis"microRNA 146a inhibits cancer metastasis by downre ......"25608619Luciferase
hsa-miR-146a-5p

liver cancerprogression"Association between microRNA 196A2 and microRNA 14 ......"26529280
hsa-miR-146a-5p

lung cancertumorigenesis"Other significantly differentiated miR families in ......"23035181
hsa-miR-146a-5p

lung cancerpoor survival"Polymorphisms of microRNA sequences or binding sit ......"23613771
hsa-miR-146a-5p

lung cancertumorigenesis"A common polymorphism in pre microRNA 146a is asso ......"24144839
hsa-miR-146a-5p

lung squamous cell cancerrecurrence; worse prognosis"The prognostic impact of microRNA sequence polymor ......"22818121
hsa-miR-146a-5p

lung squamous cell cancercell migration; progression; malignant trasformation; staging; metastasis; poor survival"miR 146a inhibits cell growth cell migration and i ......"23555954
hsa-miR-146a-5p

lung squamous cell cancerworse prognosis"microRNA 146 up regulation predicts the prognosis ......"24448024
hsa-miR-146a-5p

lung squamous cell cancerstaging; metastasis; poor survival; drug resistance"Serum levels of miR 19b and miR 146a as prognostic ......"24531034
hsa-miR-146a-5p

lung squamous cell cancermalignant trasformation"MicroRNA 146a rs2910164 polymorphism is associated ......"25154761
hsa-miR-146a-5p

lung squamous cell cancerprogression"MicroRNA 146a inhibits epithelial mesenchymal tran ......"26238771Cell migration assay; Luciferase
hsa-miR-146a-5p

lymphomastaging"Herein we used a global quantitative real-time pol ......"25503151
hsa-miR-146a-5p

melanomamalignant trasformation"The rs2910164 G>C polymorphism in microRNA 146a is ......"23222547
hsa-miR-146a-5p

melanomaprogression"miR 146a promotes the initiation and progression o ......"24550252
hsa-miR-146a-5p

melanomaprogression; metastasis; recurrence"miR 146a Exerts Differential Effects on Melanoma G ......"26965144
hsa-miR-146a-5p

melanomaprogression; metastasis; recurrence"miR 146a Exerts Differential Effects on Melanoma G ......"27311960
hsa-miR-146a-5p

ovarian cancermetastasis; poor survival"We analyzed the miRNA expression profiles of prima ......"23554878
hsa-miR-146a-5p

ovarian cancerprogression; poor survival"By analyzing multidimensional datasets of ovarian ......"25537514
hsa-miR-146a-5p

prostate cancermetastasis"Loss of mir 146a function in hormone refractory pr ......"18174313Fluorescent in situ hybridization
hsa-miR-146a-5p

prostate cancerprogression"MiR 146a suppresses tumor growth and progression b ......"22161865Colony formation; MTT assay
hsa-miR-146a-5p

prostate cancerprogression"Aberrant expressions of some miRNAs like miR-221/2 ......"24386864
hsa-miR-146a-5p

prostate cancermetastasis"We identify that TGFβ1-related miR-143 miR-145 mi ......"24763824
hsa-miR-146a-5p

prostate cancerprogression; staging"Demethylation of the miR 146a promoter by 5 Aza 2' ......"24885368Western blot; Cell Proliferation Assay
hsa-miR-146a-5p

prostate cancerstaging; drug resistance"Following global miRNA profiling of cell line mode ......"25053345
hsa-miR-146a-5p

prostate cancerprogression"Association between genetic variant in hsa miR 146 ......"25084752
hsa-miR-146a-5p

prostate cancermotility"miR 146a functions as a tumor suppressor in prosta ......"25214035Colony formation; Luciferase
hsa-miR-146a-5p

thyroid cancertumorigenesis"MicroRNA miRNA microarray analysis has consistentl ......"18587330
hsa-miR-146a-5p

thyroid cancertumorigenesis"Our review of the literature strongly supports thi ......"21865360
hsa-miR-146a-5p

thyroid cancerpoor survival"MicroRNA 146a targets PRKCE to modulate papillary ......"23457043Luciferase
hsa-miR-146a-5p

thyroid cancerstaging; metastasis; tumorigenesis"Associations of miR 146a and miR 146b expression a ......"25524940



Reported gene related to hsa-miR-146a-5p

miRNAcancergenereportingPUBMED
hsa-miR-146a-5p

breast cancerEGFR"Furthermore the expressions of bax and cleaved-cas ......"25596948
hsa-miR-146a-5p

breast cancerEGFR"Here we report a previously unrecognized posttrans ......"25417703
hsa-miR-146a-5p

gastric cancerEGFR"The regulation of EGFR and IRAK1 by miR-146a was e ......"21632853
hsa-miR-146a-5p

liver cancerEGFR"Furthermore western blot showed that miR-146a mimi ......"24895573
hsa-miR-146a-5p

lung squamous cell cancerEGFR"In functional experiments miR-146a suppressed cell ......"23555954
hsa-miR-146a-5p

pancreatic cancerEGFR"Interestingly re-expression of miR-146a inhibited ......"25242818
hsa-miR-146a-5p

pancreatic cancerEGFR"Deregulation of miR 146a expression in a mouse mod ......"24839931
hsa-miR-146a-5p

prostate cancerEGFR"MiR 146a suppresses tumor growth and progression b ......"22161865
hsa-miR-146a-5p

colorectal cancerCTSG"Moreover a multivariate analysis showed that the C ......"23898084
hsa-miR-146a-5p

liver cancerCTSG"No significant relationships were observed between ......"21624236
hsa-miR-146a-5p

liver cancerCTSG"However we found that patients with genotype CG of ......"21861697
hsa-miR-146a-5p

lung cancerCTSG"For miR-146a rs2910164 individuals carrying hetero ......"26973201
hsa-miR-146a-5p

lung cancerCTSG"Conversely CG genotype of miR-146a appeared associ ......"21902575
hsa-miR-146a-5p

lung cancerCTSG"In line with this result the level of miR-146a exp ......"24144839
hsa-miR-146a-5p

melanomaCTSG"However there was no significant difference betwee ......"23222547
hsa-miR-146a-5p

breast cancerBRCA1"We report here the involvement of miR-146a and miR ......"21472990
hsa-miR-146a-5p

breast cancerBRCA1"Here we report a previously unrecognized posttrans ......"25417703
hsa-miR-146a-5p

breast cancerBRCA1"miR 146a and miR 638 in BRCA1 deficient triple neg ......"26835710
hsa-miR-146a-5p

liver cancerBRCA1"Furthermore we revealed that miR-146a promoted the ......"23671131
hsa-miR-146a-5p

ovarian cancerBRCA1"The predicted miR-146a target genes include BRCA1 ......"18660546
hsa-miR-146a-5p

breast cancerNFKB1"Expression of microRNA 146 suppresses NF kappaB ac ......"18504431
hsa-miR-146a-5p

gastric cancerNFKB1"By targeting components of several NF-kappaB-activ ......"22992343
hsa-miR-146a-5p

sarcomaNFKB1"Reporter studies identified two NF-kappaB sites in ......"20023696
hsa-miR-146a-5p

thyroid cancerNFKB1"Our results show that NF-kappaB contributes to ana ......"20061417
hsa-miR-146a-5p

acute myeloid leukemiaCXCR4"MicroRNA 146a and AMD3100 two ways to control CXCR ......"22829170
hsa-miR-146a-5p

breast cancerCXCR4"TRAIL induced miR 146a expression suppresses CXCR4 ......"23647548
hsa-miR-146a-5p

sarcomaCXCR4"Suppression of CXCR4 by KSHV and K13 was associate ......"20023696
hsa-miR-146a-5p

bladder cancerIRAK1"Functional analysis revealed that miR-146a rs29101 ......"22846912
hsa-miR-146a-5p

gastric cancerIRAK1"The regulation of EGFR and IRAK1 by miR-146a was e ......"21632853
hsa-miR-146a-5p

pancreatic cancerIRAK1"Interestingly re-expression of miR-146a inhibited ......"25242818
hsa-miR-146a-5p

breast cancerNFASC"53BP1 functions as a tumor suppressor in breast ca ......"23027628
hsa-miR-146a-5p

breast cancerNFASC"Expression of microRNA 146 suppresses NF kappaB ac ......"18504431
hsa-miR-146a-5p

gastric cancerNFASC"Celastrol induces apoptosis of gastric cancer cell ......"23706078
hsa-miR-146a-5p

gastric cancerPTGS2"We found that overexpression of microRNA-146a by t ......"25081668
hsa-miR-146a-5p

lung cancerPTGS2"The protein expression level of COX-2 in A549 cell ......"26902276
hsa-miR-146a-5p

lung cancerPTGS2"Regulation of COX 2 expression by miR 146a in lung ......"25047043
hsa-miR-146a-5p

gastric cancerSMAD4"SMAD4 was identified as a miR-146a target and was ......"27438138
hsa-miR-146a-5p

gastric cancerSMAD4"Increased miR 146a in gastric cancer directly targ ......"22020746
hsa-miR-146a-5p

liver cancerSMAD4"The results indicated that miR-146a regulated the ......"21982769
hsa-miR-146a-5p

gastric cancerUHRF1"We identified and verified miR-146a and miR-146b a ......"23982143
hsa-miR-146a-5p

gastric cancerUHRF1"The correlation between miR 146a C/G polymorphism ......"26896831
hsa-miR-146a-5p

kidney renal cell cancerUHRF1"The interaction between miR-146a-5p and their targ ......"26859141
hsa-miR-146a-5p

breast cancerBRMS1"BRMS1 significantly up-regulates miR-146a by 6- to ......"19190326
hsa-miR-146a-5p

breast cancerBRMS1"Concurrently BRMS1 increased expression of metasta ......"19585508
hsa-miR-146a-5p

breast cancerCASP3"All the results demonstrated that quercetin exhibi ......"25596948
hsa-miR-146a-5p

prostate cancerCASP3"Moreover caspase 3 activity was stimulated by miR- ......"26306811
hsa-miR-146a-5p

kidney renal cell cancerIL8"The interaction between miR-146a-5p and their targ ......"26859141
hsa-miR-146a-5p

lung cancerIL8"The mRNA expression levels of IL-8 MCP-1 and GRO- ......"26902276
hsa-miR-146a-5p

colorectal cancerNUMB"miR-146a targets Numb to stabilize β-catenin whic ......"24561623
hsa-miR-146a-5p

melanomaNUMB"We show these oncogenic activities are due to miR- ......"24550252
hsa-miR-146a-5p

prostate cancerROCK1"In mechanic analyses we found that miR-146a inhibi ......"26306811
hsa-miR-146a-5p

prostate cancerROCK1"Transfection of mir-146a which perpetually express ......"18174313
hsa-miR-146a-5p

bladder cancerTRAF6"Functional analysis revealed that miR-146a rs29101 ......"22846912
hsa-miR-146a-5p

lymphomaTRAF6"MicroRNA 146a downregulates NFκB activity via tar ......"21610143
hsa-miR-146a-5p

gastric cancerABCC4"Using target prediction algorithms luciferase repo ......"22020746
hsa-miR-146a-5p

liver cancerAPC"The expression levels of genes including miR-146a ......"25608619
hsa-miR-146a-5p

breast cancerAR"To study the cellular response to miR-146a upregul ......"25123132
hsa-miR-146a-5p

cervical and endocervical cancerARHGEF15"The oncogenic proteins E6 E7 and E5 expressed by H ......"23189617
hsa-miR-146a-5p

breast cancerARHGEF7"In this study miR-146a and miR-222 were shown to b ......"26689540
hsa-miR-146a-5p

thyroid cancerATM"Importantly the miR-146a resulted in overexpressio ......"20061417
hsa-miR-146a-5p

breast cancerBAX"Furthermore the expressions of bax and cleaved-cas ......"25596948
hsa-miR-146a-5p

melanomaBRAF"In this study we identify a microRNA miR-146a that ......"24550252
hsa-miR-146a-5p

ovarian cancerBRCA2"The predicted miR-146a target genes include BRCA1 ......"18660546
hsa-miR-146a-5p

breast cancerCCDC6"The SNP rs2910164 in miR146a a G to C polymorphism ......"26476291
hsa-miR-146a-5p

lung cancerCCL2"The mRNA expression levels of IL-8 MCP-1 and GRO- ......"26902276
hsa-miR-146a-5p

lung cancerCSE"Under the premise of smoke inhalation injury to ex ......"26902276
hsa-miR-146a-5p

pancreatic cancerDCX"Aberrant elevated microRNA 146a in dendritic cells ......"22311263
hsa-miR-146a-5p

lung cancerEGF"MiR-146a down-regulates epidermal growth factor re ......"24144839
hsa-miR-146a-5p

breast cancerERBB2"Functional SNP in stem of mir 146a affects Her2 st ......"27434289
hsa-miR-146a-5p

lung cancerFAF2"Under the premise of smoke inhalation injury to ex ......"26902276
hsa-miR-146a-5p

lung cancerFAS"Effects of microRNA 146a on Fas associated factor ......"26902276
hsa-miR-146a-5p

gastric cancerGAST"The expression of miR-146a was evaluated by quanti ......"22992343
hsa-miR-146a-5p

gastric cancerGCA"The single nucleotide polymorphism SNP rs2910164 G ......"27105532
hsa-miR-146a-5p

thyroid cancerGRP"The miR-146a polymorphisms were shown to be signif ......"26722556
hsa-miR-146a-5p

prostate cancerIBSP"The methylation levels of miR-146a promoter region ......"24885368
hsa-miR-146a-5p

melanomaIGKV3-7"Upregulation of miR-21 and miR-146a was also detec ......"25951497
hsa-miR-146a-5p

breast cancerIL6"We investigated expressions of miR-146a miR-146b a ......"26406414
hsa-miR-146a-5p

lung squamous cell cancerINSR"MicroRNA 146a inhibits epithelial mesenchymal tran ......"26238771
hsa-miR-146a-5p

gastric cancerL1CAM"Taken together our results provide evidence that m ......"22711166
hsa-miR-146a-5p

pancreatic cancerMIA"The present study identifies a series of miRNAs wh ......"23073476
hsa-miR-146a-5p

lung cancerMIF"Effect and molecular mechanism of mir 146a on prol ......"27569893
hsa-miR-146a-5p

breast cancerMMP16"Catalpol suppresses proliferation and facilitates ......"26458573
hsa-miR-146a-5p

prostate cancerMMP2"Also miR-146a inhibited the expression of MMP2 one ......"22161865
hsa-miR-146a-5p

head and neck cancerMMP8"Odds ratios ORs with 95% confidence interval CIs w ......"26277865
hsa-miR-146a-5p

breast cancerMTSS1"Breast cancer metastasis suppressor 1 up regulates ......"19190326
hsa-miR-146a-5p

kidney renal cell cancerNOA1"Loss of inducible nitric oxide synthase expression ......"20709800
hsa-miR-146a-5p

gastric cancerNOL3"We also found that miR-146a inhibited apoptosis of ......"22020746
hsa-miR-146a-5p

kidney renal cell cancerNOS2"This effect is mediated by the microRNA miR-146a a ......"20709800
hsa-miR-146a-5p

melanomaNRAS"In this study we identify a microRNA miR-146a that ......"24550252
hsa-miR-146a-5p

melanomaOCM"Both MUM2B and OCM1 cells expressed and secreted N ......"27565163
hsa-miR-146a-5p

gastric cancerPDC"To investigate the association between the polymor ......"26896831
hsa-miR-146a-5p

liver cancerPDGFRA"MiR 146a enhances angiogenic activity of endotheli ......"23671131
hsa-miR-146a-5p

prostate cancerPDZD2"We demonstrated that miR-146a was down-regulated i ......"26306811
hsa-miR-146a-5p

thyroid cancerPRKCE"MicroRNA 146a targets PRKCE to modulate papillary ......"23457043
hsa-miR-146a-5p

thyroid cancerPTTG1"Are pre miR 146a and PTTG1 associated with papilla ......"24145614
hsa-miR-146a-5p

prostate cancerRAC1"miR 146a functions as a tumor suppressor in prosta ......"25214035
hsa-miR-146a-5p

thyroid cancerRARB"Direct interaction between miRs and RARB was deter ......"27011326
hsa-miR-146a-5p

breast cancerRHOA"MicroRNA 146a inhibits cell migration and invasion ......"27175941
hsa-miR-146a-5p

ovarian cancerROS1"Overexpression of miR-146a increased the reactive ......"27131313
hsa-miR-146a-5p

prostate cancerRTCA"Effects of miR-146a on cell growth and migration w ......"25214035
hsa-miR-146a-5p

colorectal cancerSCD"miR-146a targets Numb to stabilize β-catenin whic ......"24561623
hsa-miR-146a-5p

lymphomaSCYL1"These results suggest that miR-146a might function ......"21610143
hsa-miR-146a-5p

colorectal cancerSNAI1"MicroRNA 146a directs the symmetric division of Sn ......"24561623
hsa-miR-146a-5p

ovarian cancerSOD2"miR 146a Inhibits Proliferation and Enhances Chemo ......"27131313
hsa-miR-146a-5p

liver cancerSTAT3"miR 146a is directly regulated by STAT3 in human h ......"25607648
hsa-miR-146a-5p

thyroid cancerTHRB"Direct interaction with THRB was shown for miR-21 ......"21159845
hsa-miR-146a-5p

lymphomaTNF"TNF receptor-associated factor 6 a target of miR-1 ......"21610143
hsa-miR-146a-5p

breast cancerTP53"Overexpression of miR 146a in basal like breast ca ......"25123132
hsa-miR-146a-5p

breast cancerTP53BP1"53BP1 functions as a tumor suppressor in breast ca ......"23027628
hsa-miR-146a-5p

prostate cancerTUBA1B"Our findings suggest that ubiquitous loss of miR-1 ......"22161865
hsa-miR-146a-5p

liver cancerVEGFA"microRNA 146a inhibits cancer metastasis by downre ......"25608619
hsa-miR-146a-5p

gastric cancerWASF2"MicroRNA 146a acts as a metastasis suppressor in g ......"23435376
hsa-miR-146a-5p

breast cancerYARS"We compared the expression levels of breast cancer ......"23898484



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-146a-5p
BGLAP
9 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; OV; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.071; TCGA BRCA -0.135; TCGA HNSC -0.142; TCGA LGG -0.097; TCGA LUAD -0.137; TCGA LUSC -0.083; TCGA OV -0.089; TCGA THCA -0.066; TCGA STAD -0.128
hsa-miR-146a-5p
ERBB4
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; OV; SARC; THCA; STAD
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA BLCA -0.27; TCGA BRCA -0.772; TCGA CESC -0.46; TCGA KIRC -1.009; TCGA KIRP -1.242; TCGA LGG -0.141; TCGA OV -0.2; TCGA SARC -0.191; TCGA THCA -0.236; TCGA STAD -0.287
hsa-miR-146a-5p
MTUS2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; OV; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.329; TCGA BRCA -0.184; TCGA CESC -0.388; TCGA ESCA -0.192; TCGA HNSC -0.141; TCGA KIRC -0.218; TCGA KIRP -0.319; TCGA OV -0.234; TCGA PAAD -0.516; TCGA SARC -0.631; TCGA STAD -0.756; TCGA UCEC -0.378
hsa-miR-146a-5p
SMAD4
12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.082; TCGA CESC -0.097; TCGA ESCA -0.085; TCGA KIRC -0.069; TCGA KIRP -0.09; TCGA LGG -0.123; TCGA LUAD -0.086; TCGA PAAD -0.117; TCGA PRAD -0.074; TCGA SARC -0.157; TCGA STAD -0.111; TCGA UCEC -0.103
hsa-miR-146a-5p
PRKAA2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.298; TCGA BRCA -0.303; TCGA CESC -0.51; TCGA COAD -0.879; TCGA ESCA -0.464; TCGA KIRC -0.224; TCGA KIRP -0.157; TCGA LGG -0.136; TCGA LUSC -0.381; TCGA PRAD -0.097; TCGA SARC -0.61; TCGA THCA -0.176; TCGA STAD -0.857; TCGA UCEC -0.153
hsa-miR-146a-5p
RGS5
10 cancers: BLCA; BRCA; COAD; KIRP; LIHC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.206; TCGA BRCA -0.245; TCGA COAD -0.362; TCGA KIRP -0.333; TCGA LIHC -0.135; TCGA OV -0.059; TCGA SARC -0.168; TCGA THCA -0.319; TCGA STAD -0.316; TCGA UCEC -0.081
hsa-miR-146a-5p
FZD3
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.159; TCGA CESC -0.373; TCGA HNSC -0.122; TCGA KIRC -0.196; TCGA KIRP -0.124; TCGA LUAD -0.252; TCGA LUSC -0.147; TCGA PAAD -0.197; TCGA THCA -0.11; TCGA STAD -0.196; TCGA UCEC -0.066
hsa-miR-146a-5p
THRB
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.285; TCGA BRCA -0.186; TCGA CESC -0.169; TCGA COAD -0.471; TCGA HNSC -0.171; TCGA KIRC -0.41; TCGA KIRP -0.332; TCGA LIHC -0.123; TCGA LUSC -0.221; TCGA PRAD -0.066; TCGA SARC -0.303; TCGA STAD -0.367; TCGA UCEC -0.46
hsa-miR-146a-5p
ZNF540
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; OV; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.087; TCGA BRCA -0.056; TCGA COAD -0.131; TCGA KIRC -0.233; TCGA KIRP -0.183; TCGA LGG -0.146; TCGA LIHC -0.067; TCGA OV -0.211; TCGA SARC -0.269; TCGA THCA -0.235; TCGA UCEC -0.152
hsa-miR-146a-5p
IBTK
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; OV; PAAD
MirTarget
TCGA BLCA -0.051; TCGA BRCA -0.11; TCGA CESC -0.079; TCGA KIRC -0.095; TCGA KIRP -0.087; TCGA LIHC -0.086; TCGA LUAD -0.09; TCGA OV -0.052; TCGA PAAD -0.075
hsa-miR-146a-5p
ZNF253
9 cancers: BLCA; KIRC; KIRP; LGG; LIHC; OV; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.077; TCGA KIRC -0.095; TCGA KIRP -0.15; TCGA LGG -0.069; TCGA LIHC -0.068; TCGA OV -0.129; TCGA PAAD -0.093; TCGA SARC -0.124; TCGA THCA -0.124
hsa-miR-146a-5p
DCAF5
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; OV; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.095; TCGA BRCA -0.098; TCGA CESC -0.076; TCGA ESCA -0.099; TCGA HNSC -0.116; TCGA KIRP -0.082; TCGA LGG -0.07; TCGA LUSC -0.077; TCGA OV -0.058; TCGA THCA -0.05; TCGA STAD -0.108; TCGA UCEC -0.07
hsa-miR-146a-5p
ARL10
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.104; TCGA CESC -0.185; TCGA COAD -0.437; TCGA ESCA -0.293; TCGA HNSC -0.099; TCGA KIRP -0.132; TCGA LUSC -0.141; TCGA SARC -0.185; TCGA STAD -0.28; TCGA UCEC -0.262
hsa-miR-146a-5p
DTNA
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.173; TCGA CESC -0.171; TCGA COAD -0.628; TCGA ESCA -0.542; TCGA HNSC -0.222; TCGA LUSC -0.188; TCGA OV -0.233; TCGA PAAD -0.303; TCGA SARC -0.273; TCGA STAD -0.692; TCGA UCEC -0.315
hsa-miR-146a-5p
ZNF512B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.051; TCGA CESC -0.084; TCGA COAD -0.295; TCGA ESCA -0.257; TCGA LGG -0.068; TCGA LIHC -0.065; TCGA LUAD -0.089; TCGA OV -0.059; TCGA PAAD -0.092; TCGA SARC -0.16; TCGA THCA -0.084; TCGA STAD -0.146; TCGA UCEC -0.082
hsa-miR-146a-5p
ZNF10
10 cancers: BLCA; KIRC; KIRP; LIHC; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.15; TCGA KIRC -0.226; TCGA KIRP -0.176; TCGA LIHC -0.065; TCGA OV -0.157; TCGA PAAD -0.156; TCGA SARC -0.221; TCGA THCA -0.169; TCGA STAD -0.213; TCGA UCEC -0.086
hsa-miR-146a-5p
LANCL1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.06; TCGA BRCA -0.086; TCGA CESC -0.071; TCGA COAD -0.068; TCGA ESCA -0.068; TCGA HNSC -0.065; TCGA KIRC -0.146; TCGA KIRP -0.148; TCGA LIHC -0.078; TCGA LUAD -0.064; TCGA LUSC -0.063; TCGA OV -0.085; TCGA PRAD -0.064; TCGA SARC -0.17; TCGA STAD -0.099; TCGA UCEC -0.112
hsa-miR-146a-5p
SORT1
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.103; TCGA BRCA -0.073; TCGA CESC -0.134; TCGA KIRC -0.33; TCGA KIRP -0.138; TCGA LUAD -0.067; TCGA LUSC -0.123; TCGA PAAD -0.084; TCGA SARC -0.172; TCGA THCA -0.107; TCGA STAD -0.15
hsa-miR-146a-5p
RHOBTB3
13 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.103; TCGA BRCA -0.141; TCGA CESC -0.328; TCGA KIRC -0.491; TCGA KIRP -0.465; TCGA LGG -0.084; TCGA LIHC -0.089; TCGA LUAD -0.114; TCGA OV -0.149; TCGA PAAD -0.154; TCGA PRAD -0.074; TCGA STAD -0.333; TCGA UCEC -0.149
hsa-miR-146a-5p
MARK4
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.074; TCGA CESC -0.079; TCGA ESCA -0.119; TCGA HNSC -0.159; TCGA LGG -0.08; TCGA LIHC -0.051; TCGA LUAD -0.109; TCGA LUSC -0.059; TCGA OV -0.084; TCGA PAAD -0.057; TCGA PRAD -0.057; TCGA STAD -0.063; TCGA UCEC -0.071
hsa-miR-146a-5p
ANKS1A
12 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.063; TCGA COAD -0.069; TCGA ESCA -0.058; TCGA KIRC -0.214; TCGA KIRP -0.157; TCGA LUAD -0.094; TCGA LUSC -0.123; TCGA OV -0.084; TCGA SARC -0.096; TCGA THCA -0.088; TCGA STAD -0.212; TCGA UCEC -0.084
hsa-miR-146a-5p
PLXNA2
9 cancers: BLCA; BRCA; HNSC; KIRP; LUSC; PAAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.149; TCGA BRCA -0.065; TCGA HNSC -0.081; TCGA KIRP -0.256; TCGA LUSC -0.141; TCGA PAAD -0.14; TCGA SARC -0.128; TCGA THCA -0.127; TCGA STAD -0.084
hsa-miR-146a-5p
MTMR3
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.074; TCGA CESC -0.057; TCGA ESCA -0.083; TCGA KIRC -0.066; TCGA KIRP -0.106; TCGA LUSC -0.105; TCGA PAAD -0.092; TCGA PRAD -0.056; TCGA SARC -0.08
hsa-miR-146a-5p
DIDO1
9 cancers: BLCA; BRCA; COAD; LUAD; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.051; TCGA BRCA -0.06; TCGA COAD -0.08; TCGA LUAD -0.058; TCGA OV -0.089; TCGA SARC -0.107; TCGA THCA -0.071; TCGA STAD -0.05; TCGA UCEC -0.083
hsa-miR-146a-5p
RND2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.154; TCGA BRCA -0.206; TCGA CESC -0.306; TCGA COAD -0.461; TCGA ESCA -0.363; TCGA KIRC -0.218; TCGA LUAD -0.139; TCGA LUSC -0.321; TCGA OV -0.321; TCGA PAAD -0.392; TCGA SARC -0.241; TCGA THCA -0.286; TCGA STAD -0.502; TCGA UCEC -0.346
hsa-miR-146a-5p
C1orf21
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; OV; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.147; TCGA BRCA -0.267; TCGA ESCA -0.104; TCGA HNSC -0.103; TCGA KIRC -0.122; TCGA LIHC -0.12; TCGA OV -0.108; TCGA PRAD -0.098; TCGA SARC -0.169; TCGA STAD -0.234
hsa-miR-146a-5p
PAIP2B
11 cancers: BLCA; ESCA; KIRC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.076; TCGA ESCA -0.292; TCGA KIRC -0.219; TCGA LUAD -0.16; TCGA OV -0.15; TCGA PAAD -0.298; TCGA PRAD -0.098; TCGA SARC -0.138; TCGA THCA -0.209; TCGA STAD -0.191; TCGA UCEC -0.24
hsa-miR-146a-5p
ARPP19
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.068; TCGA BRCA -0.094; TCGA CESC -0.075; TCGA ESCA -0.088; TCGA HNSC -0.056; TCGA KIRC -0.068; TCGA KIRP -0.078; TCGA LIHC -0.057; TCGA LUAD -0.152; TCGA LUSC -0.081; TCGA PAAD -0.06; TCGA SARC -0.099; TCGA STAD -0.118
hsa-miR-146a-5p
DSTYK
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.074; TCGA CESC -0.104; TCGA COAD -0.091; TCGA ESCA -0.115; TCGA HNSC -0.073; TCGA KIRC -0.143; TCGA KIRP -0.146; TCGA LUAD -0.107; TCGA LUSC -0.132; TCGA OV -0.057; TCGA PAAD -0.078; TCGA SARC -0.12; TCGA THCA -0.113; TCGA STAD -0.167; TCGA UCEC -0.115
hsa-miR-146a-5p
ABI2
12 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.067; TCGA CESC -0.085; TCGA COAD -0.089; TCGA KIRC -0.109; TCGA KIRP -0.138; TCGA LUSC -0.086; TCGA OV -0.071; TCGA PAAD -0.097; TCGA SARC -0.158; TCGA THCA -0.098; TCGA STAD -0.209; TCGA UCEC -0.124
hsa-miR-146a-5p
FTO
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.077; TCGA BRCA -0.095; TCGA CESC -0.064; TCGA COAD -0.08; TCGA ESCA -0.124; TCGA HNSC -0.081; TCGA LIHC -0.067; TCGA LUSC -0.068; TCGA PAAD -0.087; TCGA SARC -0.072; TCGA THCA -0.064; TCGA STAD -0.189; TCGA UCEC -0.057
hsa-miR-146a-5p
ZCCHC14
11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.089; TCGA COAD -0.079; TCGA ESCA -0.056; TCGA HNSC -0.08; TCGA LIHC -0.088; TCGA LUSC -0.106; TCGA OV -0.069; TCGA PAAD -0.052; TCGA SARC -0.098; TCGA STAD -0.103; TCGA UCEC -0.078
hsa-miR-146a-5p
SSBP2
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.104; TCGA BRCA -0.161; TCGA ESCA -0.265; TCGA KIRC -0.064; TCGA KIRP -0.093; TCGA LGG -0.154; TCGA OV -0.084; TCGA SARC -0.236; TCGA THCA -0.089; TCGA STAD -0.375; TCGA UCEC -0.172
hsa-miR-146a-5p
KCTD15
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.124; TCGA BRCA -0.093; TCGA COAD -0.253; TCGA ESCA -0.408; TCGA HNSC -0.11; TCGA KIRC -0.112; TCGA KIRP -0.427; TCGA LGG -0.223; TCGA LUSC -0.154; TCGA PAAD -0.089; TCGA SARC -0.352; TCGA THCA -0.254; TCGA STAD -0.399; TCGA UCEC -0.166
hsa-miR-146a-5p
KCNB1
9 cancers: BLCA; COAD; ESCA; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.311; TCGA COAD -0.781; TCGA ESCA -0.407; TCGA LIHC -0.523; TCGA PAAD -0.41; TCGA PRAD -0.135; TCGA SARC -0.513; TCGA STAD -1.109; TCGA UCEC -0.422
hsa-miR-146a-5p
UBR1
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; SARC; STAD
mirMAP
TCGA BLCA -0.057; TCGA BRCA -0.095; TCGA CESC -0.102; TCGA KIRC -0.096; TCGA KIRP -0.161; TCGA LUAD -0.071; TCGA LUSC -0.064; TCGA SARC -0.149; TCGA STAD -0.07
hsa-miR-146a-5p
NFASC
10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.115; TCGA COAD -0.243; TCGA ESCA -0.397; TCGA HNSC -0.121; TCGA KIRP -0.289; TCGA PAAD -0.287; TCGA SARC -0.532; TCGA THCA -0.194; TCGA STAD -0.618; TCGA UCEC -0.23
hsa-miR-146a-5p
ZNF704
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.21; TCGA BRCA -0.088; TCGA CESC -0.265; TCGA COAD -0.213; TCGA KIRC -0.147; TCGA KIRP -0.367; TCGA LUAD -0.124; TCGA LUSC -0.208; TCGA SARC -0.415; TCGA THCA -0.139; TCGA STAD -0.324; TCGA UCEC -0.2
hsa-miR-146a-5p
MECP2
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.064; TCGA BRCA -0.06; TCGA COAD -0.095; TCGA KIRC -0.087; TCGA KIRP -0.108; TCGA SARC -0.062; TCGA THCA -0.074; TCGA STAD -0.172; TCGA UCEC -0.087
hsa-miR-146a-5p
AR
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.321; TCGA BRCA -0.608; TCGA COAD -0.498; TCGA ESCA -0.305; TCGA LGG -0.48; TCGA LIHC -0.423; TCGA SARC -0.614; TCGA THCA -0.309; TCGA STAD -0.672; TCGA UCEC -0.298
hsa-miR-146a-5p
OTUD3
9 cancers: BLCA; KIRP; LGG; LUSC; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.13; TCGA KIRP -0.142; TCGA LGG -0.135; TCGA LUSC -0.082; TCGA OV -0.098; TCGA SARC -0.14; TCGA THCA -0.058; TCGA STAD -0.077; TCGA UCEC -0.114
hsa-miR-146a-5p
LONRF2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.424; TCGA BRCA -0.517; TCGA CESC -0.529; TCGA COAD -1.069; TCGA ESCA -0.367; TCGA KIRC -0.574; TCGA KIRP -0.491; TCGA PAAD -0.234; TCGA PRAD -0.109; TCGA SARC -0.935; TCGA THCA -0.255; TCGA STAD -0.756; TCGA UCEC -0.299
hsa-miR-146a-5p
PDE7B
10 cancers: BLCA; CESC; COAD; KIRC; KIRP; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.229; TCGA CESC -0.237; TCGA COAD -0.285; TCGA KIRC -0.296; TCGA KIRP -0.295; TCGA OV -0.141; TCGA SARC -0.191; TCGA THCA -0.516; TCGA STAD -0.426; TCGA UCEC -0.271
hsa-miR-146a-5p
ZHX3
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.093; TCGA BRCA -0.126; TCGA CESC -0.067; TCGA ESCA -0.101; TCGA HNSC -0.166; TCGA KIRC -0.273; TCGA LGG -0.07; TCGA LIHC -0.198; TCGA LUSC -0.093; TCGA OV -0.066; TCGA PAAD -0.178; TCGA PRAD -0.054; TCGA SARC -0.07; TCGA THCA -0.138; TCGA STAD -0.268; TCGA UCEC -0.125
hsa-miR-146a-5p
CHD9
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.076; TCGA COAD -0.072; TCGA ESCA -0.089; TCGA HNSC -0.059; TCGA KIRC -0.064; TCGA KIRP -0.153; TCGA LIHC -0.092; TCGA LUSC -0.089; TCGA SARC -0.096; TCGA STAD -0.122; TCGA UCEC -0.083
hsa-miR-146a-5p
PACS2
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.085; TCGA BRCA -0.058; TCGA CESC -0.093; TCGA ESCA -0.066; TCGA HNSC -0.111; TCGA LUAD -0.063; TCGA LUSC -0.117; TCGA PAAD -0.076; TCGA STAD -0.087
hsa-miR-146a-5p
MXRA7
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.095; TCGA BRCA -0.069; TCGA CESC -0.209; TCGA COAD -0.3; TCGA ESCA -0.354; TCGA HNSC -0.204; TCGA KIRC -0.115; TCGA LUSC -0.134; TCGA OV -0.128; TCGA PAAD -0.18; TCGA SARC -0.096; TCGA THCA -0.094; TCGA STAD -0.471; TCGA UCEC -0.184
hsa-miR-146a-5p
ZNF793
11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.138; TCGA COAD -0.262; TCGA ESCA -0.206; TCGA KIRC -0.157; TCGA KIRP -0.202; TCGA LGG -0.121; TCGA OV -0.108; TCGA SARC -0.42; TCGA THCA -0.129; TCGA STAD -0.307; TCGA UCEC -0.07
hsa-miR-146a-5p
ZBTB10
11 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.082; TCGA CESC -0.341; TCGA COAD -0.227; TCGA KIRC -0.129; TCGA KIRP -0.188; TCGA LGG -0.082; TCGA LUAD -0.148; TCGA PRAD -0.1; TCGA SARC -0.228; TCGA STAD -0.261; TCGA UCEC -0.148
hsa-miR-146a-5p
TAF9B
9 cancers: BLCA; BRCA; COAD; KIRP; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.082; TCGA BRCA -0.159; TCGA COAD -0.132; TCGA KIRP -0.101; TCGA PAAD -0.145; TCGA SARC -0.165; TCGA THCA -0.064; TCGA STAD -0.245; TCGA UCEC -0.094
hsa-miR-146a-5p
ZBTB16
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC
RAID
TCGA BLCA -0.209; TCGA BRCA -0.266; TCGA COAD -0.59; TCGA KIRC -0.225; TCGA LIHC -0.288; TCGA PRAD -0.139; TCGA SARC -0.367; TCGA THCA -0.147; TCGA STAD -0.717; TCGA UCEC -0.222
hsa-miR-146a-5p
OLFML2A
10 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.188; TCGA COAD -0.255; TCGA ESCA -0.122; TCGA HNSC -0.138; TCGA KIRP -0.292; TCGA LUAD -0.1; TCGA LUSC -0.118; TCGA THCA -0.107; TCGA STAD -0.284; TCGA UCEC -0.207
hsa-miR-146a-5p
MMP16
9 cancers: BRCA; CESC; COAD; HNSC; KIRP; OV; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BRCA -0.202; TCGA CESC -0.323; TCGA COAD -0.511; TCGA HNSC -0.311; TCGA KIRP -0.182; TCGA OV -0.141; TCGA SARC -0.271; TCGA STAD -0.477; TCGA UCEC -0.241
hsa-miR-146a-5p
GOLM1
9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA
MirTarget
TCGA BRCA -0.127; TCGA CESC -0.152; TCGA KIRC -0.283; TCGA KIRP -0.139; TCGA LGG -0.131; TCGA LUAD -0.142; TCGA OV -0.053; TCGA PRAD -0.101; TCGA THCA -0.074
hsa-miR-146a-5p
TRIM37
10 cancers: BRCA; CESC; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
MirTarget
TCGA BRCA -0.053; TCGA CESC -0.069; TCGA ESCA -0.077; TCGA LGG -0.063; TCGA LIHC -0.051; TCGA LUAD -0.152; TCGA LUSC -0.09; TCGA PAAD -0.088; TCGA SARC -0.095; TCGA STAD -0.063
hsa-miR-146a-5p
WWC2
9 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.112; TCGA CESC -0.2; TCGA COAD -0.242; TCGA HNSC -0.115; TCGA KIRC -0.245; TCGA KIRP -0.25; TCGA THCA -0.184; TCGA STAD -0.176; TCGA UCEC -0.17
hsa-miR-146a-5p
BCORL1
12 cancers: BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.078; TCGA CESC -0.145; TCGA COAD -0.148; TCGA HNSC -0.116; TCGA LGG -0.083; TCGA LUAD -0.108; TCGA LUSC -0.172; TCGA OV -0.064; TCGA SARC -0.105; TCGA THCA -0.088; TCGA STAD -0.112; TCGA UCEC -0.093
hsa-miR-146a-5p
VAT1
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC
MirTarget
TCGA BRCA -0.079; TCGA CESC -0.144; TCGA COAD -0.109; TCGA ESCA -0.133; TCGA HNSC -0.172; TCGA LUSC -0.144; TCGA OV -0.059; TCGA STAD -0.155; TCGA UCEC -0.094
hsa-miR-146a-5p
MLLT1
10 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.066; TCGA ESCA -0.063; TCGA KIRC -0.057; TCGA KIRP -0.052; TCGA LIHC -0.069; TCGA OV -0.065; TCGA SARC -0.069; TCGA THCA -0.071; TCGA STAD -0.069; TCGA UCEC -0.065
hsa-miR-146a-5p
CXXC4
9 cancers: BRCA; COAD; LGG; LUAD; OV; PAAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.177; TCGA COAD -0.2; TCGA LGG -0.163; TCGA LUAD -0.35; TCGA OV -0.28; TCGA PAAD -0.342; TCGA SARC -0.208; TCGA THCA -0.524; TCGA STAD -0.351
hsa-miR-146a-5p
USP47
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.07; TCGA CESC -0.072; TCGA HNSC -0.078; TCGA KIRC -0.053; TCGA KIRP -0.104; TCGA OV -0.085; TCGA SARC -0.068; TCGA THCA -0.075; TCGA STAD -0.096; TCGA UCEC -0.065
hsa-miR-146a-5p
SYT1
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; STAD; UCEC
MirTarget
TCGA BRCA -0.386; TCGA CESC -0.273; TCGA COAD -0.31; TCGA HNSC -0.38; TCGA KIRC -0.535; TCGA KIRP -0.498; TCGA LUAD -0.27; TCGA LUSC -0.219; TCGA OV -0.183; TCGA STAD -0.584; TCGA UCEC -0.329
hsa-miR-146a-5p
IGFBP5
11 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; OV; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.196; TCGA CESC -0.268; TCGA COAD -0.525; TCGA ESCA -0.213; TCGA KIRC -0.366; TCGA KIRP -0.548; TCGA LUAD -0.165; TCGA OV -0.186; TCGA SARC -0.263; TCGA STAD -0.346; TCGA UCEC -0.414
hsa-miR-146a-5p
WNT3
9 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC
MirTarget
TCGA BRCA -0.202; TCGA ESCA -0.207; TCGA HNSC -0.243; TCGA LGG -0.207; TCGA LIHC -0.113; TCGA LUAD -0.18; TCGA LUSC -0.199; TCGA PRAD -0.081; TCGA SARC -0.236
hsa-miR-146a-5p
CDON
9 cancers: BRCA; COAD; LGG; OV; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.197; TCGA COAD -0.285; TCGA LGG -0.154; TCGA OV -0.173; TCGA PAAD -0.172; TCGA SARC -0.245; TCGA THCA -0.337; TCGA STAD -0.567; TCGA UCEC -0.308
hsa-miR-146a-5p
RGP1
9 cancers: BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC
mirMAP
TCGA BRCA -0.069; TCGA CESC -0.137; TCGA KIRC -0.156; TCGA KIRP -0.238; TCGA LUAD -0.087; TCGA LUSC -0.173; TCGA PAAD -0.137; TCGA SARC -0.182; TCGA UCEC -0.07
hsa-miR-146a-5p
USP22
10 cancers: BRCA; CESC; KIRC; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC
mirMAP
TCGA BRCA -0.09; TCGA CESC -0.07; TCGA KIRC -0.062; TCGA LUAD -0.104; TCGA LUSC -0.081; TCGA OV -0.084; TCGA PAAD -0.113; TCGA SARC -0.147; TCGA THCA -0.08; TCGA UCEC -0.052
hsa-miR-146a-5p
ADCY1
13 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.426; TCGA CESC -0.214; TCGA COAD -0.28; TCGA ESCA -0.187; TCGA KIRC -0.36; TCGA KIRP -0.668; TCGA OV -0.24; TCGA PAAD -0.387; TCGA PRAD -0.12; TCGA SARC -0.195; TCGA THCA -0.427; TCGA STAD -0.147; TCGA UCEC -0.193
hsa-miR-146a-5p
KIAA1958
13 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA
mirMAP
TCGA BRCA -0.079; TCGA CESC -0.108; TCGA COAD -0.082; TCGA KIRC -0.132; TCGA KIRP -0.266; TCGA LGG -0.131; TCGA LIHC -0.081; TCGA LUAD -0.167; TCGA LUSC -0.21; TCGA OV -0.081; TCGA PAAD -0.234; TCGA SARC -0.29; TCGA THCA -0.121
hsa-miR-146a-5p
PRTG
10 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; OV; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.267; TCGA CESC -0.357; TCGA COAD -0.598; TCGA KIRC -0.587; TCGA KIRP -0.416; TCGA LGG -0.277; TCGA OV -0.227; TCGA THCA -0.321; TCGA STAD -0.403; TCGA UCEC -0.318
hsa-miR-146a-5p
TBC1D16
12 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; STAD
mirMAP
TCGA BRCA -0.102; TCGA CESC -0.121; TCGA COAD -0.105; TCGA HNSC -0.176; TCGA KIRC -0.331; TCGA KIRP -0.184; TCGA LIHC -0.147; TCGA LUAD -0.08; TCGA LUSC -0.103; TCGA OV -0.097; TCGA THCA -0.055; TCGA STAD -0.061
hsa-miR-146a-5p
SGCD
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.205; TCGA CESC -0.268; TCGA COAD -0.72; TCGA ESCA -0.397; TCGA HNSC -0.3; TCGA LGG -0.1; TCGA PRAD -0.197; TCGA SARC -0.228; TCGA STAD -0.538; TCGA UCEC -0.467
hsa-miR-146a-5p
TANC2
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BRCA -0.213; TCGA CESC -0.096; TCGA ESCA -0.189; TCGA HNSC -0.104; TCGA KIRC -0.147; TCGA KIRP -0.171; TCGA LGG -0.067; TCGA LUSC -0.155; TCGA PAAD -0.102; TCGA STAD -0.173; TCGA UCEC -0.237
hsa-miR-146a-5p
CUEDC1
9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BRCA -0.161; TCGA CESC -0.136; TCGA ESCA -0.105; TCGA KIRC -0.126; TCGA LGG -0.082; TCGA LUSC -0.067; TCGA PAAD -0.121; TCGA SARC -0.067; TCGA STAD -0.203
hsa-miR-146a-5p
TMEM136
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.104; TCGA CESC -0.223; TCGA COAD -0.103; TCGA ESCA -0.186; TCGA HNSC -0.089; TCGA KIRC -0.108; TCGA KIRP -0.096; TCGA LUSC -0.134; TCGA PRAD -0.099; TCGA SARC -0.157; TCGA THCA -0.05; TCGA STAD -0.29; TCGA UCEC -0.172
hsa-miR-146a-5p
CYB5D1
10 cancers: BRCA; CESC; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.166; TCGA CESC -0.065; TCGA ESCA -0.077; TCGA LIHC -0.05; TCGA LUSC -0.1; TCGA PAAD -0.223; TCGA PRAD -0.081; TCGA SARC -0.102; TCGA THCA -0.21; TCGA STAD -0.085
hsa-miR-146a-5p
SHISA6
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.292; TCGA COAD -0.398; TCGA ESCA -0.293; TCGA HNSC -0.255; TCGA KIRC -0.454; TCGA KIRP -0.421; TCGA PRAD -0.135; TCGA THCA -0.408; TCGA STAD -0.191
hsa-miR-146a-5p
OSBPL1A
10 cancers: CESC; ESCA; HNSC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA CESC -0.127; TCGA ESCA -0.13; TCGA HNSC -0.113; TCGA LUAD -0.144; TCGA LUSC -0.126; TCGA OV -0.072; TCGA SARC -0.111; TCGA THCA -0.122; TCGA STAD -0.317; TCGA UCEC -0.208
hsa-miR-146a-5p
FAM168B
12 cancers: CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.076; TCGA COAD -0.051; TCGA KIRC -0.12; TCGA KIRP -0.086; TCGA LIHC -0.052; TCGA LUAD -0.102; TCGA LUSC -0.12; TCGA OV -0.096; TCGA SARC -0.158; TCGA THCA -0.083; TCGA STAD -0.175; TCGA UCEC -0.111
hsa-miR-146a-5p
ZNF275
10 cancers: CESC; COAD; KIRC; KIRP; LGG; LIHC; OV; SARC; THCA; UCEC
MirTarget
TCGA CESC -0.123; TCGA COAD -0.12; TCGA KIRC -0.08; TCGA KIRP -0.177; TCGA LGG -0.1; TCGA LIHC -0.066; TCGA OV -0.059; TCGA SARC -0.054; TCGA THCA -0.146; TCGA UCEC -0.094
hsa-miR-146a-5p
ESYT2
11 cancers: CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.074; TCGA COAD -0.056; TCGA ESCA -0.113; TCGA HNSC -0.076; TCGA KIRP -0.06; TCGA LIHC -0.07; TCGA LUAD -0.068; TCGA LUSC -0.105; TCGA SARC -0.151; TCGA STAD -0.155; TCGA UCEC -0.069
hsa-miR-146a-5p
ZNF532
11 cancers: CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.098; TCGA COAD -0.293; TCGA ESCA -0.177; TCGA KIRP -0.15; TCGA LGG -0.062; TCGA LUAD -0.061; TCGA LUSC -0.069; TCGA PRAD -0.112; TCGA SARC -0.182; TCGA STAD -0.236; TCGA UCEC -0.154
hsa-miR-146a-5p
ZNF649
10 cancers: CESC; COAD; KIRC; KIRP; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.146; TCGA COAD -0.251; TCGA KIRC -0.215; TCGA KIRP -0.232; TCGA OV -0.147; TCGA PRAD -0.143; TCGA SARC -0.087; TCGA THCA -0.077; TCGA STAD -0.184; TCGA UCEC -0.077
hsa-miR-146a-5p
YLPM1
9 cancers: CESC; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; SARC; UCEC
MirTarget
TCGA CESC -0.053; TCGA ESCA -0.056; TCGA KIRC -0.113; TCGA KIRP -0.165; TCGA LGG -0.077; TCGA LUSC -0.097; TCGA PAAD -0.053; TCGA SARC -0.053; TCGA UCEC -0.071
hsa-miR-146a-5p
EXOC5
11 cancers: CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.1; TCGA ESCA -0.152; TCGA HNSC -0.103; TCGA KIRP -0.093; TCGA LUAD -0.051; TCGA LUSC -0.094; TCGA OV -0.051; TCGA PAAD -0.093; TCGA SARC -0.065; TCGA STAD -0.091; TCGA UCEC -0.069
hsa-miR-146a-5p
HS1BP3
9 cancers: CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.076; TCGA ESCA -0.054; TCGA HNSC -0.1; TCGA LIHC -0.12; TCGA LUAD -0.099; TCGA LUSC -0.061; TCGA PRAD -0.07; TCGA SARC -0.077; TCGA STAD -0.123
hsa-miR-146a-5p
RAB3B
10 cancers: CESC; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA CESC -0.324; TCGA HNSC -0.331; TCGA KIRC -0.391; TCGA LUAD -0.281; TCGA LUSC -0.465; TCGA OV -0.165; TCGA PAAD -0.283; TCGA PRAD -0.235; TCGA SARC -0.208; TCGA STAD -0.191
hsa-miR-146a-5p
HIC2
10 cancers: CESC; HNSC; KIRP; LGG; LUAD; LUSC; OV; SARC; THCA; UCEC
mirMAP
TCGA CESC -0.114; TCGA HNSC -0.089; TCGA KIRP -0.084; TCGA LGG -0.136; TCGA LUAD -0.122; TCGA LUSC -0.149; TCGA OV -0.105; TCGA SARC -0.072; TCGA THCA -0.12; TCGA UCEC -0.064
hsa-miR-146a-5p
PYGO1
12 cancers: CESC; ESCA; KIRC; KIRP; LGG; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA CESC -0.291; TCGA ESCA -0.291; TCGA KIRC -0.391; TCGA KIRP -0.578; TCGA LGG -0.127; TCGA LUSC -0.27; TCGA OV -0.218; TCGA PRAD -0.128; TCGA SARC -0.223; TCGA THCA -0.137; TCGA STAD -0.559; TCGA UCEC -0.356
hsa-miR-146a-5p
SMAD2
9 cancers: CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD
mirMAP
TCGA CESC -0.067; TCGA ESCA -0.08; TCGA KIRC -0.094; TCGA KIRP -0.092; TCGA LUAD -0.094; TCGA LUSC -0.052; TCGA PAAD -0.053; TCGA SARC -0.078; TCGA STAD -0.07
hsa-miR-146a-5p
MAN1A2
9 cancers: CESC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD
mirMAP
TCGA CESC -0.083; TCGA KIRC -0.104; TCGA KIRP -0.239; TCGA LIHC -0.076; TCGA LUAD -0.114; TCGA LUSC -0.091; TCGA SARC -0.133; TCGA THCA -0.076; TCGA STAD -0.052
hsa-miR-146a-5p
VGLL3
9 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; STAD; UCEC
mirMAP
TCGA CESC -0.387; TCGA COAD -0.547; TCGA ESCA -0.23; TCGA HNSC -0.152; TCGA KIRC -0.221; TCGA KIRP -0.433; TCGA PRAD -0.27; TCGA STAD -0.349; TCGA UCEC -0.271
hsa-miR-146a-5p
TM9SF2
9 cancers: CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD
miRNATAP
TCGA CESC -0.091; TCGA COAD -0.085; TCGA KIRC -0.112; TCGA KIRP -0.093; TCGA LIHC -0.055; TCGA LUAD -0.097; TCGA LUSC -0.09; TCGA OV -0.088; TCGA PAAD -0.111
hsa-miR-146a-5p
PLEKHM3
12 cancers: COAD; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA COAD -0.097; TCGA ESCA -0.084; TCGA KIRP -0.076; TCGA LIHC -0.059; TCGA LUAD -0.082; TCGA LUSC -0.094; TCGA OV -0.068; TCGA PAAD -0.086; TCGA SARC -0.135; TCGA THCA -0.088; TCGA STAD -0.246; TCGA UCEC -0.145
hsa-miR-146a-5p
ZNF813
9 cancers: COAD; KIRC; KIRP; LGG; LUAD; OV; PRAD; SARC; UCEC
MirTarget
TCGA COAD -0.419; TCGA KIRC -0.105; TCGA KIRP -0.223; TCGA LGG -0.126; TCGA LUAD -0.093; TCGA OV -0.07; TCGA PRAD -0.162; TCGA SARC -0.136; TCGA UCEC -0.073
hsa-miR-146a-5p
NOS1
9 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; STAD; UCEC
mirMAP
TCGA COAD -0.847; TCGA ESCA -0.824; TCGA HNSC -0.351; TCGA KIRC -0.323; TCGA KIRP -0.504; TCGA LUSC -0.386; TCGA OV -0.266; TCGA STAD -0.822; TCGA UCEC -0.17
hsa-miR-146a-5p
FOXP2
9 cancers: COAD; ESCA; KIRC; LGG; LUAD; PAAD; SARC; THCA; STAD
mirMAP
TCGA COAD -0.842; TCGA ESCA -0.8; TCGA KIRC -0.266; TCGA LGG -0.469; TCGA LUAD -0.144; TCGA PAAD -0.308; TCGA SARC -0.216; TCGA THCA -0.537; TCGA STAD -0.906
hsa-miR-146a-5p
PLEKHG4B
11 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC; STAD; UCEC
mirMAP
TCGA ESCA -0.431; TCGA HNSC -0.199; TCGA KIRC -0.759; TCGA KIRP -0.44; TCGA LGG -0.182; TCGA LUAD -0.201; TCGA LUSC -0.303; TCGA OV -0.213; TCGA SARC -0.204; TCGA STAD -0.324; TCGA UCEC -0.144
hsa-miR-146a-5p
CSRNP3
9 cancers: HNSC; KIRC; KIRP; LUAD; LUSC; OV; SARC; STAD; UCEC
mirMAP
TCGA HNSC -0.191; TCGA KIRC -0.338; TCGA KIRP -0.262; TCGA LUAD -0.348; TCGA LUSC -0.143; TCGA OV -0.203; TCGA SARC -0.218; TCGA STAD -0.402; TCGA UCEC -0.177





Enriched cancer pathways of putative targets