microRNA information: hsa-miR-146b-5p

SectionIDlink
Mature name: hsa-miR-146b-5pmiRbase
Accession: MIMAT0002809miRbase
Precursor name: hsa-mir-146b miRbase
Precursor accession: MI0003129miRbase
Symbol: MIR146BHGNC
RefSeq ID: NR_030169GenBank
Sequence: UGAGAACUGAAUUCCAUAGGCU



Reported expression in cancers: hsa-miR-146b-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-146b-5p

B cell lymphomaupregulation"Significance of microRNA 146b 5p in diffuse large ......"23363792Microarray; qPCR
hsa-miR-146b-5p

B cell lymphomadownregulation"Low expression of microRNA 146b 5p and microRNA 32 ......"24931464
hsa-miR-146b-5p

bladder cancerderegulation"Expression levels of miRNAs were assessed by quant ......"23169479qPCR
hsa-miR-146b-5p

bladder cancerderegulation"In GBC miRNAs with tumor suppressor activity miR-1 ......"26855538
hsa-miR-146b-5p

breast cancerdownregulation"Associations of miR 146a and miR 146b expression a ......"26406414
hsa-miR-146b-5p

colorectal cancerderegulation"In our CD patients six miRNAs were upregulated fro ......"22241525
hsa-miR-146b-5p

esophageal cancerupregulation"Recent clinical study indicated that up-regulation ......"24589738
hsa-miR-146b-5p

liver cancerupregulation"Up-regulation of miR-15a miR-16 miR-27b miR-30b mi ......"24314246qPCR
hsa-miR-146b-5p

lung cancerderegulation"Microarray studies revealed alterations in the exp ......"19748927Microarray; Reverse transcription PCR
hsa-miR-146b-5p

lung squamous cell cancerupregulation"Furthermore we detected the expression of miR-146 ......"24448024
hsa-miR-146b-5p

melanomaderegulation"An exploratory miRNA analysis of 666 miRs by low d ......"20302635Microarray
hsa-miR-146b-5p

melanomaderegulation"Comparative microarray analysis of microRNA expres ......"23111773Microarray; RNA-Seq; qPCR
hsa-miR-146b-5p

prostate cancerupregulation"Loss of 18 miRNAs e.g.miR-34c miR-29b miR-212 and ......"23781281
hsa-miR-146b-5p

prostate cancerdownregulation"MicroRNA 146b acts as a potential tumor suppressor ......"27273955qPCR
hsa-miR-146b-5p

thyroid cancerupregulation"miR 146b is highly expressed in adult papillary th ......"20406109qPCR
hsa-miR-146b-5p

thyroid cancerupregulation"Prognostic implications of miR 146b expression and ......"23264400qPCR
hsa-miR-146b-5p

thyroid cancerupregulation"MicroRNAs miR 146 5p and let 7f as prognostic tool ......"23295297
hsa-miR-146b-5p

thyroid cancerupregulation"To detect the levels of miRNA expression in fresh ......"23569392Microarray
hsa-miR-146b-5p

thyroid cancerupregulation"miR-146b-5p was also transiently up-regulated duri ......"24946010
hsa-miR-146b-5p

thyroid cancerupregulation"Associations of miR 146a and miR 146b expression a ......"25524940
hsa-miR-146b-5p

thyroid cancerupregulation"Micro-RNA miR-146b-5p is overexpressed in papillar ......"25547151
hsa-miR-146b-5p

thyroid cancerupregulation"In papillary thyroid carcinoma PTC miR-146b-5p is ......"26883911
hsa-miR-146b-5p

thyroid cancerupregulation"We hypothesized that the culpable mechanisms inclu ......"27011326



Reported cancer pathway affected by hsa-miR-146b-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-146b-5p

cervical and endocervical cancercell cycle pathway"Inhibitory effect and mechanisms of microRNA 146b ......"25572123Flow cytometry; Transwell assay; Western blot
hsa-miR-146b-5p

esophageal cancerApoptosis pathway"Transcriptional regulation of miR 146b by C/EBPβ ......"24589738
hsa-miR-146b-5p

prostate cancerApoptosis pathway"MicroRNA 146b acts as a potential tumor suppressor ......"27273955
hsa-miR-146b-5p

sarcomaApoptosis pathway"miR 146b 5p promotes invasion and metastasis contr ......"26549292Luciferase; Western blot
hsa-miR-146b-5p

thyroid cancercell cycle pathway"MicroRNA miR 146b 5p regulates signal transduction ......"21874046Luciferase
hsa-miR-146b-5p

thyroid cancerApoptosis pathway"Prognostic implications of miR 146b expression and ......"23264400Colony formation
hsa-miR-146b-5p

thyroid cancerApoptosis pathway"A miR-microarray study was conducted to identify m ......"24631480
hsa-miR-146b-5p

thyroid cancerEpithelial mesenchymal transition pathway"The roles of the epithelial mesenchymal transition ......"24946010
hsa-miR-146b-5p

thyroid cancerEpithelial mesenchymal transition pathway"MiR 146b 5p promotes metastasis and induces epithe ......"25547151Luciferase
hsa-miR-146b-5p

thyroid cancercell cycle pathway"p21 participates in the regulation of anaplastic t ......"27602131



Reported cancer prognosis affected by hsa-miR-146b-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-146b-5p

B cell lymphomarecurrence; poor survival"Significance of microRNA 146b 5p in diffuse large ......"23363792
hsa-miR-146b-5p

B cell lymphomaworse prognosis; poor survival; progression; drug resistance"Low expression of microRNA 146b 5p and microRNA 32 ......"24931464
hsa-miR-146b-5p

bladder cancerstaging"Expression levels of miRNAs were assessed by quant ......"23169479
hsa-miR-146b-5p

bladder cancerdrug resistance"Focusing on the major obstacle regarding MIBC pati ......"27586262
hsa-miR-146b-5p

breast cancermetastasis"Breast cancer metastasis suppressor 1 up regulates ......"19190326
hsa-miR-146b-5p

breast cancerdifferentiation"In order to identify which miRNAs are involved in ......"22562546
hsa-miR-146b-5p

cervical and endocervical cancerprogression"Inhibitory effect and mechanisms of microRNA 146b ......"25572123Flow cytometry; Transwell assay; Western blot
hsa-miR-146b-5p

esophageal cancerpoor survival"The expression levels of miR-21 p = 0.027 miR-181b ......"23175214
hsa-miR-146b-5p

esophageal cancerpoor survival"Transcriptional regulation of miR 146b by C/EBPβ ......"24589738
hsa-miR-146b-5p

gastric cancerpoor survival; worse prognosis"NOVA1 inhibition by miR 146b 5p in the remnant tis ......"26673617
hsa-miR-146b-5p

kidney renal cell cancermetastasis"Integrated microRNA and mRNA Signature Associated ......"26859141
hsa-miR-146b-5p

liver cancerdrug resistance"The cell viability MTT assay was used to detect dr ......"23229111MTT assay
hsa-miR-146b-5p

lung cancermalignant trasformation; recurrence; staging"Overexpression of the lung cancer prognostic miR 1 ......"21789255Colony formation
hsa-miR-146b-5p

lung cancertumorigenesis"Other significantly differentiated miR families in ......"23035181
hsa-miR-146b-5p

lung squamous cell cancerworse prognosis"In this study we first identified microRNA146 miR- ......"24448024
hsa-miR-146b-5p

lymphomastaging; progression"Herein we used a global quantitative real-time pol ......"25503151
hsa-miR-146b-5p

melanomametastasis; malignant trasformation"Comparative microarray analysis of microRNA expres ......"23111773
hsa-miR-146b-5p

melanomaprogression"However miR-146a levels drop in Circulating Tumor ......"26965144
hsa-miR-146b-5p

pancreatic cancercell migration"Inhibitory effects of miR 146b 5p on cell migratio ......"21823013Luciferase
hsa-miR-146b-5p

pancreatic cancerstaging"At 25 weeks the miRNA microarray analysis revealed ......"26516699
hsa-miR-146b-5p

sarcomametastasis; drug resistance; tumorigenesis"miR 146b 5p promotes invasion and metastasis contr ......"26549292Luciferase; Western blot
hsa-miR-146b-5p

thyroid cancertumorigenesis"MicroRNA miRNA microarray analysis has consistentl ......"18587330
hsa-miR-146b-5p

thyroid cancermetastasis; recurrence"In this study we evaluated miRNA expression as a m ......"21537871
hsa-miR-146b-5p

thyroid cancertumorigenesis; drug resistance"MicroRNA miR 146b 5p regulates signal transduction ......"21874046Luciferase
hsa-miR-146b-5p

thyroid cancerstaging; worse prognosis; cell migration; metastasis; poor survival; drug resistance"Prognostic implications of miR 146b expression and ......"23264400Colony formation
hsa-miR-146b-5p

thyroid cancerworse prognosis"MicroRNAs miR 146 5p and let 7f as prognostic tool ......"23295297
hsa-miR-146b-5p

thyroid cancerstaging"To elucidate the mechanisms undergoing the pathoge ......"23533107
hsa-miR-146b-5p

thyroid cancertumor size; staging; metastasis"To detect the levels of miRNA expression in fresh ......"23569392
hsa-miR-146b-5p

thyroid cancermetastasis"These miRNAs and mRNAs were further validated by q ......"24064622Luciferase
hsa-miR-146b-5p

thyroid cancerrecurrence"MicroRNA 222 and microRNA 146b are tissue and circ ......"24301304
hsa-miR-146b-5p

thyroid cancerprogression"The roles of the epithelial mesenchymal transition ......"24946010
hsa-miR-146b-5p

thyroid cancertumorigenesis"Upregulation of miRNAs such as miR-146b miR-221 an ......"25202329
hsa-miR-146b-5p

thyroid cancertumor size; malignant trasformation"Differential expression levels of plasma derived m ......"25456009
hsa-miR-146b-5p

thyroid cancerstaging; tumorigenesis"Associations of miR 146a and miR 146b expression a ......"25524940
hsa-miR-146b-5p

thyroid cancermetastasis; staging"MiR 146b 5p promotes metastasis and induces epithe ......"25547151Luciferase
hsa-miR-146b-5p

thyroid cancerrecurrence"In the present study we investigated whether miR-9 ......"26007293
hsa-miR-146b-5p

thyroid cancermetastasis"We performed small RNA deep-sequencing of 3 PTC th ......"26487287
hsa-miR-146b-5p

thyroid cancertumor size"All tumors were tested for the presence of the BRA ......"26950846
hsa-miR-146b-5p

thyroid cancerstaging; worse prognosis"IRAK1 a Target of miR 146b Reduces Cell Aggressive ......"27533309Colony formation
hsa-miR-146b-5p

thyroid cancercell migration; progression"p21 participates in the regulation of anaplastic t ......"27602131



Reported gene related to hsa-miR-146b-5p

miRNAcancergenereportingPUBMED
hsa-miR-146b-5p

thyroid cancerBRAF"Additionally the activation of thyroid most common ......"21874046
hsa-miR-146b-5p

thyroid cancerBRAF"miR-146b-5p positively regulates migration and inv ......"26883911
hsa-miR-146b-5p

thyroid cancerBRAF"The miR-146b expression levels in PTCs with BRAF m ......"20406109
hsa-miR-146b-5p

thyroid cancerBRAF"Among BRAF-positive tumors overexpression of miR-1 ......"21537871
hsa-miR-146b-5p

pancreatic cancerMIA"The present study identifies a series of miRNAs wh ......"23073476
hsa-miR-146b-5p

pancreatic cancerMIA"Our data showed that miR-146b-5p overexpression si ......"21823013
hsa-miR-146b-5p

pancreatic cancerMMP16"Inhibitory effects of miR 146b 5p on cell migratio ......"21823013
hsa-miR-146b-5p

sarcomaMMP16"Results of western blot assay indicated that miR-1 ......"26549292
hsa-miR-146b-5p

thyroid cancerSMAD4"MicroRNA miR 146b 5p regulates signal transduction ......"21874046
hsa-miR-146b-5p

thyroid cancerSMAD4"The overexpression of SMAD4 in BCPAP cells a valid ......"26883911
hsa-miR-146b-5p

sarcomaZNRF3"Results of western blot assay indicated that miR-1 ......"26549292
hsa-miR-146b-5p

thyroid cancerZNRF3"MiR 146b 5p promotes metastasis and induces epithe ......"25547151
hsa-miR-146b-5p

thyroid cancerATM"The role of microRNA 146b miR-146b in ATC remains ......"27602131
hsa-miR-146b-5p

breast cancerBRCA1"We report here the involvement of miR-146a and miR ......"21472990
hsa-miR-146b-5p

breast cancerBRMS1"BRMS1 significantly up-regulates miR-146a by 6- to ......"19190326
hsa-miR-146b-5p

colorectal cancerCASR"miR 135b and miR 146b dependent silencing of calci ......"26178670
hsa-miR-146b-5p

thyroid cancerCDKN1A"During the search for potential targets of miR-146 ......"27602131
hsa-miR-146b-5p

B cell lymphomaDDIT3"We report here that low expression of miR-146b-5p ......"24931464
hsa-miR-146b-5p

B cell lymphomaGBA"In 62 cases of DLBCL 35.5% of cases were GCB and 6 ......"23363792
hsa-miR-146b-5p

breast cancerIL6"We investigated expressions of miR-146a miR-146b a ......"26406414
hsa-miR-146b-5p

thyroid cancerIRAK1"IRAK1 a Target of miR 146b Reduces Cell Aggressive ......"27533309
hsa-miR-146b-5p

breast cancerMTSS1"Breast cancer metastasis suppressor 1 up regulates ......"19190326
hsa-miR-146b-5p

B cell lymphomaMYC"Moreover miR-146b-5p and miR-320d were expressed a ......"24931464
hsa-miR-146b-5p

breast cancerNFKB1"Extending observations from an immunologic setting ......"18504431
hsa-miR-146b-5p

gastric cancerNOVA1"NOVA1 inhibition by miR 146b 5p in the remnant tis ......"26673617
hsa-miR-146b-5p

thyroid cancerPRRX1"The roles of the epithelial mesenchymal transition ......"24946010
hsa-miR-146b-5p

lymphomaPTLS"Significant down-regulation of hsa-miR-26a was obs ......"24327568
hsa-miR-146b-5p

thyroid cancerRARB"Direct interaction between miRs and RARB was deter ......"27011326
hsa-miR-146b-5p

thyroid cancerSLC5A5"Inhibition of miR 146b expression increases radioi ......"25960292
hsa-miR-146b-5p

gastric cancerUHRF1"We identified and verified miR-146a and miR-146b a ......"23982143



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-146b-5p
KIT
10 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.417; TCGA KIRC -0.446; TCGA KIRP -0.363; TCGA LIHC -0.121; TCGA LUAD -0.403; TCGA OV -0.268; TCGA PRAD -0.21; TCGA THCA -0.492; TCGA STAD -0.582; TCGA UCEC -0.306
hsa-miR-146b-5p
PRKAA2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.312; TCGA BRCA -0.467; TCGA CESC -0.678; TCGA COAD -0.424; TCGA ESCA -0.475; TCGA HNSC -0.52; TCGA KIRC -0.198; TCGA KIRP -0.115; TCGA LUAD -0.167; TCGA SARC -0.688; TCGA THCA -0.113; TCGA STAD -1.03; TCGA UCEC -0.154
hsa-miR-146b-5p
RGS5
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.402; TCGA BRCA -0.49; TCGA COAD -0.422; TCGA ESCA -0.323; TCGA HNSC -0.197; TCGA KIRP -0.186; TCGA LIHC -0.142; TCGA LUAD -0.162; TCGA SARC -0.27; TCGA STAD -0.421; TCGA UCEC -0.248
hsa-miR-146b-5p
ZADH2
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.213; TCGA ESCA -0.133; TCGA HNSC -0.074; TCGA KIRC -0.198; TCGA KIRP -0.12; TCGA LGG -0.077; TCGA LIHC -0.059; TCGA PAAD -0.177; TCGA THCA -0.085; TCGA STAD -0.09; TCGA UCEC -0.081
hsa-miR-146b-5p
PLEKHM3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.095; TCGA BRCA -0.155; TCGA CESC -0.147; TCGA COAD -0.108; TCGA HNSC -0.206; TCGA KIRP -0.08; TCGA LGG -0.074; TCGA LUAD -0.122; TCGA PRAD -0.174; TCGA SARC -0.18; TCGA THCA -0.082; TCGA STAD -0.207; TCGA UCEC -0.084
hsa-miR-146b-5p
THRB
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD
MirTarget; miRanda
TCGA BLCA -0.524; TCGA BRCA -0.353; TCGA CESC -0.266; TCGA COAD -0.553; TCGA ESCA -0.327; TCGA HNSC -0.278; TCGA KIRC -0.432; TCGA KIRP -0.24; TCGA PRAD -0.073; TCGA SARC -0.334; TCGA STAD -0.508
hsa-miR-146b-5p
ZNF540
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; OV; SARC; UCEC
MirTarget; miRanda
TCGA BLCA -0.232; TCGA BRCA -0.16; TCGA COAD -0.147; TCGA KIRC -0.211; TCGA KIRP -0.179; TCGA LGG -0.113; TCGA OV -0.187; TCGA SARC -0.358; TCGA UCEC -0.224
hsa-miR-146b-5p
ZNF275
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; THCA; UCEC
MirTarget; miRanda
TCGA BLCA -0.124; TCGA BRCA -0.081; TCGA COAD -0.164; TCGA KIRC -0.065; TCGA KIRP -0.132; TCGA LGG -0.26; TCGA LIHC -0.056; TCGA PAAD -0.097; TCGA PRAD -0.113; TCGA THCA -0.104; TCGA UCEC -0.093
hsa-miR-146b-5p
TM9SF3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PAAD
MirTarget
TCGA BLCA -0.075; TCGA BRCA -0.102; TCGA CESC -0.058; TCGA COAD -0.098; TCGA ESCA -0.191; TCGA HNSC -0.067; TCGA KIRP -0.07; TCGA LGG -0.091; TCGA LUAD -0.115; TCGA PAAD -0.113
hsa-miR-146b-5p
SH3YL1
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; UCEC
MirTarget; miRanda
TCGA BLCA -0.286; TCGA CESC -0.097; TCGA COAD -0.163; TCGA HNSC -0.149; TCGA KIRC -0.156; TCGA KIRP -0.135; TCGA LGG -0.11; TCGA LIHC -0.185; TCGA UCEC -0.136
hsa-miR-146b-5p
ZDHHC2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD
MirTarget; miRanda
TCGA BLCA -0.21; TCGA BRCA -0.131; TCGA COAD -0.266; TCGA ESCA -0.295; TCGA HNSC -0.175; TCGA KIRC -0.144; TCGA KIRP -0.178; TCGA LGG -0.074; TCGA LUAD -0.173; TCGA PRAD -0.183
hsa-miR-146b-5p
ZNF253
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC
MirTarget; miRanda
TCGA BLCA -0.274; TCGA BRCA -0.165; TCGA COAD -0.163; TCGA HNSC -0.132; TCGA KIRC -0.1; TCGA KIRP -0.142; TCGA LGG -0.19; TCGA LIHC -0.126; TCGA PAAD -0.14; TCGA SARC -0.123
hsa-miR-146b-5p
ZNF652
10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; THCA; UCEC
MirTarget
TCGA BLCA -0.193; TCGA BRCA -0.208; TCGA ESCA -0.126; TCGA HNSC -0.096; TCGA LGG -0.094; TCGA LUAD -0.065; TCGA LUSC -0.084; TCGA PAAD -0.095; TCGA THCA -0.096; TCGA UCEC -0.084
hsa-miR-146b-5p
CDKN2AIP
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; STAD
MirTarget; PITA; miRanda
TCGA BLCA -0.083; TCGA BRCA -0.15; TCGA HNSC -0.193; TCGA KIRC -0.138; TCGA KIRP -0.139; TCGA LGG -0.066; TCGA LIHC -0.052; TCGA PRAD -0.103; TCGA SARC -0.119; TCGA STAD -0.064
hsa-miR-146b-5p
CRK
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; UCEC
MirTarget
TCGA BLCA -0.078; TCGA BRCA -0.136; TCGA ESCA -0.09; TCGA HNSC -0.119; TCGA KIRC -0.065; TCGA KIRP -0.101; TCGA LGG -0.055; TCGA LIHC -0.089; TCGA LUAD -0.147; TCGA LUSC -0.113; TCGA PRAD -0.109; TCGA UCEC -0.071
hsa-miR-146b-5p
MLLT1
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.087; TCGA ESCA -0.124; TCGA HNSC -0.052; TCGA KIRC -0.072; TCGA KIRP -0.062; TCGA LIHC -0.06; TCGA LUSC -0.098; TCGA SARC -0.056; TCGA THCA -0.071; TCGA STAD -0.055; TCGA UCEC -0.085
hsa-miR-146b-5p
GK5
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC; UCEC
MirTarget
TCGA BLCA -0.134; TCGA BRCA -0.08; TCGA CESC -0.104; TCGA HNSC -0.185; TCGA KIRC -0.113; TCGA KIRP -0.095; TCGA LGG -0.087; TCGA LIHC -0.079; TCGA PAAD -0.094; TCGA SARC -0.199; TCGA UCEC -0.145
hsa-miR-146b-5p
TRHDE
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; OV; PRAD; STAD
MirTarget; miRanda
TCGA BLCA -0.644; TCGA BRCA -0.267; TCGA COAD -0.408; TCGA KIRC -0.312; TCGA KIRP -0.183; TCGA LIHC -0.269; TCGA OV -0.422; TCGA PRAD -0.251; TCGA STAD -0.357
hsa-miR-146b-5p
USP47
10 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.163; TCGA CESC -0.067; TCGA KIRP -0.062; TCGA LGG -0.083; TCGA LUAD -0.11; TCGA PRAD -0.079; TCGA SARC -0.06; TCGA STAD -0.052; TCGA UCEC -0.086
hsa-miR-146b-5p
ZNF649
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; STAD
MirTarget; miRanda
TCGA BLCA -0.11; TCGA BRCA -0.09; TCGA COAD -0.249; TCGA HNSC -0.131; TCGA KIRC -0.247; TCGA KIRP -0.194; TCGA LGG -0.133; TCGA LIHC -0.145; TCGA LUAD -0.089; TCGA OV -0.16; TCGA PRAD -0.155; TCGA SARC -0.098; TCGA STAD -0.235
hsa-miR-146b-5p
LANCL1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; UCEC
MirTarget; miRanda
TCGA BLCA -0.084; TCGA BRCA -0.223; TCGA CESC -0.122; TCGA ESCA -0.168; TCGA HNSC -0.167; TCGA KIRC -0.097; TCGA KIRP -0.117; TCGA LUAD -0.084; TCGA LUSC -0.096; TCGA OV -0.054; TCGA PRAD -0.067; TCGA SARC -0.194; TCGA UCEC -0.086
hsa-miR-146b-5p
SORT1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.184; TCGA CESC -0.191; TCGA COAD -0.178; TCGA ESCA -0.272; TCGA HNSC -0.301; TCGA KIRC -0.194; TCGA KIRP -0.114; TCGA LUAD -0.133; TCGA PRAD -0.144; TCGA SARC -0.27; TCGA STAD -0.147
hsa-miR-146b-5p
ZNF136
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC
MirTarget; miRanda
TCGA BLCA -0.148; TCGA BRCA -0.184; TCGA HNSC -0.113; TCGA KIRC -0.1; TCGA KIRP -0.119; TCGA LGG -0.058; TCGA LIHC -0.12; TCGA PRAD -0.067; TCGA SARC -0.154
hsa-miR-146b-5p
HMBOX1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; THCA
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.059; TCGA BRCA -0.223; TCGA HNSC -0.108; TCGA KIRC -0.168; TCGA KIRP -0.132; TCGA LGG -0.165; TCGA LIHC -0.088; TCGA LUAD -0.1; TCGA OV -0.075; TCGA PRAD -0.098; TCGA THCA -0.078
hsa-miR-146b-5p
ATP7A
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.2; TCGA BRCA -0.222; TCGA COAD -0.127; TCGA ESCA -0.106; TCGA HNSC -0.222; TCGA KIRC -0.063; TCGA KIRP -0.147; TCGA LIHC -0.066; TCGA LUSC -0.069; TCGA PRAD -0.095; TCGA SARC -0.114; TCGA STAD -0.072; TCGA UCEC -0.107
hsa-miR-146b-5p
ZC3H12B
12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.374; TCGA COAD -0.519; TCGA HNSC -0.105; TCGA KIRC -0.119; TCGA KIRP -0.122; TCGA LGG -0.272; TCGA PAAD -0.177; TCGA PRAD -0.182; TCGA SARC -0.337; TCGA THCA -0.092; TCGA STAD -0.226; TCGA UCEC -0.238
hsa-miR-146b-5p
ERBB4
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PRAD; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.632; TCGA BRCA -1.13; TCGA CESC -0.638; TCGA HNSC -0.313; TCGA KIRC -0.934; TCGA KIRP -0.757; TCGA LGG -0.195; TCGA PRAD -0.321; TCGA THCA -0.073; TCGA STAD -0.643
hsa-miR-146b-5p
ARHGAP6
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.627; TCGA BRCA -0.208; TCGA CESC -0.279; TCGA KIRC -0.19; TCGA KIRP -0.136; TCGA LIHC -0.108; TCGA LUAD -0.107; TCGA PRAD -0.178; TCGA SARC -0.205; TCGA THCA -0.142; TCGA STAD -0.313; TCGA UCEC -0.324
hsa-miR-146b-5p
SMAD4
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.104; TCGA BRCA -0.139; TCGA HNSC -0.075; TCGA KIRC -0.111; TCGA KIRP -0.102; TCGA LGG -0.148; TCGA LUAD -0.109; TCGA PAAD -0.133; TCGA PRAD -0.116; TCGA SARC -0.153; TCGA STAD -0.107; TCGA UCEC -0.115
hsa-miR-146b-5p
MAPT
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.347; TCGA BRCA -0.835; TCGA COAD -0.325; TCGA ESCA -0.468; TCGA HNSC -0.329; TCGA LGG -0.264; TCGA OV -0.248; TCGA PAAD -0.483; TCGA PRAD -0.114; TCGA SARC -0.465; TCGA THCA -0.239; TCGA STAD -0.691; TCGA UCEC -0.19
hsa-miR-146b-5p
ELF2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; UCEC
PITA; miRanda
TCGA BLCA -0.118; TCGA BRCA -0.167; TCGA CESC -0.067; TCGA COAD -0.091; TCGA HNSC -0.1; TCGA KIRP -0.093; TCGA LGG -0.057; TCGA LIHC -0.064; TCGA LUAD -0.062; TCGA PAAD -0.067; TCGA SARC -0.154; TCGA UCEC -0.077
hsa-miR-146b-5p
SETD2
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; PRAD; SARC; UCEC
PITA; miRanda
TCGA BLCA -0.12; TCGA BRCA -0.147; TCGA COAD -0.086; TCGA HNSC -0.084; TCGA KIRC -0.124; TCGA KIRP -0.086; TCGA LGG -0.078; TCGA PRAD -0.075; TCGA SARC -0.105; TCGA UCEC -0.066
hsa-miR-146b-5p
CLASP2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.113; TCGA BRCA -0.223; TCGA COAD -0.101; TCGA ESCA -0.074; TCGA HNSC -0.143; TCGA KIRC -0.146; TCGA KIRP -0.075; TCGA LGG -0.181; TCGA PAAD -0.102; TCGA PRAD -0.079; TCGA SARC -0.085; TCGA STAD -0.086; TCGA UCEC -0.126
hsa-miR-146b-5p
PHF8
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC
PITA
TCGA BLCA -0.186; TCGA BRCA -0.115; TCGA COAD -0.181; TCGA HNSC -0.148; TCGA KIRC -0.087; TCGA KIRP -0.096; TCGA LGG -0.084; TCGA LUSC -0.11; TCGA PAAD -0.096; TCGA SARC -0.109
hsa-miR-146b-5p
PHF20L1
10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; OV; THCA
PITA; miRanda; miRNATAP
TCGA BLCA -0.059; TCGA CESC -0.07; TCGA COAD -0.117; TCGA HNSC -0.074; TCGA KIRP -0.053; TCGA LGG -0.1; TCGA LUAD -0.072; TCGA LUSC -0.075; TCGA OV -0.08; TCGA THCA -0.118
hsa-miR-146b-5p
KLF3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; UCEC
PITA; miRanda
TCGA BLCA -0.173; TCGA BRCA -0.133; TCGA CESC -0.158; TCGA ESCA -0.174; TCGA HNSC -0.185; TCGA KIRC -0.074; TCGA KIRP -0.096; TCGA LUAD -0.199; TCGA LUSC -0.14; TCGA PRAD -0.073; TCGA UCEC -0.112
hsa-miR-146b-5p
RIC8B
9 cancers: BLCA; BRCA; CESC; LIHC; LUAD; LUSC; PAAD; SARC; THCA
PITA; miRanda
TCGA BLCA -0.106; TCGA BRCA -0.203; TCGA CESC -0.066; TCGA LIHC -0.12; TCGA LUAD -0.071; TCGA LUSC -0.08; TCGA PAAD -0.152; TCGA SARC -0.128; TCGA THCA -0.129
hsa-miR-146b-5p
MARK1
14 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.221; TCGA CESC -0.29; TCGA COAD -0.567; TCGA HNSC -0.062; TCGA KIRC -0.197; TCGA KIRP -0.202; TCGA LUAD -0.48; TCGA LUSC -0.41; TCGA OV -0.195; TCGA PAAD -0.255; TCGA SARC -0.268; TCGA THCA -0.077; TCGA STAD -0.513; TCGA UCEC -0.301
hsa-miR-146b-5p
FBXL17
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.16; TCGA BRCA -0.291; TCGA ESCA -0.167; TCGA HNSC -0.102; TCGA KIRC -0.106; TCGA KIRP -0.111; TCGA LIHC -0.054; TCGA LUAD -0.053; TCGA PAAD -0.184; TCGA PRAD -0.103; TCGA THCA -0.08; TCGA STAD -0.125; TCGA UCEC -0.107
hsa-miR-146b-5p
ZNRF3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC
PITA; miRanda; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.193; TCGA CESC -0.105; TCGA COAD -0.394; TCGA ESCA -0.166; TCGA HNSC -0.165; TCGA KIRC -0.265; TCGA KIRP -0.16; TCGA LUSC -0.186; TCGA PAAD -0.116; TCGA PRAD -0.178; TCGA SARC -0.067
hsa-miR-146b-5p
SESN3
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LUSC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.143; TCGA BRCA -0.137; TCGA COAD -0.332; TCGA HNSC -0.299; TCGA KIRP -0.239; TCGA LGG -0.121; TCGA LUSC -0.355; TCGA THCA -0.083; TCGA STAD -0.225; TCGA UCEC -0.145
hsa-miR-146b-5p
SLC16A14
12 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.157; TCGA BRCA -0.176; TCGA CESC -0.328; TCGA HNSC -0.403; TCGA LGG -0.074; TCGA LIHC -0.138; TCGA LUAD -0.569; TCGA LUSC -0.302; TCGA OV -0.2; TCGA SARC -0.285; TCGA STAD -0.139; TCGA UCEC -0.125
hsa-miR-146b-5p
HIPK1
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.054; TCGA BRCA -0.189; TCGA HNSC -0.151; TCGA KIRC -0.053; TCGA KIRP -0.077; TCGA PRAD -0.094; TCGA SARC -0.124; TCGA STAD -0.06; TCGA UCEC -0.139
hsa-miR-146b-5p
ZBTB41
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; UCEC
PITA
TCGA BLCA -0.057; TCGA BRCA -0.215; TCGA CESC -0.073; TCGA HNSC -0.133; TCGA KIRP -0.091; TCGA LUAD -0.063; TCGA LUSC -0.162; TCGA PRAD -0.058; TCGA SARC -0.121; TCGA UCEC -0.13
hsa-miR-146b-5p
ZC3H6
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.187; TCGA BRCA -0.272; TCGA COAD -0.11; TCGA HNSC -0.137; TCGA KIRP -0.092; TCGA LGG -0.119; TCGA LIHC -0.078; TCGA PAAD -0.132; TCGA PRAD -0.119; TCGA SARC -0.157; TCGA STAD -0.177; TCGA UCEC -0.161
hsa-miR-146b-5p
WSB2
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD
miRanda
TCGA BLCA -0.113; TCGA BRCA -0.082; TCGA ESCA -0.129; TCGA HNSC -0.123; TCGA LUAD -0.051; TCGA LUSC -0.135; TCGA PAAD -0.139; TCGA THCA -0.089; TCGA STAD -0.063
hsa-miR-146b-5p
UBR1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; UCEC
miRanda; mirMAP
TCGA BLCA -0.082; TCGA BRCA -0.219; TCGA CESC -0.12; TCGA ESCA -0.09; TCGA HNSC -0.054; TCGA KIRC -0.1; TCGA KIRP -0.102; TCGA LGG -0.051; TCGA LIHC -0.056; TCGA LUAD -0.071; TCGA PRAD -0.11; TCGA SARC -0.189; TCGA UCEC -0.146
hsa-miR-146b-5p
EIF4A2
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.131; TCGA BRCA -0.145; TCGA CESC -0.172; TCGA COAD -0.113; TCGA HNSC -0.076; TCGA KIRC -0.06; TCGA PAAD -0.081; TCGA SARC -0.079; TCGA STAD -0.092; TCGA UCEC -0.077
hsa-miR-146b-5p
HOXB3
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.446; TCGA BRCA -0.289; TCGA COAD -0.248; TCGA KIRC -0.248; TCGA KIRP -0.136; TCGA LIHC -0.122; TCGA LUAD -0.168; TCGA PRAD -0.112; TCGA STAD -0.191; TCGA UCEC -0.199
hsa-miR-146b-5p
EPHX2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.325; TCGA BRCA -0.256; TCGA COAD -0.18; TCGA ESCA -0.322; TCGA HNSC -0.232; TCGA KIRC -0.352; TCGA KIRP -0.097; TCGA PAAD -0.357; TCGA PRAD -0.111; TCGA SARC -0.326; TCGA STAD -0.198
hsa-miR-146b-5p
PPIL6
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; PAAD; THCA; STAD
miRanda
TCGA BLCA -0.235; TCGA BRCA -0.172; TCGA ESCA -0.226; TCGA HNSC -0.143; TCGA KIRC -0.153; TCGA LIHC -0.082; TCGA PAAD -0.362; TCGA THCA -0.11; TCGA STAD -0.111
hsa-miR-146b-5p
PHF2
15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.091; TCGA BRCA -0.139; TCGA COAD -0.124; TCGA HNSC -0.072; TCGA KIRC -0.096; TCGA KIRP -0.118; TCGA LGG -0.171; TCGA LIHC -0.067; TCGA LUAD -0.083; TCGA OV -0.103; TCGA PAAD -0.123; TCGA PRAD -0.113; TCGA SARC -0.134; TCGA STAD -0.14; TCGA UCEC -0.197
hsa-miR-146b-5p
VEZF1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.106; TCGA BRCA -0.232; TCGA CESC -0.183; TCGA COAD -0.092; TCGA ESCA -0.113; TCGA HNSC -0.076; TCGA KIRC -0.113; TCGA KIRP -0.099; TCGA LGG -0.126; TCGA LUSC -0.112; TCGA PAAD -0.092; TCGA PRAD -0.085; TCGA SARC -0.093; TCGA STAD -0.146; TCGA UCEC -0.089
hsa-miR-146b-5p
ZFR
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.061; TCGA BRCA -0.077; TCGA CESC -0.118; TCGA COAD -0.1; TCGA HNSC -0.133; TCGA KIRC -0.067; TCGA KIRP -0.11; TCGA LGG -0.056; TCGA LUAD -0.057; TCGA LUSC -0.143; TCGA PAAD -0.126; TCGA PRAD -0.088; TCGA SARC -0.07; TCGA UCEC -0.059
hsa-miR-146b-5p
PRRT1
10 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.279; TCGA BRCA -0.085; TCGA ESCA -0.267; TCGA KIRC -0.124; TCGA LIHC -0.103; TCGA LUAD -0.169; TCGA PAAD -0.165; TCGA SARC -0.174; TCGA STAD -0.298; TCGA UCEC -0.2
hsa-miR-146b-5p
PTCH1
12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.151; TCGA COAD -0.428; TCGA HNSC -0.161; TCGA KIRC -0.266; TCGA KIRP -0.223; TCGA LGG -0.431; TCGA LIHC -0.16; TCGA LUAD -0.153; TCGA PAAD -0.139; TCGA PRAD -0.096; TCGA STAD -0.134; TCGA UCEC -0.279
hsa-miR-146b-5p
PHF3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BLCA -0.052; TCGA BRCA -0.198; TCGA CESC -0.14; TCGA COAD -0.129; TCGA HNSC -0.095; TCGA KIRC -0.053; TCGA KIRP -0.102; TCGA LGG -0.139; TCGA LIHC -0.075; TCGA LUAD -0.108; TCGA LUSC -0.083; TCGA PRAD -0.106; TCGA SARC -0.101
hsa-miR-146b-5p
MID1
10 cancers: BLCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.259; TCGA COAD -0.141; TCGA HNSC -0.139; TCGA LUAD -0.211; TCGA LUSC -0.246; TCGA OV -0.085; TCGA PRAD -0.175; TCGA SARC -0.178; TCGA THCA -0.202; TCGA UCEC -0.218
hsa-miR-146b-5p
DDX6
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.105; TCGA ESCA -0.087; TCGA HNSC -0.1; TCGA KIRP -0.064; TCGA LGG -0.134; TCGA LIHC -0.05; TCGA LUAD -0.064; TCGA LUSC -0.103; TCGA PRAD -0.058; TCGA SARC -0.054; TCGA UCEC -0.053
hsa-miR-146b-5p
NCOA1
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.093; TCGA BRCA -0.176; TCGA COAD -0.074; TCGA ESCA -0.155; TCGA HNSC -0.175; TCGA KIRC -0.122; TCGA KIRP -0.128; TCGA LGG -0.094; TCGA LIHC -0.067; TCGA LUAD -0.145; TCGA LUSC -0.115; TCGA PRAD -0.138; TCGA SARC -0.056; TCGA STAD -0.119; TCGA UCEC -0.089
hsa-miR-146b-5p
DDX3X
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.091; TCGA ESCA -0.114; TCGA HNSC -0.1; TCGA KIRP -0.086; TCGA LIHC -0.051; TCGA LUAD -0.07; TCGA PRAD -0.058; TCGA SARC -0.053; TCGA UCEC -0.056
hsa-miR-146b-5p
PHKB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.156; TCGA CESC -0.065; TCGA COAD -0.105; TCGA ESCA -0.169; TCGA HNSC -0.143; TCGA KIRC -0.118; TCGA KIRP -0.071; TCGA LIHC -0.063; TCGA PAAD -0.093; TCGA PRAD -0.055; TCGA THCA -0.144; TCGA STAD -0.089; TCGA UCEC -0.179
hsa-miR-146b-5p
LDB3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.289; TCGA BRCA -0.369; TCGA CESC -0.267; TCGA COAD -0.614; TCGA ESCA -0.445; TCGA KIRP -0.153; TCGA LIHC -0.104; TCGA PRAD -0.48; TCGA SARC -0.669; TCGA THCA -0.161; TCGA STAD -1.032; TCGA UCEC -0.316
hsa-miR-146b-5p
ARHGAP32
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; UCEC
miRanda; mirMAP
TCGA BLCA -0.228; TCGA BRCA -0.268; TCGA CESC -0.152; TCGA ESCA -0.223; TCGA HNSC -0.278; TCGA KIRC -0.054; TCGA KIRP -0.094; TCGA LGG -0.13; TCGA LIHC -0.066; TCGA LUAD -0.166; TCGA LUSC -0.125; TCGA UCEC -0.237
hsa-miR-146b-5p
MSI2
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.224; TCGA HNSC -0.132; TCGA KIRC -0.261; TCGA KIRP -0.182; TCGA LGG -0.112; TCGA LUAD -0.187; TCGA LUSC -0.32; TCGA PAAD -0.255; TCGA PRAD -0.096
hsa-miR-146b-5p
ANKRD12
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.132; TCGA BRCA -0.212; TCGA HNSC -0.131; TCGA KIRC -0.079; TCGA KIRP -0.19; TCGA LGG -0.098; TCGA LUAD -0.093; TCGA OV -0.088; TCGA PRAD -0.105; TCGA SARC -0.14; TCGA THCA -0.071; TCGA UCEC -0.099
hsa-miR-146b-5p
CAPS2
11 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LIHC; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.262; TCGA BRCA -0.346; TCGA HNSC -0.147; TCGA KIRC -0.133; TCGA LGG -0.055; TCGA LIHC -0.181; TCGA PAAD -0.166; TCGA SARC -0.21; TCGA THCA -0.151; TCGA STAD -0.131; TCGA UCEC -0.293
hsa-miR-146b-5p
SATB1
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.326; TCGA COAD -0.553; TCGA ESCA -0.194; TCGA HNSC -0.143; TCGA KIRC -0.135; TCGA KIRP -0.085; TCGA LGG -0.271; TCGA LUAD -0.089; TCGA OV -0.184; TCGA PRAD -0.195; TCGA STAD -0.33; TCGA UCEC -0.286
hsa-miR-146b-5p
SLC41A3
9 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.074; TCGA COAD -0.165; TCGA HNSC -0.053; TCGA KIRC -0.143; TCGA LUAD -0.096; TCGA LUSC -0.063; TCGA PAAD -0.073; TCGA STAD -0.088; TCGA UCEC -0.1
hsa-miR-146b-5p
CHIC1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.172; TCGA BRCA -0.251; TCGA CESC -0.178; TCGA COAD -0.215; TCGA HNSC -0.096; TCGA KIRC -0.073; TCGA PAAD -0.098; TCGA PRAD -0.126; TCGA SARC -0.111; TCGA STAD -0.319; TCGA UCEC -0.151
hsa-miR-146b-5p
ZNF248
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.223; TCGA BRCA -0.079; TCGA CESC -0.072; TCGA COAD -0.102; TCGA HNSC -0.067; TCGA LGG -0.187; TCGA PAAD -0.078; TCGA PRAD -0.069; TCGA SARC -0.174; TCGA STAD -0.102
hsa-miR-146b-5p
AKAP11
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.101; TCGA BRCA -0.184; TCGA COAD -0.132; TCGA HNSC -0.101; TCGA KIRC -0.067; TCGA KIRP -0.128; TCGA LGG -0.088; TCGA LUAD -0.099; TCGA OV -0.058; TCGA PAAD -0.128; TCGA PRAD -0.168; TCGA SARC -0.077; TCGA UCEC -0.124
hsa-miR-146b-5p
PUM1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PRAD
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.083; TCGA CESC -0.085; TCGA COAD -0.081; TCGA HNSC -0.095; TCGA KIRC -0.056; TCGA LGG -0.054; TCGA LUAD -0.075; TCGA LUSC -0.099; TCGA PRAD -0.07
hsa-miR-146b-5p
SLC38A1
10 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD
miRanda; miRNATAP
TCGA BLCA -0.119; TCGA COAD -0.135; TCGA HNSC -0.105; TCGA KIRP -0.071; TCGA LGG -0.151; TCGA LUSC -0.22; TCGA PRAD -0.149; TCGA SARC -0.337; TCGA THCA -0.123; TCGA STAD -0.132
hsa-miR-146b-5p
EDNRB
11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.173; TCGA KIRC -0.183; TCGA KIRP -0.266; TCGA LGG -0.292; TCGA LIHC -0.139; TCGA PRAD -0.316; TCGA SARC -0.304; TCGA THCA -0.114; TCGA STAD -0.169; TCGA UCEC -0.25
hsa-miR-146b-5p
ZNF451
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.067; TCGA BRCA -0.116; TCGA CESC -0.072; TCGA COAD -0.097; TCGA HNSC -0.05; TCGA KIRP -0.089; TCGA LGG -0.088; TCGA PAAD -0.065; TCGA SARC -0.08; TCGA UCEC -0.094
hsa-miR-146b-5p
KIAA0430
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.171; TCGA BRCA -0.186; TCGA COAD -0.091; TCGA ESCA -0.141; TCGA HNSC -0.076; TCGA KIRP -0.053; TCGA LGG -0.099; TCGA LIHC -0.071; TCGA PRAD -0.11; TCGA SARC -0.123; TCGA STAD -0.126; TCGA UCEC -0.083
hsa-miR-146b-5p
KCTD3
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.086; TCGA BRCA -0.264; TCGA CESC -0.096; TCGA ESCA -0.192; TCGA HNSC -0.158; TCGA LGG -0.12; TCGA LIHC -0.063; TCGA LUAD -0.284; TCGA LUSC -0.184; TCGA PRAD -0.059; TCGA SARC -0.11; TCGA STAD -0.074; TCGA UCEC -0.151
hsa-miR-146b-5p
ABCD3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.174; TCGA BRCA -0.234; TCGA CESC -0.087; TCGA ESCA -0.113; TCGA HNSC -0.157; TCGA KIRC -0.13; TCGA KIRP -0.055; TCGA PAAD -0.126; TCGA PRAD -0.119; TCGA SARC -0.066; TCGA UCEC -0.074
hsa-miR-146b-5p
ZNF506
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC
miRanda
TCGA BLCA -0.208; TCGA BRCA -0.14; TCGA COAD -0.132; TCGA HNSC -0.134; TCGA KIRC -0.053; TCGA KIRP -0.054; TCGA LGG -0.105; TCGA LIHC -0.095; TCGA PAAD -0.098; TCGA SARC -0.108
hsa-miR-146b-5p
BHLHB9
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.073; TCGA BRCA -0.196; TCGA CESC -0.147; TCGA COAD -0.282; TCGA HNSC -0.205; TCGA KIRC -0.232; TCGA KIRP -0.143; TCGA LIHC -0.143; TCGA LUAD -0.075; TCGA LUSC -0.11; TCGA PAAD -0.237; TCGA PRAD -0.123; TCGA SARC -0.119; TCGA THCA -0.073; TCGA STAD -0.243
hsa-miR-146b-5p
BRD2
9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC
miRanda
TCGA BLCA -0.079; TCGA BRCA -0.072; TCGA ESCA -0.057; TCGA KIRC -0.09; TCGA KIRP -0.075; TCGA LGG -0.072; TCGA LIHC -0.072; TCGA LUAD -0.077; TCGA LUSC -0.064
hsa-miR-146b-5p
MANSC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.236; TCGA BRCA -0.151; TCGA CESC -0.174; TCGA COAD -0.27; TCGA ESCA -0.294; TCGA HNSC -0.4; TCGA KIRC -0.204; TCGA KIRP -0.07; TCGA LUAD -0.206; TCGA LUSC -0.159; TCGA PAAD -0.214; TCGA PRAD -0.089; TCGA SARC -0.283; TCGA STAD -0.105; TCGA UCEC -0.208
hsa-miR-146b-5p
ITPKB
9 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.063; TCGA ESCA -0.206; TCGA HNSC -0.142; TCGA KIRC -0.228; TCGA KIRP -0.156; TCGA PRAD -0.089; TCGA SARC -0.127; TCGA STAD -0.357; TCGA UCEC -0.29
hsa-miR-146b-5p
ZFP3
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.281; TCGA BRCA -0.148; TCGA CESC -0.15; TCGA COAD -0.202; TCGA HNSC -0.189; TCGA KIRC -0.126; TCGA KIRP -0.171; TCGA LGG -0.111; TCGA LIHC -0.224; TCGA PAAD -0.184; TCGA PRAD -0.095; TCGA SARC -0.182; TCGA THCA -0.112; TCGA STAD -0.254
hsa-miR-146b-5p
DCAF17
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUSC; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.053; TCGA BRCA -0.102; TCGA CESC -0.074; TCGA HNSC -0.083; TCGA KIRP -0.085; TCGA LUSC -0.101; TCGA PRAD -0.069; TCGA SARC -0.094; TCGA THCA -0.14
hsa-miR-146b-5p
CREB3L2
9 cancers: BLCA; HNSC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.074; TCGA HNSC -0.184; TCGA KIRP -0.106; TCGA LUAD -0.105; TCGA PRAD -0.1; TCGA SARC -0.061; TCGA THCA -0.082; TCGA STAD -0.12; TCGA UCEC -0.178
hsa-miR-146b-5p
RSF1
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BLCA -0.08; TCGA BRCA -0.138; TCGA CESC -0.095; TCGA HNSC -0.082; TCGA KIRC -0.087; TCGA KIRP -0.155; TCGA LGG -0.205; TCGA LIHC -0.069; TCGA LUAD -0.092; TCGA LUSC -0.118; TCGA PRAD -0.124; TCGA SARC -0.112
hsa-miR-146b-5p
RHOT1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.055; TCGA BRCA -0.146; TCGA CESC -0.055; TCGA COAD -0.088; TCGA ESCA -0.093; TCGA HNSC -0.09; TCGA KIRP -0.068; TCGA LIHC -0.053; TCGA LUSC -0.063; TCGA PAAD -0.098; TCGA PRAD -0.093; TCGA SARC -0.112; TCGA STAD -0.094; TCGA UCEC -0.065
hsa-miR-146b-5p
EXPH5
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC
miRanda
TCGA BLCA -0.238; TCGA CESC -0.186; TCGA COAD -0.151; TCGA ESCA -0.237; TCGA HNSC -0.425; TCGA KIRC -0.355; TCGA KIRP -0.256; TCGA LIHC -0.201; TCGA LUSC -0.116; TCGA SARC -0.268
hsa-miR-146b-5p
RREB1
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.067; TCGA BRCA -0.185; TCGA HNSC -0.237; TCGA KIRC -0.051; TCGA KIRP -0.066; TCGA LUAD -0.076; TCGA LUSC -0.113; TCGA PRAD -0.116; TCGA THCA -0.051; TCGA UCEC -0.138
hsa-miR-146b-5p
WASF3
10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.162; TCGA HNSC -0.289; TCGA KIRC -0.274; TCGA KIRP -0.153; TCGA LGG -0.209; TCGA LUAD -0.193; TCGA OV -0.152; TCGA THCA -0.262; TCGA STAD -0.478; TCGA UCEC -0.264
hsa-miR-146b-5p
COL4A3BP
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.285; TCGA ESCA -0.136; TCGA HNSC -0.09; TCGA KIRC -0.051; TCGA KIRP -0.055; TCGA LIHC -0.061; TCGA PRAD -0.124; TCGA SARC -0.105; TCGA STAD -0.072
hsa-miR-146b-5p
DLG2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.512; TCGA BRCA -0.221; TCGA COAD -0.308; TCGA ESCA -0.372; TCGA HNSC -0.517; TCGA KIRC -0.297; TCGA LIHC -0.137; TCGA OV -0.202; TCGA PRAD -0.115; TCGA SARC -0.298; TCGA THCA -0.472; TCGA STAD -0.676; TCGA UCEC -0.778
hsa-miR-146b-5p
STAU2
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC
miRanda
TCGA BLCA -0.097; TCGA BRCA -0.138; TCGA COAD -0.171; TCGA ESCA -0.096; TCGA HNSC -0.218; TCGA LUAD -0.102; TCGA LUSC -0.107; TCGA PAAD -0.063; TCGA SARC -0.058
hsa-miR-146b-5p
TJP1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.123; TCGA BRCA -0.159; TCGA CESC -0.134; TCGA HNSC -0.24; TCGA KIRC -0.123; TCGA KIRP -0.124; TCGA LGG -0.091; TCGA LIHC -0.092; TCGA LUAD -0.144; TCGA PRAD -0.078; TCGA SARC -0.139; TCGA STAD -0.14; TCGA UCEC -0.1
hsa-miR-146b-5p
SCOC
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PAAD; STAD
miRanda
TCGA BLCA -0.063; TCGA BRCA -0.148; TCGA CESC -0.075; TCGA HNSC -0.085; TCGA KIRC -0.137; TCGA KIRP -0.087; TCGA LUAD -0.118; TCGA PAAD -0.132; TCGA STAD -0.128
hsa-miR-146b-5p
DICER1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.176; TCGA HNSC -0.124; TCGA KIRC -0.118; TCGA KIRP -0.109; TCGA LGG -0.102; TCGA LIHC -0.076; TCGA LUAD -0.052; TCGA SARC -0.06; TCGA THCA -0.101; TCGA UCEC -0.07
hsa-miR-146b-5p
MAPK10
13 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.59; TCGA BRCA -0.153; TCGA HNSC -0.296; TCGA KIRC -0.238; TCGA KIRP -0.155; TCGA LGG -0.065; TCGA LIHC -0.252; TCGA OV -0.17; TCGA PRAD -0.107; TCGA SARC -0.657; TCGA THCA -0.107; TCGA STAD -0.538; TCGA UCEC -0.187
hsa-miR-146b-5p
ITSN1
9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; PRAD; STAD
miRanda
TCGA BLCA -0.055; TCGA BRCA -0.185; TCGA CESC -0.097; TCGA HNSC -0.062; TCGA LGG -0.087; TCGA LIHC -0.061; TCGA LUAD -0.057; TCGA PRAD -0.152; TCGA STAD -0.1
hsa-miR-146b-5p
ZNF562
10 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.141; TCGA BRCA -0.05; TCGA HNSC -0.13; TCGA KIRP -0.072; TCGA LGG -0.062; TCGA LIHC -0.084; TCGA LUSC -0.115; TCGA PAAD -0.073; TCGA SARC -0.12; TCGA UCEC -0.068
hsa-miR-146b-5p
XK
12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.14; TCGA COAD -0.165; TCGA ESCA -0.468; TCGA HNSC -0.472; TCGA KIRP -0.384; TCGA LUAD -0.241; TCGA LUSC -0.241; TCGA PAAD -0.446; TCGA PRAD -0.3; TCGA SARC -0.776; TCGA THCA -0.189; TCGA STAD -0.239
hsa-miR-146b-5p
GARNL3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; OV; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.419; TCGA BRCA -0.263; TCGA CESC -0.17; TCGA COAD -0.283; TCGA ESCA -0.221; TCGA HNSC -0.16; TCGA KIRC -0.156; TCGA KIRP -0.091; TCGA LIHC -0.282; TCGA OV -0.108; TCGA PAAD -0.265; TCGA SARC -0.332; TCGA THCA -0.185; TCGA STAD -0.323; TCGA UCEC -0.348
hsa-miR-146b-5p
ERCC6
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC
miRanda
TCGA BLCA -0.097; TCGA BRCA -0.116; TCGA COAD -0.106; TCGA HNSC -0.097; TCGA KIRC -0.069; TCGA KIRP -0.132; TCGA LGG -0.14; TCGA LIHC -0.064; TCGA PRAD -0.076; TCGA SARC -0.054
hsa-miR-146b-5p
PARK2
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.511; TCGA BRCA -0.225; TCGA COAD -0.446; TCGA ESCA -0.501; TCGA HNSC -0.332; TCGA KIRC -0.242; TCGA KIRP -0.23; TCGA LUAD -0.218; TCGA PAAD -0.161; TCGA PRAD -0.208; TCGA SARC -0.243; TCGA THCA -0.136; TCGA STAD -0.618; TCGA UCEC -0.256
hsa-miR-146b-5p
TCP11L2
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.289; TCGA BRCA -0.342; TCGA CESC -0.172; TCGA ESCA -0.231; TCGA HNSC -0.333; TCGA KIRC -0.081; TCGA KIRP -0.107; TCGA LGG -0.091; TCGA LUAD -0.152; TCGA LUSC -0.096; TCGA PRAD -0.175; TCGA SARC -0.189; TCGA STAD -0.168; TCGA UCEC -0.133
hsa-miR-146b-5p
AKAP9
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; OV; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.115; TCGA BRCA -0.258; TCGA COAD -0.117; TCGA HNSC -0.189; TCGA KIRC -0.168; TCGA KIRP -0.208; TCGA LGG -0.13; TCGA LIHC -0.175; TCGA OV -0.056; TCGA PAAD -0.217; TCGA SARC -0.106; TCGA UCEC -0.087
hsa-miR-146b-5p
BRPF3
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.064; TCGA BRCA -0.147; TCGA COAD -0.243; TCGA ESCA -0.16; TCGA HNSC -0.135; TCGA KIRC -0.107; TCGA KIRP -0.113; TCGA LGG -0.13; TCGA LIHC -0.066; TCGA LUSC -0.079; TCGA PAAD -0.121; TCGA PRAD -0.102; TCGA SARC -0.107; TCGA STAD -0.074
hsa-miR-146b-5p
EFS
10 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.286; TCGA HNSC -0.223; TCGA KIRP -0.226; TCGA LGG -0.236; TCGA LIHC -0.175; TCGA LUSC -0.295; TCGA OV -0.153; TCGA PRAD -0.243; TCGA SARC -0.2; TCGA STAD -0.455
hsa-miR-146b-5p
CHD9
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.133; TCGA BRCA -0.197; TCGA CESC -0.134; TCGA COAD -0.162; TCGA HNSC -0.171; TCGA KIRC -0.066; TCGA KIRP -0.112; TCGA LGG -0.188; TCGA LIHC -0.096; TCGA PRAD -0.176; TCGA SARC -0.07; TCGA STAD -0.07; TCGA UCEC -0.176
hsa-miR-146b-5p
USP54
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.18; TCGA BRCA -0.059; TCGA CESC -0.213; TCGA COAD -0.242; TCGA ESCA -0.352; TCGA HNSC -0.31; TCGA KIRC -0.08; TCGA KIRP -0.061; TCGA LGG -0.264; TCGA SARC -0.216; TCGA THCA -0.083; TCGA STAD -0.115; TCGA UCEC -0.142
hsa-miR-146b-5p
SPOP
10 cancers: BLCA; BRCA; CESC; ESCA; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.072; TCGA BRCA -0.183; TCGA CESC -0.09; TCGA ESCA -0.15; TCGA OV -0.077; TCGA PAAD -0.117; TCGA PRAD -0.131; TCGA SARC -0.176; TCGA STAD -0.17; TCGA UCEC -0.082
hsa-miR-146b-5p
UBXN4
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD
miRanda
TCGA BLCA -0.08; TCGA BRCA -0.094; TCGA CESC -0.08; TCGA HNSC -0.1; TCGA KIRP -0.053; TCGA LIHC -0.06; TCGA LUAD -0.055; TCGA LUSC -0.099; TCGA PRAD -0.064
hsa-miR-146b-5p
ATXN1L
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.06; TCGA BRCA -0.116; TCGA COAD -0.08; TCGA HNSC -0.139; TCGA KIRC -0.1; TCGA KIRP -0.072; TCGA LGG -0.075; TCGA LUAD -0.076; TCGA PRAD -0.153; TCGA SARC -0.106; TCGA THCA -0.064; TCGA STAD -0.1; TCGA UCEC -0.097
hsa-miR-146b-5p
SNX13
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.113; TCGA BRCA -0.207; TCGA CESC -0.087; TCGA COAD -0.102; TCGA HNSC -0.115; TCGA KIRC -0.065; TCGA KIRP -0.098; TCGA LIHC -0.08; TCGA PAAD -0.144; TCGA PRAD -0.086; TCGA SARC -0.075; TCGA STAD -0.058; TCGA UCEC -0.099
hsa-miR-146b-5p
SIRT1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.213; TCGA CESC -0.084; TCGA HNSC -0.107; TCGA KIRP -0.098; TCGA LGG -0.22; TCGA LIHC -0.094; TCGA LUAD -0.092; TCGA PRAD -0.09; TCGA SARC -0.063; TCGA UCEC -0.102
hsa-miR-146b-5p
MPPE1
11 cancers: BLCA; BRCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.112; TCGA HNSC -0.078; TCGA KIRC -0.087; TCGA LUAD -0.063; TCGA PAAD -0.084; TCGA PRAD -0.097; TCGA SARC -0.126; TCGA THCA -0.094; TCGA STAD -0.075; TCGA UCEC -0.084
hsa-miR-146b-5p
ZNF561
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.256; TCGA BRCA -0.077; TCGA ESCA -0.141; TCGA HNSC -0.115; TCGA KIRP -0.053; TCGA LIHC -0.091; TCGA LUSC -0.065; TCGA PAAD -0.101; TCGA PRAD -0.106; TCGA SARC -0.193; TCGA UCEC -0.104
hsa-miR-146b-5p
ARID2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BLCA -0.212; TCGA BRCA -0.228; TCGA CESC -0.066; TCGA ESCA -0.086; TCGA HNSC -0.141; TCGA KIRP -0.058; TCGA LGG -0.156; TCGA LIHC -0.051; TCGA LUAD -0.059; TCGA LUSC -0.162; TCGA PRAD -0.109; TCGA SARC -0.103
hsa-miR-146b-5p
KLHL24
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUSC; OV; SARC
miRanda
TCGA BLCA -0.183; TCGA BRCA -0.086; TCGA CESC -0.18; TCGA COAD -0.224; TCGA HNSC -0.2; TCGA KIRC -0.06; TCGA LGG -0.109; TCGA LIHC -0.123; TCGA LUSC -0.227; TCGA OV -0.095; TCGA SARC -0.154
hsa-miR-146b-5p
PLEKHA5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.179; TCGA BRCA -0.109; TCGA CESC -0.231; TCGA COAD -0.209; TCGA ESCA -0.146; TCGA HNSC -0.135; TCGA LGG -0.16; TCGA LIHC -0.056; TCGA LUSC -0.143; TCGA PRAD -0.115; TCGA SARC -0.097; TCGA STAD -0.132; TCGA UCEC -0.229
hsa-miR-146b-5p
ZNF37A
9 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.084; TCGA BRCA -0.147; TCGA HNSC -0.067; TCGA KIRP -0.13; TCGA LGG -0.11; TCGA LIHC -0.066; TCGA SARC -0.109; TCGA THCA -0.063; TCGA UCEC -0.078
hsa-miR-146b-5p
TEAD3
10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.211; TCGA COAD -0.118; TCGA ESCA -0.143; TCGA HNSC -0.068; TCGA LUAD -0.078; TCGA LUSC -0.146; TCGA PRAD -0.093; TCGA SARC -0.278; TCGA STAD -0.279; TCGA UCEC -0.095
hsa-miR-146b-5p
MICAL3
10 cancers: BLCA; COAD; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.054; TCGA COAD -0.191; TCGA HNSC -0.061; TCGA LGG -0.164; TCGA LUSC -0.173; TCGA PAAD -0.091; TCGA PRAD -0.066; TCGA SARC -0.343; TCGA STAD -0.08; TCGA UCEC -0.114
hsa-miR-146b-5p
ESCO1
9 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; LUSC; PAAD; SARC
miRanda
TCGA BLCA -0.067; TCGA BRCA -0.059; TCGA CESC -0.06; TCGA KIRP -0.079; TCGA LGG -0.074; TCGA LUAD -0.076; TCGA LUSC -0.173; TCGA PAAD -0.08; TCGA SARC -0.064
hsa-miR-146b-5p
DYNC1I2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC
miRanda
TCGA BLCA -0.063; TCGA BRCA -0.171; TCGA CESC -0.152; TCGA COAD -0.125; TCGA ESCA -0.075; TCGA HNSC -0.094; TCGA KIRC -0.057; TCGA KIRP -0.064; TCGA LIHC -0.051; TCGA LUAD -0.13; TCGA LUSC -0.085; TCGA OV -0.132; TCGA PRAD -0.059; TCGA SARC -0.062
hsa-miR-146b-5p
LNX2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD
miRanda
TCGA BLCA -0.145; TCGA BRCA -0.171; TCGA COAD -0.254; TCGA ESCA -0.175; TCGA HNSC -0.161; TCGA KIRC -0.105; TCGA KIRP -0.11; TCGA LIHC -0.09; TCGA LUAD -0.144; TCGA OV -0.121; TCGA PAAD -0.088; TCGA PRAD -0.068
hsa-miR-146b-5p
GCC2
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.14; TCGA BRCA -0.185; TCGA COAD -0.089; TCGA HNSC -0.064; TCGA KIRP -0.11; TCGA LIHC -0.056; TCGA PRAD -0.104; TCGA SARC -0.053; TCGA UCEC -0.126
hsa-miR-146b-5p
PPM1H
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.361; TCGA BRCA -0.16; TCGA CESC -0.289; TCGA COAD -0.257; TCGA KIRC -0.305; TCGA KIRP -0.112; TCGA LIHC -0.211; TCGA LUAD -0.239; TCGA LUSC -0.256; TCGA PAAD -0.244; TCGA THCA -0.136; TCGA UCEC -0.169
hsa-miR-146b-5p
PNPLA8
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.14; TCGA BRCA -0.14; TCGA CESC -0.084; TCGA COAD -0.072; TCGA HNSC -0.136; TCGA KIRC -0.115; TCGA KIRP -0.144; TCGA LGG -0.06; TCGA LUAD -0.055; TCGA PRAD -0.105; TCGA SARC -0.098; TCGA THCA -0.064; TCGA STAD -0.097; TCGA UCEC -0.095
hsa-miR-146b-5p
BCLAF1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.104; TCGA BRCA -0.101; TCGA CESC -0.101; TCGA HNSC -0.078; TCGA KIRC -0.072; TCGA KIRP -0.071; TCGA LGG -0.077; TCGA PAAD -0.064; TCGA SARC -0.059; TCGA UCEC -0.059
hsa-miR-146b-5p
ARFGEF1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC
miRanda
TCGA BLCA -0.094; TCGA BRCA -0.122; TCGA COAD -0.188; TCGA ESCA -0.106; TCGA HNSC -0.113; TCGA KIRC -0.076; TCGA KIRP -0.109; TCGA LGG -0.062; TCGA LUSC -0.061
hsa-miR-146b-5p
RERE
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.268; TCGA BRCA -0.19; TCGA CESC -0.115; TCGA COAD -0.111; TCGA ESCA -0.163; TCGA HNSC -0.11; TCGA KIRC -0.104; TCGA KIRP -0.056; TCGA LGG -0.059; TCGA LUAD -0.089; TCGA PRAD -0.07; TCGA SARC -0.101; TCGA STAD -0.188; TCGA UCEC -0.11
hsa-miR-146b-5p
PCSK2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.467; TCGA BRCA -0.316; TCGA CESC -0.36; TCGA ESCA -0.754; TCGA HNSC -0.601; TCGA KIRP -0.205; TCGA LGG -0.261; TCGA LUAD -0.749; TCGA PRAD -0.68; TCGA STAD -1.19; TCGA UCEC -0.241
hsa-miR-146b-5p
ADD1
9 cancers: BLCA; BRCA; ESCA; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.11; TCGA BRCA -0.168; TCGA ESCA -0.081; TCGA LGG -0.056; TCGA LUAD -0.085; TCGA PRAD -0.093; TCGA SARC -0.078; TCGA STAD -0.166; TCGA UCEC -0.098
hsa-miR-146b-5p
RPRD2
12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.142; TCGA BRCA -0.165; TCGA COAD -0.118; TCGA HNSC -0.173; TCGA LGG -0.123; TCGA LIHC -0.092; TCGA LUAD -0.081; TCGA LUSC -0.149; TCGA PAAD -0.127; TCGA PRAD -0.136; TCGA SARC -0.138; TCGA STAD -0.053
hsa-miR-146b-5p
MBNL2
10 cancers: BLCA; BRCA; COAD; KIRP; LUAD; OV; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.106; TCGA BRCA -0.118; TCGA COAD -0.095; TCGA KIRP -0.089; TCGA LUAD -0.108; TCGA OV -0.127; TCGA PRAD -0.205; TCGA SARC -0.215; TCGA STAD -0.103; TCGA UCEC -0.107
hsa-miR-146b-5p
MFSD6
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.155; TCGA BRCA -0.128; TCGA CESC -0.149; TCGA ESCA -0.275; TCGA HNSC -0.288; TCGA KIRC -0.114; TCGA KIRP -0.132; TCGA LUAD -0.222; TCGA LUSC -0.139; TCGA PAAD -0.216; TCGA PRAD -0.154; TCGA SARC -0.22; TCGA STAD -0.06; TCGA UCEC -0.116
hsa-miR-146b-5p
RABGAP1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.107; TCGA CESC -0.093; TCGA COAD -0.093; TCGA ESCA -0.099; TCGA KIRC -0.123; TCGA KIRP -0.099; TCGA LGG -0.156; TCGA LUAD -0.083; TCGA LUSC -0.082; TCGA OV -0.074; TCGA PAAD -0.104; TCGA PRAD -0.112; TCGA SARC -0.265; TCGA STAD -0.18; TCGA UCEC -0.119
hsa-miR-146b-5p
RCOR3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.195; TCGA BRCA -0.228; TCGA CESC -0.083; TCGA COAD -0.132; TCGA HNSC -0.113; TCGA KIRP -0.062; TCGA LGG -0.103; TCGA PRAD -0.095; TCGA SARC -0.147; TCGA STAD -0.116; TCGA UCEC -0.141
hsa-miR-146b-5p
TOM1L1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; SARC; THCA
miRanda
TCGA BLCA -0.143; TCGA BRCA -0.258; TCGA CESC -0.162; TCGA COAD -0.123; TCGA ESCA -0.237; TCGA HNSC -0.215; TCGA KIRC -0.185; TCGA KIRP -0.119; TCGA LUSC -0.169; TCGA PAAD -0.225; TCGA SARC -0.269; TCGA THCA -0.071
hsa-miR-146b-5p
SPRED2
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PRAD
miRanda
TCGA BLCA -0.206; TCGA BRCA -0.255; TCGA CESC -0.255; TCGA COAD -0.103; TCGA HNSC -0.154; TCGA KIRC -0.064; TCGA KIRP -0.134; TCGA LUSC -0.065; TCGA PRAD -0.103
hsa-miR-146b-5p
HERC1
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.141; TCGA BRCA -0.185; TCGA ESCA -0.131; TCGA HNSC -0.156; TCGA KIRC -0.119; TCGA KIRP -0.144; TCGA LGG -0.095; TCGA LIHC -0.094; TCGA PRAD -0.123; TCGA SARC -0.148; TCGA THCA -0.067; TCGA STAD -0.11; TCGA UCEC -0.138
hsa-miR-146b-5p
DEPDC5
9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.146; TCGA HNSC -0.056; TCGA KIRC -0.081; TCGA KIRP -0.061; TCGA LGG -0.072; TCGA LIHC -0.137; TCGA PAAD -0.087; TCGA SARC -0.105; TCGA UCEC -0.054
hsa-miR-146b-5p
WBP4
9 cancers: BLCA; BRCA; CESC; KIRC; LUAD; OV; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.1; TCGA CESC -0.067; TCGA KIRC -0.057; TCGA LUAD -0.067; TCGA OV -0.127; TCGA PAAD -0.085; TCGA PRAD -0.113; TCGA UCEC -0.07
hsa-miR-146b-5p
ZNF417
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.092; TCGA BRCA -0.2; TCGA COAD -0.146; TCGA HNSC -0.093; TCGA KIRC -0.091; TCGA KIRP -0.109; TCGA LIHC -0.09; TCGA PRAD -0.08; TCGA SARC -0.122; TCGA UCEC -0.113
hsa-miR-146b-5p
TET2
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.192; TCGA BRCA -0.114; TCGA CESC -0.168; TCGA HNSC -0.232; TCGA KIRP -0.093; TCGA LGG -0.204; TCGA LIHC -0.08; TCGA LUAD -0.073; TCGA LUSC -0.128; TCGA PRAD -0.052; TCGA SARC -0.051; TCGA UCEC -0.171
hsa-miR-146b-5p
GTF2IRD2B
14 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.394; TCGA BRCA -0.278; TCGA COAD -0.48; TCGA HNSC -0.157; TCGA KIRC -0.118; TCGA KIRP -0.099; TCGA LGG -0.122; TCGA LIHC -0.146; TCGA PAAD -0.17; TCGA PRAD -0.1; TCGA SARC -0.199; TCGA THCA -0.062; TCGA STAD -0.267; TCGA UCEC -0.249
hsa-miR-146b-5p
COG6
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.098; TCGA BRCA -0.134; TCGA CESC -0.114; TCGA COAD -0.122; TCGA HNSC -0.136; TCGA KIRC -0.066; TCGA KIRP -0.094; TCGA LUAD -0.119; TCGA OV -0.132; TCGA PAAD -0.158; TCGA PRAD -0.145; TCGA UCEC -0.104
hsa-miR-146b-5p
TMEM185A
9 cancers: BLCA; BRCA; COAD; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.084; TCGA BRCA -0.089; TCGA COAD -0.094; TCGA LIHC -0.06; TCGA LUSC -0.12; TCGA PAAD -0.054; TCGA PRAD -0.054; TCGA STAD -0.152; TCGA UCEC -0.062
hsa-miR-146b-5p
TSC22D2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.065; TCGA BRCA -0.063; TCGA CESC -0.18; TCGA COAD -0.164; TCGA HNSC -0.123; TCGA KIRC -0.07; TCGA KIRP -0.11; TCGA LUSC -0.086; TCGA PRAD -0.114; TCGA SARC -0.12; TCGA STAD -0.148
hsa-miR-146b-5p
DTX3
10 cancers: BLCA; BRCA; KIRC; LGG; LIHC; PAAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.127; TCGA KIRC -0.092; TCGA LGG -0.057; TCGA LIHC -0.098; TCGA PAAD -0.128; TCGA SARC -0.13; TCGA THCA -0.052; TCGA STAD -0.352; TCGA UCEC -0.086
hsa-miR-146b-5p
PIBF1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.102; TCGA BRCA -0.08; TCGA CESC -0.141; TCGA COAD -0.173; TCGA HNSC -0.09; TCGA KIRP -0.09; TCGA LGG -0.081; TCGA LUAD -0.058; TCGA OV -0.078; TCGA PAAD -0.066; TCGA PRAD -0.095; TCGA UCEC -0.067
hsa-miR-146b-5p
MMRN2
9 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.23; TCGA BRCA -0.142; TCGA KIRC -0.14; TCGA KIRP -0.132; TCGA LIHC -0.068; TCGA LUAD -0.132; TCGA SARC -0.088; TCGA STAD -0.11; TCGA UCEC -0.183
hsa-miR-146b-5p
SYNPO2
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.186; TCGA BRCA -0.214; TCGA COAD -0.506; TCGA ESCA -0.427; TCGA LGG -0.096; TCGA LIHC -0.139; TCGA LUAD -0.12; TCGA PRAD -0.484; TCGA SARC -0.851; TCGA STAD -0.927; TCGA UCEC -0.413
hsa-miR-146b-5p
COL21A1
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.206; TCGA BRCA -0.139; TCGA CESC -0.356; TCGA COAD -0.423; TCGA HNSC -0.245; TCGA PRAD -0.207; TCGA SARC -0.272; TCGA STAD -0.622; TCGA UCEC -0.585
hsa-miR-146b-5p
RFX2
9 cancers: BLCA; CESC; ESCA; LIHC; OV; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.181; TCGA CESC -0.253; TCGA ESCA -0.183; TCGA LIHC -0.111; TCGA OV -0.161; TCGA PAAD -0.204; TCGA SARC -0.16; TCGA STAD -0.245; TCGA UCEC -0.352
hsa-miR-146b-5p
RBBP6
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; OV; SARC
miRanda
TCGA BLCA -0.123; TCGA BRCA -0.07; TCGA CESC -0.089; TCGA COAD -0.058; TCGA HNSC -0.065; TCGA KIRP -0.057; TCGA LGG -0.123; TCGA OV -0.072; TCGA SARC -0.078
hsa-miR-146b-5p
ANO5
9 cancers: BLCA; BRCA; KIRC; OV; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.491; TCGA BRCA -0.279; TCGA KIRC -0.226; TCGA OV -0.387; TCGA PAAD -0.211; TCGA PRAD -0.363; TCGA SARC -0.362; TCGA THCA -0.259; TCGA STAD -0.738
hsa-miR-146b-5p
GIN1
11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.225; TCGA KIRC -0.099; TCGA KIRP -0.083; TCGA LGG -0.068; TCGA PAAD -0.175; TCGA PRAD -0.063; TCGA SARC -0.107; TCGA THCA -0.062; TCGA STAD -0.058; TCGA UCEC -0.052
hsa-miR-146b-5p
WEE1
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; SARC; UCEC
miRanda
TCGA BLCA -0.199; TCGA CESC -0.21; TCGA COAD -0.125; TCGA KIRC -0.11; TCGA KIRP -0.151; TCGA LUAD -0.086; TCGA LUSC -0.12; TCGA SARC -0.117; TCGA UCEC -0.162
hsa-miR-146b-5p
LIMCH1
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.526; TCGA BRCA -0.241; TCGA COAD -0.266; TCGA ESCA -0.347; TCGA HNSC -0.425; TCGA KIRC -0.25; TCGA KIRP -0.233; TCGA LGG -0.098; TCGA LIHC -0.255; TCGA LUAD -0.16; TCGA OV -0.135; TCGA PAAD -0.296; TCGA PRAD -0.146; TCGA SARC -0.409; TCGA THCA -0.071; TCGA STAD -0.317; TCGA UCEC -0.168
hsa-miR-146b-5p
ADAL
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.082; TCGA BRCA -0.227; TCGA CESC -0.117; TCGA HNSC -0.135; TCGA KIRC -0.183; TCGA KIRP -0.122; TCGA LIHC -0.076; TCGA LUSC -0.094; TCGA PAAD -0.095; TCGA PRAD -0.054; TCGA SARC -0.165; TCGA THCA -0.137; TCGA STAD -0.121
hsa-miR-146b-5p
RALGAPB
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC
miRanda
TCGA BLCA -0.101; TCGA BRCA -0.151; TCGA CESC -0.084; TCGA COAD -0.213; TCGA HNSC -0.099; TCGA KIRC -0.075; TCGA KIRP -0.105; TCGA LUAD -0.089; TCGA PAAD -0.11; TCGA PRAD -0.078; TCGA SARC -0.064
hsa-miR-146b-5p
RGPD5
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.177; TCGA BRCA -0.311; TCGA CESC -0.219; TCGA HNSC -0.183; TCGA KIRC -0.101; TCGA KIRP -0.154; TCGA PRAD -0.265; TCGA SARC -0.149; TCGA UCEC -0.296
hsa-miR-146b-5p
EPS8
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.305; TCGA BRCA -0.134; TCGA CESC -0.458; TCGA ESCA -0.23; TCGA HNSC -0.201; TCGA LIHC -0.063; TCGA PRAD -0.106; TCGA SARC -0.066; TCGA UCEC -0.3
hsa-miR-146b-5p
ZNF678
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.157; TCGA BRCA -0.275; TCGA CESC -0.132; TCGA HNSC -0.16; TCGA KIRC -0.089; TCGA KIRP -0.185; TCGA LGG -0.255; TCGA LIHC -0.179; TCGA PRAD -0.089; TCGA THCA -0.074; TCGA UCEC -0.147
hsa-miR-146b-5p
CAT
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.12; TCGA BRCA -0.195; TCGA CESC -0.13; TCGA COAD -0.126; TCGA ESCA -0.158; TCGA KIRC -0.265; TCGA KIRP -0.107; TCGA PRAD -0.134; TCGA STAD -0.172; TCGA UCEC -0.158
hsa-miR-146b-5p
MEF2A
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.056; TCGA BRCA -0.082; TCGA CESC -0.13; TCGA HNSC -0.122; TCGA KIRP -0.127; TCGA LIHC -0.069; TCGA PRAD -0.153; TCGA SARC -0.236; TCGA STAD -0.188; TCGA UCEC -0.184
hsa-miR-146b-5p
METTL7A
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.44; TCGA BRCA -0.112; TCGA ESCA -0.343; TCGA HNSC -0.143; TCGA KIRC -0.189; TCGA PRAD -0.212; TCGA SARC -0.169; TCGA THCA -0.141; TCGA STAD -0.345; TCGA UCEC -0.24
hsa-miR-146b-5p
ZSWIM5
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.477; TCGA BRCA -0.454; TCGA COAD -0.291; TCGA ESCA -0.384; TCGA HNSC -0.163; TCGA KIRC -0.079; TCGA KIRP -0.119; TCGA LGG -0.24; TCGA LUAD -0.104; TCGA PAAD -0.343; TCGA PRAD -0.128; TCGA SARC -0.167; TCGA STAD -0.241; TCGA UCEC -0.445
hsa-miR-146b-5p
ZNF507
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; SARC
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.071; TCGA CESC -0.101; TCGA COAD -0.106; TCGA HNSC -0.134; TCGA KIRP -0.083; TCGA LGG -0.073; TCGA LIHC -0.082; TCGA LUSC -0.09; TCGA PAAD -0.099; TCGA SARC -0.111
hsa-miR-146b-5p
ARID1A
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.092; TCGA HNSC -0.105; TCGA KIRC -0.063; TCGA KIRP -0.082; TCGA LGG -0.067; TCGA LUAD -0.068; TCGA LUSC -0.072; TCGA PRAD -0.061; TCGA SARC -0.052
hsa-miR-146b-5p
FBXO8
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.101; TCGA BRCA -0.183; TCGA HNSC -0.089; TCGA KIRC -0.11; TCGA KIRP -0.085; TCGA LIHC -0.074; TCGA PAAD -0.081; TCGA PRAD -0.068; TCGA SARC -0.096; TCGA THCA -0.055; TCGA STAD -0.16; TCGA UCEC -0.094
hsa-miR-146b-5p
LRTOMT
11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.161; TCGA BRCA -0.312; TCGA KIRC -0.075; TCGA KIRP -0.06; TCGA LGG -0.069; TCGA LUAD -0.12; TCGA PAAD -0.196; TCGA SARC -0.122; TCGA THCA -0.089; TCGA STAD -0.107; TCGA UCEC -0.138
hsa-miR-146b-5p
SUCLG2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; STAD; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.172; TCGA COAD -0.126; TCGA ESCA -0.198; TCGA HNSC -0.075; TCGA KIRC -0.167; TCGA KIRP -0.079; TCGA LUAD -0.106; TCGA STAD -0.092; TCGA UCEC -0.085
hsa-miR-146b-5p
ABCG2
11 cancers: BLCA; BRCA; HNSC; KIRC; LGG; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.211; TCGA BRCA -0.319; TCGA HNSC -0.129; TCGA KIRC -0.226; TCGA LGG -0.071; TCGA OV -0.101; TCGA PRAD -0.279; TCGA SARC -0.137; TCGA THCA -0.091; TCGA STAD -0.289; TCGA UCEC -0.409
hsa-miR-146b-5p
ZNF41
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.178; TCGA BRCA -0.175; TCGA COAD -0.192; TCGA HNSC -0.138; TCGA KIRC -0.06; TCGA KIRP -0.148; TCGA LGG -0.091; TCGA LIHC -0.121; TCGA PRAD -0.086; TCGA SARC -0.117; TCGA THCA -0.054; TCGA UCEC -0.058
hsa-miR-146b-5p
MON2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.127; TCGA BRCA -0.189; TCGA CESC -0.065; TCGA COAD -0.068; TCGA HNSC -0.118; TCGA KIRP -0.078; TCGA LGG -0.071; TCGA LIHC -0.077; TCGA PAAD -0.099; TCGA SARC -0.063; TCGA UCEC -0.141
hsa-miR-146b-5p
SOS2
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.115; TCGA BRCA -0.184; TCGA CESC -0.093; TCGA COAD -0.166; TCGA HNSC -0.149; TCGA KIRC -0.148; TCGA KIRP -0.083; TCGA LGG -0.155; TCGA LIHC -0.11; TCGA PRAD -0.143; TCGA SARC -0.15; TCGA THCA -0.051; TCGA STAD -0.109; TCGA UCEC -0.085
hsa-miR-146b-5p
FBXO21
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.167; TCGA BRCA -0.154; TCGA CESC -0.07; TCGA COAD -0.115; TCGA ESCA -0.132; TCGA HNSC -0.143; TCGA KIRC -0.162; TCGA KIRP -0.136; TCGA LGG -0.12; TCGA LUAD -0.111; TCGA LUSC -0.14; TCGA PRAD -0.124; TCGA SARC -0.165; TCGA STAD -0.079; TCGA UCEC -0.093
hsa-miR-146b-5p
SH3GL2
11 cancers: BLCA; ESCA; KIRC; KIRP; LGG; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.428; TCGA ESCA -0.623; TCGA KIRC -0.785; TCGA KIRP -0.369; TCGA LGG -0.337; TCGA OV -0.262; TCGA PRAD -0.27; TCGA SARC -0.456; TCGA THCA -0.355; TCGA STAD -1.092; TCGA UCEC -0.308
hsa-miR-146b-5p
PPM1L
18 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.427; TCGA BRCA -0.126; TCGA CESC -0.398; TCGA ESCA -0.604; TCGA HNSC -0.509; TCGA KIRC -0.231; TCGA KIRP -0.252; TCGA LGG -0.302; TCGA LIHC -0.116; TCGA LUAD -0.314; TCGA LUSC -0.308; TCGA OV -0.13; TCGA PAAD -0.202; TCGA PRAD -0.23; TCGA SARC -0.363; TCGA THCA -0.307; TCGA STAD -0.315; TCGA UCEC -0.342
hsa-miR-146b-5p
GCOM1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.613; TCGA BRCA -0.156; TCGA COAD -0.285; TCGA ESCA -0.587; TCGA HNSC -0.378; TCGA KIRC -0.53; TCGA KIRP -0.313; TCGA LIHC -0.153; TCGA LUAD -0.132; TCGA PRAD -0.343; TCGA SARC -0.169; TCGA THCA -0.101; TCGA STAD -0.217; TCGA UCEC -0.302
hsa-miR-146b-5p
ZNF862
9 cancers: BLCA; BRCA; COAD; ESCA; LGG; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.292; TCGA BRCA -0.118; TCGA COAD -0.153; TCGA ESCA -0.159; TCGA LGG -0.12; TCGA SARC -0.153; TCGA THCA -0.104; TCGA STAD -0.076; TCGA UCEC -0.24
hsa-miR-146b-5p
SCP2
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.117; TCGA BRCA -0.168; TCGA ESCA -0.126; TCGA HNSC -0.095; TCGA KIRC -0.066; TCGA LIHC -0.09; TCGA PRAD -0.061; TCGA STAD -0.061; TCGA UCEC -0.102
hsa-miR-146b-5p
ACADM
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.077; TCGA BRCA -0.16; TCGA HNSC -0.126; TCGA KIRC -0.231; TCGA KIRP -0.121; TCGA LUAD -0.072; TCGA PAAD -0.1; TCGA PRAD -0.094; TCGA SARC -0.082; TCGA THCA -0.111; TCGA STAD -0.197
hsa-miR-146b-5p
FGFR2
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.146; TCGA CESC -0.298; TCGA ESCA -0.244; TCGA HNSC -0.315; TCGA KIRC -0.195; TCGA KIRP -0.208; TCGA LIHC -0.241; TCGA LUAD -0.185; TCGA LUSC -0.196; TCGA PRAD -0.321; TCGA SARC -0.62; TCGA THCA -0.114
hsa-miR-146b-5p
CHRNB2
9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.146; TCGA ESCA -0.311; TCGA HNSC -0.22; TCGA LGG -0.181; TCGA LUAD -0.282; TCGA LUSC -0.439; TCGA PAAD -0.445; TCGA STAD -0.406
hsa-miR-146b-5p
DNMBP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; UCEC
miRanda
TCGA BLCA -0.219; TCGA BRCA -0.278; TCGA CESC -0.132; TCGA COAD -0.149; TCGA ESCA -0.215; TCGA HNSC -0.142; TCGA KIRC -0.177; TCGA KIRP -0.108; TCGA LGG -0.172; TCGA LIHC -0.057; TCGA LUSC -0.093; TCGA PRAD -0.091; TCGA UCEC -0.133
hsa-miR-146b-5p
DNAL1
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.096; TCGA BRCA -0.288; TCGA CESC -0.137; TCGA ESCA -0.095; TCGA KIRC -0.133; TCGA KIRP -0.06; TCGA LIHC -0.075; TCGA LUAD -0.107; TCGA PAAD -0.157; TCGA THCA -0.098; TCGA STAD -0.068; TCGA UCEC -0.13
hsa-miR-146b-5p
ZFP14
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.233; TCGA BRCA -0.239; TCGA COAD -0.121; TCGA HNSC -0.121; TCGA KIRP -0.064; TCGA LGG -0.079; TCGA LIHC -0.077; TCGA PAAD -0.105; TCGA PRAD -0.08; TCGA SARC -0.143; TCGA UCEC -0.092
hsa-miR-146b-5p
BAZ2B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.244; TCGA BRCA -0.223; TCGA CESC -0.113; TCGA COAD -0.141; TCGA ESCA -0.128; TCGA HNSC -0.218; TCGA KIRP -0.059; TCGA LGG -0.157; TCGA LIHC -0.104; TCGA LUAD -0.055; TCGA PRAD -0.104; TCGA SARC -0.123; TCGA STAD -0.076; TCGA UCEC -0.12
hsa-miR-146b-5p
FAM174B
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PAAD; STAD
miRanda
TCGA BLCA -0.68; TCGA BRCA -0.287; TCGA CESC -0.312; TCGA ESCA -0.301; TCGA HNSC -0.111; TCGA KIRC -0.071; TCGA LIHC -0.187; TCGA LUAD -0.311; TCGA OV -0.133; TCGA PAAD -0.374; TCGA STAD -0.295
hsa-miR-146b-5p
BCAS3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.082; TCGA BRCA -0.173; TCGA CESC -0.075; TCGA COAD -0.258; TCGA ESCA -0.166; TCGA HNSC -0.136; TCGA KIRC -0.094; TCGA LUAD -0.135; TCGA LUSC -0.242; TCGA PAAD -0.112; TCGA PRAD -0.063; TCGA SARC -0.065; TCGA STAD -0.159
hsa-miR-146b-5p
RBPMS
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.295; TCGA BRCA -0.096; TCGA CESC -0.239; TCGA COAD -0.317; TCGA ESCA -0.285; TCGA LIHC -0.058; TCGA PRAD -0.191; TCGA SARC -0.443; TCGA STAD -0.411; TCGA UCEC -0.243
hsa-miR-146b-5p
TRAK2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.07; TCGA BRCA -0.235; TCGA CESC -0.125; TCGA ESCA -0.133; TCGA HNSC -0.116; TCGA KIRC -0.122; TCGA KIRP -0.09; TCGA LIHC -0.058; TCGA PRAD -0.08; TCGA SARC -0.128; TCGA STAD -0.11; TCGA UCEC -0.081
hsa-miR-146b-5p
GTF2IRD2
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.32; TCGA BRCA -0.237; TCGA COAD -0.37; TCGA ESCA -0.222; TCGA HNSC -0.12; TCGA KIRC -0.079; TCGA KIRP -0.073; TCGA LGG -0.088; TCGA LIHC -0.137; TCGA PAAD -0.176; TCGA PRAD -0.051; TCGA SARC -0.156; TCGA THCA -0.059; TCGA STAD -0.352; TCGA UCEC -0.203
hsa-miR-146b-5p
STXBP5
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD
miRanda
TCGA BLCA -0.097; TCGA BRCA -0.117; TCGA CESC -0.179; TCGA ESCA -0.157; TCGA HNSC -0.214; TCGA KIRP -0.076; TCGA LUAD -0.164; TCGA PAAD -0.127; TCGA PRAD -0.158
hsa-miR-146b-5p
EEPD1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.079; TCGA CESC -0.227; TCGA COAD -0.141; TCGA ESCA -0.386; TCGA HNSC -0.129; TCGA LGG -0.353; TCGA LUSC -0.141; TCGA SARC -0.14; TCGA THCA -0.06; TCGA STAD -0.158; TCGA UCEC -0.136
hsa-miR-146b-5p
AASS
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.214; TCGA BRCA -0.213; TCGA HNSC -0.135; TCGA KIRC -0.166; TCGA KIRP -0.145; TCGA LGG -0.07; TCGA LIHC -0.169; TCGA SARC -0.12; TCGA THCA -0.102; TCGA STAD -0.262; TCGA UCEC -0.282
hsa-miR-146b-5p
ZHX1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.114; TCGA HNSC -0.08; TCGA KIRC -0.098; TCGA KIRP -0.158; TCGA LGG -0.084; TCGA PRAD -0.084; TCGA SARC -0.115; TCGA THCA -0.08; TCGA STAD -0.078; TCGA UCEC -0.129
hsa-miR-146b-5p
ARPP19
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRanda; mirMAP
TCGA BLCA -0.089; TCGA BRCA -0.212; TCGA CESC -0.134; TCGA ESCA -0.117; TCGA HNSC -0.078; TCGA KIRC -0.074; TCGA KIRP -0.105; TCGA LIHC -0.05; TCGA LUAD -0.108; TCGA LUSC -0.075; TCGA PAAD -0.058; TCGA PRAD -0.109; TCGA SARC -0.123; TCGA UCEC -0.072
hsa-miR-146b-5p
LPP
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.169; TCGA BRCA -0.211; TCGA CESC -0.214; TCGA ESCA -0.239; TCGA HNSC -0.184; TCGA KIRP -0.095; TCGA LIHC -0.098; TCGA LUAD -0.087; TCGA LUSC -0.137; TCGA PRAD -0.34; TCGA SARC -0.384; TCGA THCA -0.129; TCGA STAD -0.348; TCGA UCEC -0.131
hsa-miR-146b-5p
OSBPL2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; SARC; STAD
miRanda
TCGA BLCA -0.165; TCGA CESC -0.07; TCGA COAD -0.144; TCGA ESCA -0.136; TCGA HNSC -0.112; TCGA KIRC -0.109; TCGA KIRP -0.082; TCGA LUAD -0.087; TCGA OV -0.063; TCGA PAAD -0.117; TCGA SARC -0.08; TCGA STAD -0.052
hsa-miR-146b-5p
LCA5
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; OV; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.181; TCGA BRCA -0.253; TCGA CESC -0.303; TCGA HNSC -0.229; TCGA KIRP -0.102; TCGA LIHC -0.107; TCGA OV -0.072; TCGA PRAD -0.233; TCGA SARC -0.257; TCGA UCEC -0.205
hsa-miR-146b-5p
PPP1R10
10 cancers: BLCA; CESC; ESCA; LGG; LUAD; LUSC; PAAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.139; TCGA CESC -0.071; TCGA ESCA -0.13; TCGA LGG -0.095; TCGA LUAD -0.054; TCGA LUSC -0.085; TCGA PAAD -0.085; TCGA SARC -0.094; TCGA THCA -0.056; TCGA UCEC -0.066
hsa-miR-146b-5p
TTC33
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.115; TCGA CESC -0.138; TCGA ESCA -0.117; TCGA HNSC -0.13; TCGA KIRC -0.062; TCGA KIRP -0.124; TCGA LGG -0.078; TCGA LIHC -0.064; TCGA LUAD -0.101; TCGA OV -0.067; TCGA PAAD -0.126; TCGA PRAD -0.123; TCGA SARC -0.176; TCGA STAD -0.092; TCGA UCEC -0.127
hsa-miR-146b-5p
PAQR3
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; UCEC
miRanda
TCGA BLCA -0.06; TCGA CESC -0.16; TCGA HNSC -0.189; TCGA KIRC -0.078; TCGA KIRP -0.095; TCGA LIHC -0.105; TCGA LUSC -0.139; TCGA PRAD -0.132; TCGA UCEC -0.112
hsa-miR-146b-5p
ZNF527
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.122; TCGA BRCA -0.121; TCGA HNSC -0.131; TCGA KIRC -0.086; TCGA KIRP -0.087; TCGA LIHC -0.121; TCGA SARC -0.166; TCGA THCA -0.079; TCGA STAD -0.087; TCGA UCEC -0.076
hsa-miR-146b-5p
MKRN1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; SARC
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.075; TCGA COAD -0.12; TCGA ESCA -0.075; TCGA HNSC -0.058; TCGA LGG -0.073; TCGA LUSC -0.136; TCGA PAAD -0.136; TCGA SARC -0.093
hsa-miR-146b-5p
TOX3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; OV; UCEC
miRanda
TCGA BLCA -1.359; TCGA BRCA -0.569; TCGA CESC -0.663; TCGA COAD -0.307; TCGA HNSC -0.481; TCGA KIRC -0.781; TCGA KIRP -0.427; TCGA LGG -0.486; TCGA LUAD -0.244; TCGA OV -0.981; TCGA UCEC -0.443
hsa-miR-146b-5p
BTG2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.485; TCGA BRCA -0.31; TCGA CESC -0.161; TCGA COAD -0.228; TCGA ESCA -0.324; TCGA HNSC -0.18; TCGA KIRC -0.227; TCGA KIRP -0.134; TCGA LGG -0.064; TCGA PRAD -0.151; TCGA SARC -0.172; TCGA THCA -0.054; TCGA STAD -0.452; TCGA UCEC -0.222
hsa-miR-146b-5p
KIF13B
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.206; TCGA BRCA -0.332; TCGA ESCA -0.263; TCGA HNSC -0.1; TCGA KIRC -0.273; TCGA KIRP -0.109; TCGA LIHC -0.07; TCGA LUAD -0.247; TCGA OV -0.111; TCGA PRAD -0.128; TCGA SARC -0.083; TCGA UCEC -0.26
hsa-miR-146b-5p
SLC6A4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.388; TCGA BRCA -0.499; TCGA CESC -0.243; TCGA COAD -0.951; TCGA ESCA -0.399; TCGA HNSC -0.876; TCGA KIRC -0.549; TCGA KIRP -0.301; TCGA PRAD -0.304; TCGA STAD -0.607; TCGA UCEC -0.169
hsa-miR-146b-5p
MPHOSPH8
14 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.197; TCGA COAD -0.142; TCGA HNSC -0.084; TCGA KIRC -0.099; TCGA KIRP -0.141; TCGA LGG -0.065; TCGA LUAD -0.06; TCGA OV -0.078; TCGA PAAD -0.096; TCGA PRAD -0.162; TCGA SARC -0.095; TCGA STAD -0.056; TCGA UCEC -0.113
hsa-miR-146b-5p
TUBB1
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; PAAD; THCA; UCEC
miRanda
TCGA BLCA -0.19; TCGA BRCA -0.106; TCGA KIRC -0.174; TCGA KIRP -0.136; TCGA LGG -0.059; TCGA LUAD -0.108; TCGA PAAD -0.369; TCGA THCA -0.164; TCGA UCEC -0.072
hsa-miR-146b-5p
GTF2I
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC
miRanda
TCGA BLCA -0.134; TCGA BRCA -0.182; TCGA HNSC -0.19; TCGA KIRC -0.087; TCGA KIRP -0.143; TCGA LGG -0.101; TCGA LUAD -0.06; TCGA LUSC -0.137; TCGA PAAD -0.122; TCGA PRAD -0.143; TCGA SARC -0.126
hsa-miR-146b-5p
ADH5
11 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.07; TCGA BRCA -0.067; TCGA KIRC -0.123; TCGA KIRP -0.061; TCGA LUAD -0.063; TCGA LUSC -0.104; TCGA PRAD -0.104; TCGA SARC -0.127; TCGA THCA -0.074; TCGA STAD -0.11; TCGA UCEC -0.075
hsa-miR-146b-5p
CCNDBP1
9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.101; TCGA BRCA -0.223; TCGA ESCA -0.146; TCGA KIRC -0.063; TCGA KIRP -0.11; TCGA LUAD -0.072; TCGA PRAD -0.06; TCGA SARC -0.091; TCGA STAD -0.095
hsa-miR-146b-5p
RNF14
9 cancers: BLCA; BRCA; ESCA; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.091; TCGA BRCA -0.199; TCGA ESCA -0.106; TCGA PAAD -0.109; TCGA PRAD -0.061; TCGA SARC -0.098; TCGA THCA -0.054; TCGA STAD -0.119; TCGA UCEC -0.065
hsa-miR-146b-5p
SGSM2
9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.265; TCGA BRCA -0.066; TCGA ESCA -0.171; TCGA KIRC -0.11; TCGA LGG -0.051; TCGA PAAD -0.166; TCGA SARC -0.073; TCGA STAD -0.135; TCGA UCEC -0.168
hsa-miR-146b-5p
FBXO3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PRAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.056; TCGA BRCA -0.209; TCGA CESC -0.119; TCGA COAD -0.064; TCGA ESCA -0.133; TCGA HNSC -0.144; TCGA KIRC -0.121; TCGA KIRP -0.12; TCGA LUAD -0.114; TCGA OV -0.068; TCGA PRAD -0.087; TCGA SARC -0.138; TCGA STAD -0.181; TCGA UCEC -0.166
hsa-miR-146b-5p
TBC1D20
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.084; TCGA BRCA -0.125; TCGA CESC -0.053; TCGA ESCA -0.092; TCGA HNSC -0.086; TCGA LUAD -0.101; TCGA PAAD -0.106; TCGA PRAD -0.064; TCGA STAD -0.088; TCGA UCEC -0.082
hsa-miR-146b-5p
FAM149A
12 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.36; TCGA BRCA -0.193; TCGA ESCA -0.448; TCGA KIRC -0.093; TCGA LIHC -0.208; TCGA LUAD -0.162; TCGA OV -0.198; TCGA PRAD -0.146; TCGA SARC -0.229; TCGA THCA -0.081; TCGA STAD -0.515; TCGA UCEC -0.3
hsa-miR-146b-5p
EFR3B
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.212; TCGA BRCA -0.352; TCGA COAD -0.341; TCGA HNSC -0.305; TCGA KIRC -0.273; TCGA KIRP -0.273; TCGA LGG -0.059; TCGA LIHC -0.102; TCGA PAAD -0.296; TCGA PRAD -0.136; TCGA STAD -0.243
hsa-miR-146b-5p
DIS3L
15 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.186; TCGA BRCA -0.245; TCGA ESCA -0.11; TCGA HNSC -0.156; TCGA KIRC -0.062; TCGA KIRP -0.124; TCGA LGG -0.06; TCGA LIHC -0.108; TCGA LUAD -0.096; TCGA LUSC -0.084; TCGA PAAD -0.115; TCGA PRAD -0.104; TCGA SARC -0.121; TCGA THCA -0.093; TCGA UCEC -0.087
hsa-miR-146b-5p
MED13L
14 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.36; TCGA COAD -0.131; TCGA HNSC -0.149; TCGA KIRP -0.101; TCGA LGG -0.198; TCGA LIHC -0.079; TCGA LUAD -0.152; TCGA LUSC -0.071; TCGA PRAD -0.136; TCGA SARC -0.115; TCGA THCA -0.097; TCGA STAD -0.092; TCGA UCEC -0.171
hsa-miR-146b-5p
WNK3
11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.269; TCGA HNSC -0.328; TCGA KIRC -0.461; TCGA KIRP -0.344; TCGA LGG -0.264; TCGA LIHC -0.163; TCGA LUAD -0.243; TCGA PRAD -0.201; TCGA SARC -0.207; TCGA THCA -0.064; TCGA STAD -0.311
hsa-miR-146b-5p
SYT9
10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.669; TCGA BRCA -0.888; TCGA KIRC -0.272; TCGA KIRP -0.42; TCGA LGG -0.128; TCGA LIHC -0.454; TCGA PRAD -0.382; TCGA THCA -0.439; TCGA STAD -0.555; TCGA UCEC -0.225
hsa-miR-146b-5p
HBP1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.059; TCGA BRCA -0.201; TCGA CESC -0.066; TCGA COAD -0.083; TCGA HNSC -0.147; TCGA KIRP -0.055; TCGA LGG -0.071; TCGA LUAD -0.077; TCGA PAAD -0.057; TCGA PRAD -0.076; TCGA SARC -0.118; TCGA STAD -0.126; TCGA UCEC -0.098
hsa-miR-146b-5p
CROT
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.285; TCGA BRCA -0.229; TCGA COAD -0.194; TCGA ESCA -0.158; TCGA HNSC -0.122; TCGA KIRC -0.122; TCGA KIRP -0.081; TCGA PRAD -0.094; TCGA SARC -0.071; TCGA THCA -0.064; TCGA STAD -0.171; TCGA UCEC -0.143
hsa-miR-146b-5p
NT5DC1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.081; TCGA BRCA -0.175; TCGA CESC -0.127; TCGA ESCA -0.131; TCGA HNSC -0.092; TCGA KIRC -0.09; TCGA KIRP -0.089; TCGA SARC -0.069; TCGA THCA -0.066; TCGA UCEC -0.057
hsa-miR-146b-5p
TADA1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUSC; OV; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.073; TCGA BRCA -0.07; TCGA CESC -0.07; TCGA HNSC -0.106; TCGA KIRP -0.07; TCGA LGG -0.06; TCGA LUSC -0.128; TCGA OV -0.083; TCGA PAAD -0.111; TCGA SARC -0.137; TCGA UCEC -0.065
hsa-miR-146b-5p
PNPLA4
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; PAAD; SARC; THCA
miRanda
TCGA BLCA -0.106; TCGA BRCA -0.32; TCGA CESC -0.114; TCGA HNSC -0.085; TCGA KIRC -0.144; TCGA KIRP -0.087; TCGA LIHC -0.118; TCGA PAAD -0.223; TCGA SARC -0.102; TCGA THCA -0.108
hsa-miR-146b-5p
ARHGEF12
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.176; TCGA BRCA -0.244; TCGA CESC -0.088; TCGA COAD -0.072; TCGA ESCA -0.145; TCGA HNSC -0.166; TCGA KIRC -0.131; TCGA KIRP -0.113; TCGA LIHC -0.056; TCGA LUAD -0.063; TCGA PRAD -0.134; TCGA SARC -0.151; TCGA STAD -0.055; TCGA UCEC -0.113
hsa-miR-146b-5p
FBXO30
14 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.059; TCGA CESC -0.142; TCGA ESCA -0.1; TCGA HNSC -0.106; TCGA KIRC -0.087; TCGA KIRP -0.087; TCGA LGG -0.132; TCGA LUAD -0.055; TCGA LUSC -0.116; TCGA PRAD -0.197; TCGA SARC -0.241; TCGA THCA -0.123; TCGA STAD -0.201; TCGA UCEC -0.092
hsa-miR-146b-5p
IMMP2L
10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.202; TCGA BRCA -0.146; TCGA COAD -0.291; TCGA KIRC -0.063; TCGA LGG -0.05; TCGA LIHC -0.077; TCGA PAAD -0.113; TCGA SARC -0.137; TCGA STAD -0.145; TCGA UCEC -0.079
hsa-miR-146b-5p
PRKCE
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; THCA; STAD
miRanda; miRNATAP
TCGA BLCA -0.118; TCGA BRCA -0.21; TCGA CESC -0.113; TCGA ESCA -0.103; TCGA HNSC -0.098; TCGA KIRC -0.151; TCGA KIRP -0.128; TCGA LGG -0.076; TCGA LIHC -0.092; TCGA PRAD -0.133; TCGA THCA -0.169; TCGA STAD -0.176
hsa-miR-146b-5p
DHX40
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.121; TCGA BRCA -0.201; TCGA CESC -0.158; TCGA COAD -0.134; TCGA ESCA -0.08; TCGA HNSC -0.129; TCGA LGG -0.077; TCGA LIHC -0.083; TCGA LUSC -0.17; TCGA PAAD -0.16; TCGA PRAD -0.074; TCGA STAD -0.052; TCGA UCEC -0.077
hsa-miR-146b-5p
TSPAN12
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.572; TCGA BRCA -0.1; TCGA CESC -0.42; TCGA COAD -0.193; TCGA ESCA -0.417; TCGA HNSC -0.322; TCGA KIRC -0.1; TCGA LGG -0.112; TCGA LUAD -0.222; TCGA PAAD -0.253; TCGA PRAD -0.147; TCGA SARC -0.205; TCGA THCA -0.104; TCGA STAD -0.118
hsa-miR-146b-5p
CASZ1
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.325; TCGA BRCA -0.178; TCGA ESCA -0.301; TCGA HNSC -0.201; TCGA KIRC -0.37; TCGA KIRP -0.256; TCGA LGG -0.113; TCGA LIHC -0.068; TCGA LUAD -0.117; TCGA LUSC -0.126; TCGA SARC -0.39; TCGA THCA -0.119; TCGA STAD -0.26; TCGA UCEC -0.173
hsa-miR-146b-5p
SYTL4
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.22; TCGA BRCA -0.376; TCGA CESC -0.325; TCGA ESCA -0.204; TCGA HNSC -0.186; TCGA KIRP -0.115; TCGA LGG -0.362; TCGA PRAD -0.139; TCGA THCA -0.083; TCGA STAD -0.118; TCGA UCEC -0.371
hsa-miR-146b-5p
PDK4
12 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.215; TCGA BRCA -0.186; TCGA ESCA -0.416; TCGA KIRC -0.183; TCGA KIRP -0.188; TCGA LGG -0.193; TCGA LIHC -0.148; TCGA LUAD -0.219; TCGA PRAD -0.569; TCGA SARC -0.487; TCGA STAD -0.833; TCGA UCEC -0.314
hsa-miR-146b-5p
ARMCX5
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; PAAD
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.134; TCGA CESC -0.141; TCGA COAD -0.214; TCGA HNSC -0.152; TCGA KIRC -0.071; TCGA KIRP -0.064; TCGA LIHC -0.055; TCGA PAAD -0.128
hsa-miR-146b-5p
KIAA0355
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.085; TCGA BRCA -0.092; TCGA CESC -0.109; TCGA COAD -0.203; TCGA HNSC -0.12; TCGA KIRC -0.098; TCGA KIRP -0.139; TCGA LIHC -0.095; TCGA LUAD -0.084; TCGA PRAD -0.071; TCGA SARC -0.114; TCGA STAD -0.07; TCGA UCEC -0.109
hsa-miR-146b-5p
PPIP5K1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.244; TCGA BRCA -0.2; TCGA CESC -0.082; TCGA ESCA -0.113; TCGA HNSC -0.162; TCGA KIRC -0.086; TCGA KIRP -0.079; TCGA PAAD -0.16; TCGA SARC -0.152; TCGA UCEC -0.119
hsa-miR-146b-5p
CHD2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.089; TCGA CESC -0.079; TCGA HNSC -0.075; TCGA KIRC -0.052; TCGA KIRP -0.059; TCGA LGG -0.129; TCGA PRAD -0.07; TCGA SARC -0.102; TCGA UCEC -0.104
hsa-miR-146b-5p
CAPS
9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.547; TCGA COAD -0.612; TCGA ESCA -0.214; TCGA KIRC -0.394; TCGA KIRP -0.232; TCGA LIHC -0.107; TCGA OV -0.253; TCGA STAD -0.382; TCGA UCEC -0.369
hsa-miR-146b-5p
BBS10
10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.084; TCGA BRCA -0.23; TCGA CESC -0.091; TCGA HNSC -0.104; TCGA LGG -0.161; TCGA LIHC -0.075; TCGA LUAD -0.067; TCGA PRAD -0.12; TCGA SARC -0.112; TCGA STAD -0.159
hsa-miR-146b-5p
SALL2
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.422; TCGA BRCA -0.315; TCGA CESC -0.223; TCGA HNSC -0.241; TCGA KIRC -0.205; TCGA KIRP -0.108; TCGA LGG -0.244; TCGA PAAD -0.19; TCGA PRAD -0.106; TCGA SARC -0.372; TCGA THCA -0.074; TCGA STAD -0.6
hsa-miR-146b-5p
DTWD1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.142; TCGA CESC -0.114; TCGA ESCA -0.082; TCGA HNSC -0.062; TCGA LUAD -0.052; TCGA SARC -0.115; TCGA THCA -0.057; TCGA STAD -0.109; TCGA UCEC -0.196
hsa-miR-146b-5p
SESTD1
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; OV; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.24; TCGA BRCA -0.267; TCGA CESC -0.231; TCGA KIRC -0.116; TCGA KIRP -0.112; TCGA LGG -0.084; TCGA LUAD -0.256; TCGA OV -0.309; TCGA PRAD -0.126; TCGA SARC -0.233; TCGA STAD -0.116; TCGA UCEC -0.158
hsa-miR-146b-5p
CADM2
9 cancers: BLCA; BRCA; COAD; LGG; LUAD; OV; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.26; TCGA BRCA -0.766; TCGA COAD -0.399; TCGA LGG -0.263; TCGA LUAD -0.224; TCGA OV -0.435; TCGA THCA -0.192; TCGA STAD -1.105; TCGA UCEC -0.202
hsa-miR-146b-5p
ATP9B
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.148; TCGA BRCA -0.131; TCGA ESCA -0.132; TCGA HNSC -0.146; TCGA KIRP -0.083; TCGA LUAD -0.065; TCGA PAAD -0.123; TCGA PRAD -0.104; TCGA SARC -0.098; TCGA STAD -0.085; TCGA UCEC -0.177
hsa-miR-146b-5p
TRIM13
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; OV; PRAD; UCEC
miRanda
TCGA BLCA -0.144; TCGA BRCA -0.125; TCGA COAD -0.094; TCGA HNSC -0.103; TCGA LGG -0.124; TCGA LUAD -0.07; TCGA OV -0.082; TCGA PRAD -0.121; TCGA UCEC -0.116
hsa-miR-146b-5p
COL4A5
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.293; TCGA BRCA -0.142; TCGA CESC -0.279; TCGA COAD -0.559; TCGA KIRC -0.336; TCGA KIRP -0.208; TCGA LUAD -0.236; TCGA LUSC -0.172; TCGA PRAD -0.117; TCGA SARC -0.639; TCGA THCA -0.159; TCGA STAD -0.829; TCGA UCEC -0.454
hsa-miR-146b-5p
THAP10
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.218; TCGA BRCA -0.175; TCGA CESC -0.149; TCGA KIRC -0.073; TCGA KIRP -0.096; TCGA LIHC -0.133; TCGA LUSC -0.109; TCGA PAAD -0.199; TCGA PRAD -0.078; TCGA SARC -0.1; TCGA STAD -0.161
hsa-miR-146b-5p
NBEAL1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.119; TCGA BRCA -0.324; TCGA CESC -0.209; TCGA HNSC -0.343; TCGA KIRC -0.234; TCGA KIRP -0.277; TCGA LGG -0.2; TCGA LIHC -0.168; TCGA PRAD -0.199; TCGA SARC -0.266; TCGA THCA -0.117
hsa-miR-146b-5p
PARD6G
10 cancers: BLCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.215; TCGA HNSC -0.142; TCGA KIRP -0.119; TCGA LUAD -0.144; TCGA LUSC -0.323; TCGA OV -0.091; TCGA PRAD -0.147; TCGA THCA -0.069; TCGA STAD -0.262; TCGA UCEC -0.104
hsa-miR-146b-5p
TMTC4
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV
miRanda
TCGA BLCA -0.193; TCGA BRCA -0.073; TCGA COAD -0.275; TCGA HNSC -0.146; TCGA KIRC -0.06; TCGA KIRP -0.062; TCGA LIHC -0.056; TCGA LUAD -0.192; TCGA LUSC -0.174; TCGA OV -0.108
hsa-miR-146b-5p
HS6ST2
9 cancers: BLCA; CESC; KIRC; KIRP; LGG; LIHC; LUSC; OV; STAD
miRanda
TCGA BLCA -0.399; TCGA CESC -0.362; TCGA KIRC -0.836; TCGA KIRP -0.385; TCGA LGG -0.085; TCGA LIHC -0.221; TCGA LUSC -0.325; TCGA OV -0.241; TCGA STAD -0.605
hsa-miR-146b-5p
ZNF626
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.42; TCGA BRCA -0.197; TCGA KIRC -0.087; TCGA KIRP -0.127; TCGA LGG -0.072; TCGA LIHC -0.237; TCGA PRAD -0.076; TCGA SARC -0.192; TCGA STAD -0.283
hsa-miR-146b-5p
CCDC126
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; THCA; UCEC
miRanda
TCGA BLCA -0.075; TCGA BRCA -0.248; TCGA HNSC -0.144; TCGA KIRC -0.083; TCGA KIRP -0.104; TCGA LUAD -0.086; TCGA PAAD -0.144; TCGA THCA -0.118; TCGA UCEC -0.107
hsa-miR-146b-5p
GNPDA2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; OV; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.114; TCGA BRCA -0.236; TCGA CESC -0.092; TCGA COAD -0.088; TCGA HNSC -0.079; TCGA KIRP -0.07; TCGA LGG -0.071; TCGA OV -0.084; TCGA PRAD -0.067; TCGA SARC -0.087; TCGA STAD -0.152; TCGA UCEC -0.138
hsa-miR-146b-5p
RNF11
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.114; TCGA BRCA -0.142; TCGA CESC -0.116; TCGA ESCA -0.104; TCGA HNSC -0.154; TCGA KIRC -0.085; TCGA KIRP -0.087; TCGA LUAD -0.055; TCGA PRAD -0.091; TCGA SARC -0.072; TCGA STAD -0.192; TCGA UCEC -0.107
hsa-miR-146b-5p
DOCK9
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.069; TCGA BRCA -0.185; TCGA ESCA -0.157; TCGA HNSC -0.25; TCGA KIRC -0.119; TCGA KIRP -0.223; TCGA LIHC -0.082; TCGA PRAD -0.163; TCGA SARC -0.108; TCGA UCEC -0.141
hsa-miR-146b-5p
MARCH6
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC
miRanda
TCGA BLCA -0.053; TCGA BRCA -0.16; TCGA HNSC -0.118; TCGA KIRC -0.073; TCGA KIRP -0.095; TCGA LGG -0.072; TCGA LUSC -0.108; TCGA PAAD -0.101; TCGA SARC -0.081
hsa-miR-146b-5p
MAOA
11 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.572; TCGA BRCA -0.491; TCGA ESCA -0.393; TCGA HNSC -0.3; TCGA LIHC -0.131; TCGA LUAD -0.187; TCGA PAAD -0.151; TCGA PRAD -0.082; TCGA SARC -0.58; TCGA STAD -0.442; TCGA UCEC -0.245
hsa-miR-146b-5p
ST7L
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.09; TCGA BRCA -0.118; TCGA CESC -0.167; TCGA ESCA -0.125; TCGA HNSC -0.124; TCGA LIHC -0.066; TCGA LUSC -0.111; TCGA PAAD -0.07; TCGA SARC -0.055; TCGA STAD -0.056; TCGA UCEC -0.064
hsa-miR-146b-5p
LEMD3
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; UCEC
miRanda
TCGA BLCA -0.092; TCGA BRCA -0.124; TCGA COAD -0.091; TCGA HNSC -0.074; TCGA KIRC -0.054; TCGA KIRP -0.073; TCGA LGG -0.065; TCGA LUAD -0.107; TCGA LUSC -0.075; TCGA UCEC -0.097
hsa-miR-146b-5p
RDH11
9 cancers: BLCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA
miRanda
TCGA BLCA -0.076; TCGA CESC -0.171; TCGA KIRC -0.227; TCGA KIRP -0.099; TCGA LGG -0.056; TCGA LUAD -0.083; TCGA LUSC -0.078; TCGA PAAD -0.163; TCGA THCA -0.073
hsa-miR-146b-5p
NAALADL2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; SARC; UCEC
miRanda
TCGA BLCA -0.621; TCGA BRCA -0.207; TCGA CESC -0.369; TCGA COAD -0.624; TCGA ESCA -0.396; TCGA HNSC -0.47; TCGA KIRC -0.315; TCGA KIRP -0.226; TCGA LIHC -0.188; TCGA LUSC -0.24; TCGA OV -0.184; TCGA SARC -0.138; TCGA UCEC -0.193
hsa-miR-146b-5p
CCDC85A
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.257; TCGA BRCA -0.419; TCGA ESCA -0.375; TCGA HNSC -0.286; TCGA KIRC -0.148; TCGA KIRP -0.232; TCGA LIHC -0.133; TCGA PRAD -0.28; TCGA SARC -0.277; TCGA THCA -0.158; TCGA STAD -0.329; TCGA UCEC -0.503
hsa-miR-146b-5p
REPS2
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.161; TCGA BRCA -0.383; TCGA COAD -0.319; TCGA ESCA -0.415; TCGA LGG -0.258; TCGA LIHC -0.147; TCGA LUAD -0.099; TCGA SARC -0.159; TCGA THCA -0.08; TCGA STAD -0.218; TCGA UCEC -0.282
hsa-miR-146b-5p
THSD7B
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.254; TCGA BRCA -0.235; TCGA CESC -0.395; TCGA HNSC -0.612; TCGA KIRC -0.365; TCGA KIRP -0.317; TCGA LIHC -0.184; TCGA LUSC -0.361; TCGA OV -0.294; TCGA PRAD -0.195; TCGA SARC -0.243; TCGA THCA -0.103; TCGA STAD -0.469
hsa-miR-146b-5p
SLC39A9
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; UCEC
miRanda
TCGA BLCA -0.058; TCGA BRCA -0.203; TCGA CESC -0.057; TCGA ESCA -0.095; TCGA HNSC -0.093; TCGA KIRC -0.145; TCGA KIRP -0.096; TCGA LGG -0.101; TCGA LUAD -0.113; TCGA LUSC -0.135; TCGA PAAD -0.166; TCGA THCA -0.063; TCGA UCEC -0.084
hsa-miR-146b-5p
MAPK4
12 cancers: BLCA; COAD; KIRC; KIRP; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.644; TCGA COAD -0.591; TCGA KIRC -0.865; TCGA KIRP -0.586; TCGA LUAD -0.412; TCGA OV -0.397; TCGA PAAD -0.41; TCGA PRAD -0.293; TCGA SARC -1.13; TCGA THCA -0.686; TCGA STAD -1.421; TCGA UCEC -0.223
hsa-miR-146b-5p
ST13
11 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.072; TCGA BRCA -0.107; TCGA CESC -0.065; TCGA COAD -0.071; TCGA LGG -0.148; TCGA LUAD -0.063; TCGA LUSC -0.113; TCGA OV -0.15; TCGA PAAD -0.118; TCGA STAD -0.052; TCGA UCEC -0.083
hsa-miR-146b-5p
DACH1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD
miRanda
TCGA BLCA -0.409; TCGA BRCA -0.805; TCGA COAD -0.848; TCGA HNSC -0.287; TCGA KIRC -0.454; TCGA KIRP -0.387; TCGA LGG -0.237; TCGA LUAD -0.283; TCGA PAAD -0.303; TCGA PRAD -0.1
hsa-miR-146b-5p
SENP6
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; OV; SARC; UCEC
miRanda
TCGA BLCA -0.082; TCGA BRCA -0.071; TCGA CESC -0.095; TCGA COAD -0.053; TCGA HNSC -0.051; TCGA KIRC -0.068; TCGA KIRP -0.101; TCGA LGG -0.092; TCGA OV -0.061; TCGA SARC -0.059; TCGA UCEC -0.062
hsa-miR-146b-5p
MTUS2
10 cancers: BLCA; ESCA; KIRP; LUAD; OV; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.782; TCGA ESCA -0.334; TCGA KIRP -0.282; TCGA LUAD -0.174; TCGA OV -0.285; TCGA PAAD -0.489; TCGA SARC -0.51; TCGA THCA -0.124; TCGA STAD -0.881; TCGA UCEC -0.402
hsa-miR-146b-5p
GOLPH3L
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.117; TCGA BRCA -0.185; TCGA CESC -0.083; TCGA COAD -0.086; TCGA ESCA -0.119; TCGA HNSC -0.177; TCGA LIHC -0.121; TCGA LUAD -0.093; TCGA LUSC -0.08; TCGA PAAD -0.149
hsa-miR-146b-5p
MBTD1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; SARC
miRanda
TCGA BLCA -0.242; TCGA BRCA -0.128; TCGA CESC -0.092; TCGA COAD -0.183; TCGA HNSC -0.139; TCGA LGG -0.229; TCGA LIHC -0.054; TCGA LUAD -0.061; TCGA LUSC -0.122; TCGA SARC -0.05
hsa-miR-146b-5p
BMP3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; OV; STAD
miRanda; mirMAP
TCGA BLCA -1.03; TCGA CESC -0.615; TCGA COAD -0.546; TCGA ESCA -0.64; TCGA HNSC -0.451; TCGA KIRC -0.205; TCGA KIRP -0.163; TCGA OV -0.475; TCGA STAD -1.174
hsa-miR-146b-5p
WWOX
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.132; TCGA BRCA -0.086; TCGA COAD -0.17; TCGA ESCA -0.138; TCGA HNSC -0.109; TCGA KIRC -0.096; TCGA LGG -0.085; TCGA LUAD -0.094; TCGA PAAD -0.104; TCGA PRAD -0.094; TCGA SARC -0.074; TCGA THCA -0.177; TCGA STAD -0.083; TCGA UCEC -0.083
hsa-miR-146b-5p
ZNF441
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.223; TCGA BRCA -0.298; TCGA COAD -0.194; TCGA KIRC -0.147; TCGA KIRP -0.14; TCGA LGG -0.095; TCGA LIHC -0.073; TCGA PAAD -0.17; TCGA PRAD -0.098; TCGA SARC -0.228; TCGA STAD -0.102; TCGA UCEC -0.102
hsa-miR-146b-5p
PDE7B
11 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.406; TCGA KIRC -0.309; TCGA KIRP -0.244; TCGA LIHC -0.233; TCGA LUAD -0.257; TCGA OV -0.103; TCGA PRAD -0.313; TCGA SARC -0.157; TCGA THCA -0.139; TCGA STAD -0.452; TCGA UCEC -0.236
hsa-miR-146b-5p
ZNF280D
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.201; TCGA BRCA -0.202; TCGA CESC -0.129; TCGA ESCA -0.069; TCGA HNSC -0.096; TCGA KIRP -0.085; TCGA LGG -0.071; TCGA LUAD -0.083; TCGA SARC -0.132; TCGA STAD -0.136; TCGA UCEC -0.193
hsa-miR-146b-5p
ZNF471
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.334; TCGA BRCA -0.118; TCGA COAD -0.291; TCGA HNSC -0.294; TCGA KIRC -0.32; TCGA KIRP -0.242; TCGA LGG -0.063; TCGA LIHC -0.207; TCGA SARC -0.421; TCGA STAD -0.478; TCGA UCEC -0.235
hsa-miR-146b-5p
DOPEY1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.201; TCGA BRCA -0.084; TCGA CESC -0.113; TCGA COAD -0.134; TCGA ESCA -0.134; TCGA HNSC -0.097; TCGA KIRP -0.052; TCGA LGG -0.155; TCGA PRAD -0.091; TCGA SARC -0.114; TCGA UCEC -0.11
hsa-miR-146b-5p
DOCK1
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.139; TCGA BRCA -0.205; TCGA ESCA -0.094; TCGA HNSC -0.088; TCGA KIRC -0.141; TCGA KIRP -0.157; TCGA LIHC -0.105; TCGA PRAD -0.164; TCGA THCA -0.054; TCGA STAD -0.065; TCGA UCEC -0.156
hsa-miR-146b-5p
EHD3
9 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD
miRanda
TCGA BLCA -0.241; TCGA HNSC -0.257; TCGA KIRC -0.081; TCGA KIRP -0.151; TCGA LIHC -0.111; TCGA LUAD -0.12; TCGA LUSC -0.12; TCGA PRAD -0.077; TCGA STAD -0.16
hsa-miR-146b-5p
FRY
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.598; TCGA BRCA -0.491; TCGA CESC -0.309; TCGA COAD -0.234; TCGA ESCA -0.37; TCGA HNSC -0.301; TCGA KIRC -0.309; TCGA KIRP -0.337; TCGA LGG -0.289; TCGA LUAD -0.09; TCGA PRAD -0.157; TCGA SARC -0.529; TCGA THCA -0.122; TCGA STAD -0.335; TCGA UCEC -0.284
hsa-miR-146b-5p
GCNT4
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.391; TCGA BRCA -0.335; TCGA ESCA -0.542; TCGA HNSC -0.221; TCGA KIRC -0.443; TCGA KIRP -0.483; TCGA LIHC -0.126; TCGA PRAD -0.367; TCGA SARC -0.467; TCGA STAD -0.52
hsa-miR-146b-5p
AQR
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.094; TCGA BRCA -0.135; TCGA HNSC -0.142; TCGA KIRC -0.081; TCGA KIRP -0.088; TCGA LGG -0.113; TCGA LUAD -0.088; TCGA LUSC -0.079; TCGA PRAD -0.113; TCGA SARC -0.085; TCGA UCEC -0.053
hsa-miR-146b-5p
TP53INP2
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.192; TCGA BRCA -0.114; TCGA CESC -0.249; TCGA ESCA -0.452; TCGA HNSC -0.37; TCGA KIRC -0.111; TCGA KIRP -0.13; TCGA LIHC -0.118; TCGA LUAD -0.196; TCGA PRAD -0.159; TCGA SARC -0.334; TCGA THCA -0.196; TCGA STAD -0.424; TCGA UCEC -0.127
hsa-miR-146b-5p
IGSF9B
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.335; TCGA BRCA -0.575; TCGA ESCA -0.545; TCGA HNSC -0.306; TCGA KIRP -0.188; TCGA LGG -0.3; TCGA PRAD -0.28; TCGA SARC -0.839; TCGA THCA -0.199; TCGA STAD -0.27; TCGA UCEC -0.363
hsa-miR-146b-5p
ZSCAN29
9 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUAD; LUSC; SARC; UCEC
miRanda
TCGA BLCA -0.137; TCGA BRCA -0.139; TCGA HNSC -0.088; TCGA KIRP -0.072; TCGA LGG -0.153; TCGA LUAD -0.107; TCGA LUSC -0.107; TCGA SARC -0.105; TCGA UCEC -0.061
hsa-miR-146b-5p
COQ9
9 cancers: BLCA; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.135; TCGA ESCA -0.111; TCGA HNSC -0.054; TCGA KIRC -0.107; TCGA LIHC -0.1; TCGA PAAD -0.082; TCGA PRAD -0.067; TCGA THCA -0.108; TCGA STAD -0.115
hsa-miR-146b-5p
ZSCAN23
9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.314; TCGA HNSC -0.184; TCGA KIRC -0.242; TCGA KIRP -0.308; TCGA LGG -0.311; TCGA PRAD -0.167; TCGA SARC -0.359; TCGA THCA -0.092; TCGA STAD -0.383
hsa-miR-146b-5p
FAM47E
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.406; TCGA BRCA -0.632; TCGA COAD -0.198; TCGA ESCA -0.451; TCGA HNSC -0.242; TCGA KIRC -0.317; TCGA KIRP -0.069; TCGA PAAD -0.483; TCGA SARC -0.262; TCGA STAD -0.228; TCGA UCEC -0.235
hsa-miR-146b-5p
TMEM47
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.408; TCGA BRCA -0.188; TCGA CESC -0.457; TCGA HNSC -0.151; TCGA KIRC -0.081; TCGA KIRP -0.269; TCGA LGG -0.116; TCGA LIHC -0.136; TCGA LUAD -0.211; TCGA OV -0.22; TCGA PRAD -0.211; TCGA SARC -0.505; TCGA THCA -0.172; TCGA STAD -0.401; TCGA UCEC -0.279
hsa-miR-146b-5p
TMEM80
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.075; TCGA BRCA -0.09; TCGA ESCA -0.189; TCGA KIRC -0.191; TCGA KIRP -0.066; TCGA LGG -0.078; TCGA PAAD -0.16; TCGA SARC -0.057; TCGA THCA -0.082; TCGA STAD -0.132; TCGA UCEC -0.091
hsa-miR-146b-5p
TTC21B
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.14; TCGA BRCA -0.153; TCGA CESC -0.154; TCGA HNSC -0.108; TCGA KIRC -0.051; TCGA KIRP -0.099; TCGA LGG -0.079; TCGA LIHC -0.061; TCGA LUAD -0.064; TCGA LUSC -0.091; TCGA OV -0.088; TCGA PAAD -0.069; TCGA SARC -0.088; TCGA UCEC -0.124
hsa-miR-146b-5p
LIG3
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; PAAD; SARC
miRanda
TCGA BLCA -0.055; TCGA BRCA -0.057; TCGA COAD -0.128; TCGA HNSC -0.08; TCGA LGG -0.074; TCGA LUAD -0.059; TCGA LUSC -0.204; TCGA PAAD -0.178; TCGA SARC -0.098
hsa-miR-146b-5p
NFAT5
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.154; TCGA BRCA -0.084; TCGA COAD -0.2; TCGA HNSC -0.065; TCGA KIRC -0.118; TCGA KIRP -0.111; TCGA PRAD -0.128; TCGA SARC -0.08; TCGA UCEC -0.133
hsa-miR-146b-5p
PRDM2
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.182; TCGA BRCA -0.102; TCGA COAD -0.097; TCGA HNSC -0.118; TCGA KIRC -0.082; TCGA KIRP -0.094; TCGA LIHC -0.1; TCGA PRAD -0.101; TCGA STAD -0.087; TCGA UCEC -0.078
hsa-miR-146b-5p
PIP5K1B
10 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; UCEC
miRanda; miRNATAP
TCGA BLCA -0.178; TCGA CESC -0.322; TCGA COAD -0.147; TCGA KIRC -0.529; TCGA KIRP -0.332; TCGA LUAD -0.363; TCGA PAAD -0.555; TCGA PRAD -0.436; TCGA SARC -0.263; TCGA UCEC -0.406
hsa-miR-146b-5p
SH3RF1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; SARC; THCA
miRanda
TCGA BLCA -0.104; TCGA BRCA -0.226; TCGA CESC -0.203; TCGA HNSC -0.139; TCGA KIRC -0.15; TCGA KIRP -0.161; TCGA LIHC -0.169; TCGA SARC -0.133; TCGA THCA -0.148
hsa-miR-146b-5p
MAP6
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.278; TCGA BRCA -0.22; TCGA COAD -0.271; TCGA ESCA -0.336; TCGA KIRC -0.3; TCGA KIRP -0.228; TCGA OV -0.276; TCGA PAAD -0.253; TCGA PRAD -0.163; TCGA SARC -0.16; TCGA THCA -0.131; TCGA STAD -0.668; TCGA UCEC -0.338
hsa-miR-146b-5p
SCUBE2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.669; TCGA BRCA -0.863; TCGA COAD -0.454; TCGA ESCA -0.408; TCGA HNSC -0.243; TCGA KIRC -0.196; TCGA KIRP -0.309; TCGA LUAD -0.202; TCGA OV -0.179; TCGA SARC -0.457; TCGA THCA -0.188; TCGA STAD -0.667; TCGA UCEC -0.202
hsa-miR-146b-5p
ZNF829
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.162; TCGA BRCA -0.206; TCGA HNSC -0.235; TCGA KIRC -0.168; TCGA KIRP -0.268; TCGA PRAD -0.135; TCGA SARC -0.278; TCGA THCA -0.055; TCGA STAD -0.264
hsa-miR-146b-5p
ERLIN2
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.102; TCGA BRCA -0.239; TCGA CESC -0.094; TCGA HNSC -0.144; TCGA KIRC -0.123; TCGA KIRP -0.069; TCGA LGG -0.063; TCGA LIHC -0.109; TCGA LUAD -0.179; TCGA LUSC -0.162; TCGA OV -0.085; TCGA PRAD -0.1; TCGA SARC -0.051; TCGA THCA -0.054; TCGA UCEC -0.103
hsa-miR-146b-5p
SLAIN2
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.059; TCGA BRCA -0.143; TCGA ESCA -0.112; TCGA HNSC -0.128; TCGA KIRP -0.084; TCGA LUAD -0.059; TCGA PRAD -0.072; TCGA SARC -0.091; TCGA STAD -0.136; TCGA UCEC -0.12
hsa-miR-146b-5p
TSHZ1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.204; TCGA BRCA -0.236; TCGA CESC -0.117; TCGA COAD -0.154; TCGA ESCA -0.168; TCGA HNSC -0.19; TCGA KIRC -0.104; TCGA KIRP -0.071; TCGA LGG -0.205; TCGA LIHC -0.064; TCGA PAAD -0.126; TCGA PRAD -0.116; TCGA SARC -0.158; TCGA THCA -0.061; TCGA STAD -0.273; TCGA UCEC -0.178
hsa-miR-146b-5p
STAM2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.1; TCGA BRCA -0.194; TCGA CESC -0.112; TCGA ESCA -0.096; TCGA HNSC -0.11; TCGA KIRC -0.094; TCGA KIRP -0.099; TCGA LUAD -0.059; TCGA PRAD -0.103; TCGA SARC -0.08; TCGA UCEC -0.131
hsa-miR-146b-5p
ATRNL1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.425; TCGA BRCA -0.5; TCGA CESC -0.352; TCGA COAD -0.812; TCGA ESCA -0.376; TCGA HNSC -0.496; TCGA KIRC -0.299; TCGA KIRP -0.185; TCGA LGG -0.115; TCGA LUAD -0.352; TCGA LUSC -0.4; TCGA OV -0.389; TCGA PAAD -0.428; TCGA PRAD -0.235; TCGA SARC -0.213; TCGA THCA -0.257; TCGA STAD -0.719
hsa-miR-146b-5p
TSPYL1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.197; TCGA CESC -0.092; TCGA ESCA -0.218; TCGA HNSC -0.112; TCGA KIRC -0.228; TCGA KIRP -0.113; TCGA LUAD -0.071; TCGA LUSC -0.077; TCGA PAAD -0.135; TCGA PRAD -0.127; TCGA SARC -0.088; TCGA STAD -0.135
hsa-miR-146b-5p
WRN
9 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC
miRanda
TCGA BLCA -0.091; TCGA BRCA -0.06; TCGA HNSC -0.073; TCGA KIRP -0.104; TCGA LGG -0.127; TCGA LUAD -0.089; TCGA LUSC -0.098; TCGA PRAD -0.082; TCGA UCEC -0.109
hsa-miR-146b-5p
PEX19
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; SARC
miRanda
TCGA BLCA -0.104; TCGA BRCA -0.279; TCGA COAD -0.061; TCGA ESCA -0.121; TCGA HNSC -0.095; TCGA KIRC -0.082; TCGA KIRP -0.076; TCGA LUSC -0.093; TCGA OV -0.053; TCGA PAAD -0.125; TCGA PRAD -0.096; TCGA SARC -0.075
hsa-miR-146b-5p
ARL1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.171; TCGA CESC -0.092; TCGA ESCA -0.093; TCGA HNSC -0.095; TCGA LUAD -0.077; TCGA PAAD -0.189; TCGA PRAD -0.08; TCGA UCEC -0.09
hsa-miR-146b-5p
WWP1
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; THCA; UCEC
miRanda
TCGA BLCA -0.062; TCGA BRCA -0.349; TCGA COAD -0.179; TCGA HNSC -0.108; TCGA KIRC -0.108; TCGA KIRP -0.075; TCGA LUAD -0.055; TCGA THCA -0.069; TCGA UCEC -0.128
hsa-miR-146b-5p
ZNF254
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.274; TCGA BRCA -0.11; TCGA COAD -0.226; TCGA HNSC -0.166; TCGA KIRC -0.086; TCGA KIRP -0.09; TCGA LGG -0.15; TCGA LIHC -0.115; TCGA SARC -0.136; TCGA STAD -0.124; TCGA UCEC -0.066
hsa-miR-146b-5p
FAM179B
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.143; TCGA BRCA -0.27; TCGA CESC -0.094; TCGA COAD -0.284; TCGA HNSC -0.154; TCGA KIRC -0.12; TCGA KIRP -0.121; TCGA LIHC -0.098; TCGA LUAD -0.057; TCGA PAAD -0.128; TCGA PRAD -0.101; TCGA SARC -0.069; TCGA THCA -0.069; TCGA STAD -0.124; TCGA UCEC -0.097
hsa-miR-146b-5p
NF1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.128; TCGA BRCA -0.199; TCGA CESC -0.148; TCGA COAD -0.133; TCGA HNSC -0.102; TCGA KIRP -0.1; TCGA LGG -0.206; TCGA LIHC -0.074; TCGA LUSC -0.16; TCGA PRAD -0.125; TCGA SARC -0.192; TCGA UCEC -0.076
hsa-miR-146b-5p
WDFY3
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.223; TCGA BRCA -0.249; TCGA CESC -0.119; TCGA ESCA -0.158; TCGA HNSC -0.186; TCGA KIRC -0.114; TCGA KIRP -0.074; TCGA LGG -0.177; TCGA LIHC -0.112; TCGA LUSC -0.073; TCGA PAAD -0.087; TCGA PRAD -0.101; TCGA SARC -0.068; TCGA STAD -0.129; TCGA UCEC -0.138
hsa-miR-146b-5p
RHOB
10 cancers: BLCA; BRCA; ESCA; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.121; TCGA BRCA -0.276; TCGA ESCA -0.237; TCGA LUAD -0.245; TCGA OV -0.136; TCGA PRAD -0.207; TCGA SARC -0.258; TCGA THCA -0.08; TCGA STAD -0.446; TCGA UCEC -0.238
hsa-miR-146b-5p
ZNF689
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BLCA -0.078; TCGA BRCA -0.202; TCGA ESCA -0.133; TCGA HNSC -0.106; TCGA KIRC -0.057; TCGA KIRP -0.096; TCGA LGG -0.107; TCGA LIHC -0.122; TCGA LUAD -0.057; TCGA LUSC -0.144; TCGA PRAD -0.176; TCGA SARC -0.13
hsa-miR-146b-5p
ZNF292
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUSC; OV; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.222; TCGA BRCA -0.074; TCGA CESC -0.179; TCGA HNSC -0.184; TCGA KIRP -0.128; TCGA LGG -0.21; TCGA LUSC -0.088; TCGA OV -0.064; TCGA PRAD -0.12; TCGA SARC -0.153; TCGA UCEC -0.097
hsa-miR-146b-5p
ETV3
15 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.16; TCGA BRCA -0.153; TCGA ESCA -0.139; TCGA HNSC -0.321; TCGA KIRC -0.133; TCGA KIRP -0.242; TCGA LGG -0.131; TCGA LIHC -0.145; TCGA LUAD -0.133; TCGA LUSC -0.23; TCGA PRAD -0.262; TCGA SARC -0.199; TCGA THCA -0.061; TCGA STAD -0.118; TCGA UCEC -0.157
hsa-miR-146b-5p
MGA
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.062; TCGA CESC -0.121; TCGA HNSC -0.097; TCGA KIRP -0.061; TCGA LGG -0.055; TCGA LUAD -0.1; TCGA LUSC -0.094; TCGA PRAD -0.09; TCGA SARC -0.143
hsa-miR-146b-5p
PPM1A
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.234; TCGA CESC -0.129; TCGA ESCA -0.109; TCGA HNSC -0.109; TCGA KIRC -0.171; TCGA KIRP -0.077; TCGA LGG -0.054; TCGA LIHC -0.076; TCGA LUAD -0.071; TCGA LUSC -0.086; TCGA PAAD -0.141; TCGA SARC -0.088; TCGA STAD -0.172; TCGA UCEC -0.1
hsa-miR-146b-5p
MBD5
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.183; TCGA BRCA -0.181; TCGA COAD -0.174; TCGA ESCA -0.112; TCGA HNSC -0.069; TCGA KIRP -0.101; TCGA LGG -0.139; TCGA LIHC -0.109; TCGA LUAD -0.071; TCGA PRAD -0.131; TCGA SARC -0.149; TCGA STAD -0.191
hsa-miR-146b-5p
LEPR
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; OV; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.114; TCGA BRCA -0.125; TCGA ESCA -0.276; TCGA HNSC -0.201; TCGA LUAD -0.228; TCGA OV -0.138; TCGA PRAD -0.135; TCGA STAD -0.309; TCGA UCEC -0.268
hsa-miR-146b-5p
HS6ST1
9 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; THCA
miRanda
TCGA BLCA -0.088; TCGA HNSC -0.064; TCGA KIRC -0.33; TCGA KIRP -0.181; TCGA LUAD -0.263; TCGA LUSC -0.225; TCGA OV -0.101; TCGA PRAD -0.071; TCGA THCA -0.062
hsa-miR-146b-5p
TTC17
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; PAAD; PRAD
miRanda
TCGA BLCA -0.077; TCGA BRCA -0.142; TCGA CESC -0.098; TCGA COAD -0.155; TCGA HNSC -0.099; TCGA KIRP -0.075; TCGA LGG -0.136; TCGA LUAD -0.09; TCGA PAAD -0.107; TCGA PRAD -0.079
hsa-miR-146b-5p
MAGI3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.224; TCGA CESC -0.24; TCGA COAD -0.107; TCGA ESCA -0.173; TCGA HNSC -0.246; TCGA KIRC -0.36; TCGA KIRP -0.242; TCGA LGG -0.059; TCGA LIHC -0.078; TCGA SARC -0.176; TCGA THCA -0.099; TCGA STAD -0.145; TCGA UCEC -0.111
hsa-miR-146b-5p
RALGPS1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.391; TCGA BRCA -0.236; TCGA CESC -0.144; TCGA ESCA -0.328; TCGA HNSC -0.207; TCGA KIRC -0.415; TCGA KIRP -0.199; TCGA LGG -0.118; TCGA LIHC -0.113; TCGA PAAD -0.407; TCGA SARC -0.234; TCGA THCA -0.103; TCGA UCEC -0.091
hsa-miR-146b-5p
RGMB
11 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.087; TCGA BRCA -0.177; TCGA CESC -0.112; TCGA ESCA -0.32; TCGA KIRP -0.088; TCGA LGG -0.305; TCGA PAAD -0.098; TCGA PRAD -0.073; TCGA SARC -0.081; TCGA STAD -0.421; TCGA UCEC -0.164
hsa-miR-146b-5p
SH3BGR
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.232; TCGA BRCA -0.121; TCGA COAD -0.179; TCGA ESCA -0.297; TCGA KIRC -0.145; TCGA KIRP -0.084; TCGA PAAD -0.146; TCGA PRAD -0.204; TCGA SARC -0.484; TCGA THCA -0.171; TCGA STAD -0.598; TCGA UCEC -0.198
hsa-miR-146b-5p
KCTD18
9 cancers: BLCA; BRCA; HNSC; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.097; TCGA BRCA -0.126; TCGA HNSC -0.153; TCGA LGG -0.07; TCGA LUSC -0.079; TCGA PRAD -0.064; TCGA SARC -0.123; TCGA STAD -0.085; TCGA UCEC -0.069
hsa-miR-146b-5p
WDR48
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.128; TCGA BRCA -0.134; TCGA COAD -0.058; TCGA KIRC -0.15; TCGA KIRP -0.051; TCGA LGG -0.1; TCGA PAAD -0.068; TCGA PRAD -0.101; TCGA SARC -0.111; TCGA STAD -0.057
hsa-miR-146b-5p
KIAA1109
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.183; TCGA BRCA -0.275; TCGA COAD -0.14; TCGA ESCA -0.119; TCGA HNSC -0.121; TCGA KIRC -0.166; TCGA KIRP -0.172; TCGA LGG -0.059; TCGA PRAD -0.124; TCGA SARC -0.158; TCGA THCA -0.064; TCGA STAD -0.077; TCGA UCEC -0.158
hsa-miR-146b-5p
CBX6
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; OV; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.118; TCGA BRCA -0.103; TCGA HNSC -0.185; TCGA KIRC -0.153; TCGA KIRP -0.09; TCGA LUSC -0.121; TCGA OV -0.132; TCGA PRAD -0.228; TCGA SARC -0.234; TCGA STAD -0.35
hsa-miR-146b-5p
BRAF
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; STAD
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.11; TCGA CESC -0.101; TCGA COAD -0.119; TCGA HNSC -0.199; TCGA KIRC -0.099; TCGA KIRP -0.135; TCGA LGG -0.064; TCGA LUSC -0.181; TCGA STAD -0.072
hsa-miR-146b-5p
FBXL5
11 cancers: BLCA; BRCA; ESCA; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.094; TCGA BRCA -0.294; TCGA ESCA -0.172; TCGA LIHC -0.072; TCGA OV -0.066; TCGA PAAD -0.093; TCGA PRAD -0.112; TCGA SARC -0.13; TCGA THCA -0.096; TCGA STAD -0.163; TCGA UCEC -0.145
hsa-miR-146b-5p
TSC22D1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; OV; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.076; TCGA BRCA -0.095; TCGA COAD -0.147; TCGA ESCA -0.172; TCGA KIRC -0.093; TCGA LGG -0.149; TCGA LUAD -0.169; TCGA OV -0.109; TCGA PAAD -0.109; TCGA SARC -0.104; TCGA STAD -0.246; TCGA UCEC -0.082
hsa-miR-146b-5p
CUL3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD
miRanda
TCGA BLCA -0.069; TCGA BRCA -0.143; TCGA CESC -0.068; TCGA COAD -0.071; TCGA ESCA -0.091; TCGA HNSC -0.14; TCGA KIRC -0.108; TCGA KIRP -0.074; TCGA LIHC -0.051; TCGA LUAD -0.088; TCGA PAAD -0.069
hsa-miR-146b-5p
MTMR4
9 cancers: BLCA; BRCA; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; THCA
miRanda
TCGA BLCA -0.138; TCGA BRCA -0.099; TCGA HNSC -0.084; TCGA KIRP -0.06; TCGA LUAD -0.056; TCGA LUSC -0.122; TCGA PAAD -0.101; TCGA SARC -0.056; TCGA THCA -0.143
hsa-miR-146b-5p
MXI1
11 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.139; TCGA BRCA -0.116; TCGA ESCA -0.172; TCGA HNSC -0.192; TCGA LGG -0.214; TCGA LUAD -0.054; TCGA LUSC -0.12; TCGA PRAD -0.117; TCGA SARC -0.187; TCGA STAD -0.289; TCGA UCEC -0.118
hsa-miR-146b-5p
CACNB4
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.269; TCGA BRCA -0.101; TCGA CESC -0.226; TCGA HNSC -0.369; TCGA KIRC -0.209; TCGA KIRP -0.271; TCGA PRAD -0.137; TCGA SARC -0.284; TCGA THCA -0.387; TCGA STAD -0.26; TCGA UCEC -0.192
hsa-miR-146b-5p
MYO5C
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; SARC; UCEC
miRanda
TCGA BLCA -0.256; TCGA BRCA -0.328; TCGA CESC -0.286; TCGA ESCA -0.352; TCGA HNSC -0.481; TCGA KIRC -0.328; TCGA KIRP -0.15; TCGA LIHC -0.118; TCGA SARC -0.194; TCGA UCEC -0.18
hsa-miR-146b-5p
MYH11
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.219; TCGA BRCA -0.201; TCGA CESC -0.41; TCGA COAD -0.74; TCGA ESCA -0.624; TCGA HNSC -0.482; TCGA KIRC -0.14; TCGA KIRP -0.208; TCGA LIHC -0.206; TCGA LUAD -0.193; TCGA PRAD -0.477; TCGA SARC -1.349; TCGA THCA -0.132; TCGA STAD -1.177; TCGA UCEC -0.675
hsa-miR-146b-5p
GALNT11
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.144; TCGA BRCA -0.096; TCGA ESCA -0.127; TCGA HNSC -0.108; TCGA LIHC -0.087; TCGA PAAD -0.074; TCGA SARC -0.058; TCGA STAD -0.143; TCGA UCEC -0.133
hsa-miR-146b-5p
SNX1
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA BRCA -0.193; TCGA CESC -0.054; TCGA ESCA -0.126; TCGA KIRC -0.067; TCGA LGG -0.061; TCGA PRAD -0.069; TCGA SARC -0.054; TCGA STAD -0.156; TCGA UCEC -0.084
hsa-miR-146b-5p
NEDD4L
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; STAD
mirMAP
TCGA BLCA -0.229; TCGA BRCA -0.297; TCGA CESC -0.108; TCGA ESCA -0.295; TCGA HNSC -0.102; TCGA KIRC -0.35; TCGA KIRP -0.171; TCGA LUAD -0.229; TCGA PAAD -0.156; TCGA STAD -0.096
hsa-miR-146b-5p
ANKS1A
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.136; TCGA COAD -0.121; TCGA ESCA -0.175; TCGA HNSC -0.081; TCGA KIRC -0.207; TCGA KIRP -0.136; TCGA LIHC -0.086; TCGA LUAD -0.066; TCGA PRAD -0.118; TCGA SARC -0.135; TCGA THCA -0.078; TCGA STAD -0.176
hsa-miR-146b-5p
PLXNA2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.128; TCGA COAD -0.289; TCGA ESCA -0.341; TCGA HNSC -0.185; TCGA KIRP -0.137; TCGA PAAD -0.186; TCGA PRAD -0.191; TCGA SARC -0.181; TCGA STAD -0.179; TCGA UCEC -0.198
hsa-miR-146b-5p
ZNF264
9 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.158; TCGA HNSC -0.092; TCGA KIRP -0.066; TCGA LIHC -0.098; TCGA LUSC -0.076; TCGA PRAD -0.063; TCGA SARC -0.064; TCGA UCEC -0.131
hsa-miR-146b-5p
ABLIM1
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.25; TCGA CESC -0.186; TCGA ESCA -0.421; TCGA HNSC -0.365; TCGA KIRC -0.156; TCGA KIRP -0.082; TCGA LGG -0.163; TCGA LUAD -0.209; TCGA OV -0.111; TCGA PAAD -0.176; TCGA PRAD -0.092; TCGA SARC -0.148; TCGA STAD -0.114
hsa-miR-146b-5p
CBX7
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.261; TCGA BRCA -0.213; TCGA ESCA -0.308; TCGA HNSC -0.123; TCGA KIRC -0.197; TCGA KIRP -0.156; TCGA PAAD -0.196; TCGA PRAD -0.201; TCGA SARC -0.382; TCGA STAD -0.461; TCGA UCEC -0.303
hsa-miR-146b-5p
MTMR3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.17; TCGA BRCA -0.153; TCGA CESC -0.091; TCGA COAD -0.072; TCGA ESCA -0.126; TCGA HNSC -0.176; TCGA KIRC -0.093; TCGA KIRP -0.078; TCGA LGG -0.125; TCGA LUSC -0.056; TCGA PAAD -0.09; TCGA SARC -0.103; TCGA STAD -0.094; TCGA UCEC -0.101
hsa-miR-146b-5p
PAIP2B
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.156; TCGA BRCA -0.188; TCGA COAD -0.205; TCGA HNSC -0.248; TCGA KIRC -0.36; TCGA LGG -0.114; TCGA LIHC -0.255; TCGA LUAD -0.263; TCGA LUSC -0.119; TCGA PAAD -0.301; TCGA THCA -0.225; TCGA STAD -0.582
hsa-miR-146b-5p
USP22
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; UCEC
mirMAP
TCGA BLCA -0.079; TCGA BRCA -0.082; TCGA COAD -0.103; TCGA ESCA -0.124; TCGA HNSC -0.062; TCGA KIRC -0.09; TCGA LUAD -0.104; TCGA LUSC -0.127; TCGA PAAD -0.164; TCGA SARC -0.102; TCGA UCEC -0.068
hsa-miR-146b-5p
HIP1
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC
mirMAP
TCGA BLCA -0.07; TCGA BRCA -0.247; TCGA HNSC -0.116; TCGA KIRC -0.133; TCGA KIRP -0.186; TCGA LGG -0.183; TCGA LIHC -0.123; TCGA PRAD -0.16; TCGA SARC -0.202
hsa-miR-146b-5p
TTBK2
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.115; TCGA BRCA -0.309; TCGA CESC -0.165; TCGA HNSC -0.204; TCGA KIRC -0.09; TCGA KIRP -0.222; TCGA LGG -0.099; TCGA LIHC -0.119; TCGA PRAD -0.268; TCGA SARC -0.314; TCGA THCA -0.083; TCGA STAD -0.171; TCGA UCEC -0.213
hsa-miR-146b-5p
DSTYK
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.137; TCGA COAD -0.079; TCGA ESCA -0.08; TCGA HNSC -0.11; TCGA KIRC -0.116; TCGA KIRP -0.112; TCGA LGG -0.063; TCGA LIHC -0.065; TCGA LUAD -0.107; TCGA LUSC -0.068; TCGA PRAD -0.09; TCGA SARC -0.08; TCGA STAD -0.087; TCGA UCEC -0.062
hsa-miR-146b-5p
ACVR1B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PRAD; THCA
mirMAP
TCGA BLCA -0.16; TCGA BRCA -0.167; TCGA CESC -0.084; TCGA COAD -0.295; TCGA ESCA -0.102; TCGA HNSC -0.106; TCGA KIRC -0.1; TCGA LIHC -0.051; TCGA LUSC -0.118; TCGA PRAD -0.13; TCGA THCA -0.071
hsa-miR-146b-5p
FAM117B
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC
mirMAP
TCGA BLCA -0.175; TCGA BRCA -0.099; TCGA COAD -0.088; TCGA HNSC -0.165; TCGA KIRC -0.096; TCGA KIRP -0.056; TCGA LGG -0.167; TCGA LUAD -0.102; TCGA LUSC -0.349; TCGA SARC -0.099
hsa-miR-146b-5p
ABI2
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.072; TCGA BRCA -0.062; TCGA CESC -0.123; TCGA KIRC -0.095; TCGA KIRP -0.102; TCGA LGG -0.085; TCGA PAAD -0.092; TCGA PRAD -0.081; TCGA SARC -0.122; TCGA STAD -0.098
hsa-miR-146b-5p
FTO
11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.053; TCGA BRCA -0.155; TCGA COAD -0.092; TCGA HNSC -0.082; TCGA LGG -0.069; TCGA LUAD -0.096; TCGA PAAD -0.07; TCGA PRAD -0.154; TCGA SARC -0.07; TCGA STAD -0.117; TCGA UCEC -0.165
hsa-miR-146b-5p
POU2F1
12 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.233; TCGA BRCA -0.156; TCGA CESC -0.14; TCGA COAD -0.242; TCGA KIRP -0.08; TCGA LGG -0.214; TCGA LUAD -0.271; TCGA LUSC -0.281; TCGA OV -0.071; TCGA PAAD -0.127; TCGA PRAD -0.301; TCGA SARC -0.059
hsa-miR-146b-5p
SSBP2
9 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.101; TCGA BRCA -0.262; TCGA HNSC -0.147; TCGA KIRP -0.084; TCGA LIHC -0.133; TCGA PRAD -0.112; TCGA SARC -0.22; TCGA STAD -0.478; TCGA UCEC -0.13
hsa-miR-146b-5p
RMND5B
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.096; TCGA BRCA -0.126; TCGA ESCA -0.159; TCGA HNSC -0.117; TCGA KIRC -0.065; TCGA LGG -0.065; TCGA PAAD -0.103; TCGA SARC -0.13; TCGA STAD -0.095
hsa-miR-146b-5p
JMY
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.197; TCGA BRCA -0.131; TCGA CESC -0.123; TCGA COAD -0.134; TCGA ESCA -0.212; TCGA HNSC -0.133; TCGA KIRC -0.186; TCGA KIRP -0.098; TCGA LGG -0.154; TCGA PAAD -0.142; TCGA PRAD -0.057; TCGA SARC -0.196; TCGA STAD -0.199; TCGA UCEC -0.076
hsa-miR-146b-5p
KCNB1
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.197; TCGA BRCA -0.184; TCGA COAD -0.403; TCGA ESCA -0.431; TCGA LGG -0.371; TCGA LIHC -0.201; TCGA PAAD -0.438; TCGA PRAD -0.508; TCGA SARC -0.553; TCGA STAD -1.202; TCGA UCEC -0.679
hsa-miR-146b-5p
SHANK2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.355; TCGA BRCA -0.109; TCGA COAD -0.412; TCGA HNSC -0.226; TCGA KIRC -0.13; TCGA KIRP -0.196; TCGA LGG -0.4; TCGA LIHC -0.107; TCGA LUAD -0.163; TCGA PRAD -0.092; TCGA THCA -0.305; TCGA STAD -0.213; TCGA UCEC -0.188
hsa-miR-146b-5p
NFASC
10 cancers: BLCA; COAD; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.167; TCGA COAD -0.44; TCGA HNSC -0.121; TCGA KIRC -0.214; TCGA PAAD -0.256; TCGA PRAD -0.133; TCGA SARC -0.717; TCGA THCA -0.104; TCGA STAD -0.505; TCGA UCEC -0.473
hsa-miR-146b-5p
ZNF704
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.348; TCGA BRCA -0.323; TCGA CESC -0.422; TCGA COAD -0.524; TCGA ESCA -0.451; TCGA HNSC -0.235; TCGA KIRC -0.251; TCGA KIRP -0.312; TCGA LGG -0.246; TCGA LUAD -0.225; TCGA PRAD -0.182; TCGA SARC -0.425; TCGA THCA -0.088; TCGA STAD -0.42; TCGA UCEC -0.35
hsa-miR-146b-5p
ADCY1
10 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; OV; PAAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.538; TCGA KIRC -0.331; TCGA KIRP -0.467; TCGA LIHC -0.412; TCGA OV -0.166; TCGA PAAD -0.272; TCGA SARC -0.221; TCGA THCA -0.2; TCGA UCEC -0.249
hsa-miR-146b-5p
MECP2
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.102; TCGA COAD -0.124; TCGA ESCA -0.085; TCGA KIRC -0.121; TCGA KIRP -0.115; TCGA PAAD -0.065; TCGA PRAD -0.134; TCGA SARC -0.099; TCGA STAD -0.159; TCGA UCEC -0.077
hsa-miR-146b-5p
AR
11 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.673; TCGA BRCA -0.902; TCGA HNSC -0.521; TCGA KIRP -0.202; TCGA LGG -0.165; TCGA LUAD -0.288; TCGA PRAD -0.242; TCGA SARC -0.582; TCGA THCA -0.295; TCGA STAD -0.619; TCGA UCEC -0.492
hsa-miR-146b-5p
LONRF2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.731; TCGA BRCA -0.738; TCGA CESC -0.48; TCGA ESCA -0.806; TCGA HNSC -0.548; TCGA KIRC -0.396; TCGA KIRP -0.337; TCGA PRAD -0.115; TCGA SARC -0.956; TCGA STAD -0.945; TCGA UCEC -0.362
hsa-miR-146b-5p
WIPF2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC
mirMAP
TCGA BLCA -0.081; TCGA BRCA -0.178; TCGA CESC -0.081; TCGA COAD -0.081; TCGA HNSC -0.167; TCGA KIRP -0.094; TCGA LGG -0.052; TCGA LUAD -0.058; TCGA LUSC -0.112; TCGA PRAD -0.118; TCGA SARC -0.086
hsa-miR-146b-5p
SMAD2
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.062; TCGA BRCA -0.078; TCGA HNSC -0.085; TCGA KIRC -0.064; TCGA KIRP -0.069; TCGA LGG -0.073; TCGA LUAD -0.125; TCGA LUSC -0.107; TCGA PRAD -0.085; TCGA STAD -0.064
hsa-miR-146b-5p
RIMS2
9 cancers: BLCA; CESC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.232; TCGA CESC -0.449; TCGA LGG -0.268; TCGA LUSC -0.479; TCGA PAAD -0.369; TCGA PRAD -0.157; TCGA SARC -0.509; TCGA STAD -0.613; TCGA UCEC -0.397
hsa-miR-146b-5p
CYB5D1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.07; TCGA BRCA -0.262; TCGA CESC -0.095; TCGA ESCA -0.119; TCGA HNSC -0.067; TCGA KIRC -0.068; TCGA LIHC -0.102; TCGA PAAD -0.257; TCGA PRAD -0.132; TCGA SARC -0.076; TCGA THCA -0.128; TCGA STAD -0.069; TCGA UCEC -0.134
hsa-miR-146b-5p
ZBTB40
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.128; TCGA BRCA -0.108; TCGA KIRC -0.098; TCGA KIRP -0.053; TCGA LGG -0.068; TCGA PRAD -0.082; TCGA SARC -0.192; TCGA THCA -0.054; TCGA UCEC -0.122
hsa-miR-146b-5p
PPARA
14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.096; TCGA COAD -0.156; TCGA ESCA -0.185; TCGA HNSC -0.232; TCGA KIRC -0.213; TCGA KIRP -0.126; TCGA LGG -0.154; TCGA LUAD -0.055; TCGA LUSC -0.103; TCGA PAAD -0.141; TCGA PRAD -0.158; TCGA SARC -0.122; TCGA STAD -0.133; TCGA UCEC -0.07
hsa-miR-146b-5p
ZNF81
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC
mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.183; TCGA COAD -0.164; TCGA HNSC -0.111; TCGA KIRP -0.109; TCGA LGG -0.25; TCGA LIHC -0.081; TCGA LUSC -0.079; TCGA PRAD -0.111; TCGA SARC -0.15
hsa-miR-146b-5p
VPS13A
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; OV; PAAD; SARC; UCEC
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.163; TCGA CESC -0.101; TCGA HNSC -0.108; TCGA KIRC -0.087; TCGA KIRP -0.094; TCGA OV -0.097; TCGA PAAD -0.186; TCGA SARC -0.245; TCGA UCEC -0.09
hsa-miR-146b-5p
ZBTB10
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; SARC; STAD
mirMAP
TCGA BLCA -0.188; TCGA BRCA -0.117; TCGA CESC -0.214; TCGA COAD -0.521; TCGA KIRC -0.139; TCGA KIRP -0.154; TCGA LGG -0.188; TCGA SARC -0.211; TCGA STAD -0.239
hsa-miR-146b-5p
LCOR
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRNATAP
TCGA BLCA -0.266; TCGA BRCA -0.355; TCGA HNSC -0.265; TCGA KIRC -0.115; TCGA KIRP -0.237; TCGA LGG -0.232; TCGA LIHC -0.111; TCGA LUAD -0.106; TCGA LUSC -0.097; TCGA PRAD -0.193; TCGA SARC -0.123
hsa-miR-146b-5p
SOX5
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.198; TCGA BRCA -0.344; TCGA CESC -0.378; TCGA HNSC -0.372; TCGA KIRC -0.203; TCGA KIRP -0.442; TCGA PRAD -0.318; TCGA SARC -0.337; TCGA THCA -0.209; TCGA STAD -0.443; TCGA UCEC -0.161
hsa-miR-146b-5p
TLN2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; THCA
miRNATAP
TCGA BLCA -0.095; TCGA BRCA -0.173; TCGA CESC -0.203; TCGA ESCA -0.215; TCGA HNSC -0.134; TCGA KIRC -0.217; TCGA KIRP -0.097; TCGA LIHC -0.154; TCGA LUAD -0.16; TCGA LUSC -0.191; TCGA THCA -0.149
hsa-miR-146b-5p
NDUFA5
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; OV; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.162; TCGA ESCA -0.097; TCGA HNSC -0.058; TCGA KIRC -0.109; TCGA LUAD -0.08; TCGA OV -0.06; TCGA PAAD -0.214; TCGA SARC -0.08; TCGA THCA -0.096; TCGA STAD -0.079
hsa-miR-146b-5p
TAF9B
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.116; TCGA BRCA -0.245; TCGA CESC -0.163; TCGA COAD -0.157; TCGA HNSC -0.119; TCGA KIRP -0.12; TCGA LGG -0.109; TCGA LUSC -0.074; TCGA PAAD -0.171; TCGA PRAD -0.073; TCGA SARC -0.19; TCGA STAD -0.206; TCGA UCEC -0.123
hsa-miR-146b-5p
SBF2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.157; TCGA BRCA -0.134; TCGA CESC -0.142; TCGA COAD -0.105; TCGA ESCA -0.117; TCGA HNSC -0.16; TCGA KIRC -0.114; TCGA KIRP -0.156; TCGA LGG -0.196; TCGA LUAD -0.167; TCGA LUSC -0.105; TCGA PRAD -0.131; TCGA SARC -0.13; TCGA STAD -0.133; TCGA UCEC -0.187
hsa-miR-146b-5p
KBTBD3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; OV; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.235; TCGA CESC -0.098; TCGA COAD -0.091; TCGA ESCA -0.169; TCGA HNSC -0.073; TCGA KIRC -0.137; TCGA KIRP -0.075; TCGA OV -0.137; TCGA PAAD -0.162; TCGA SARC -0.105; TCGA STAD -0.13; TCGA UCEC -0.107
hsa-miR-146b-5p
BAG1
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; STAD
miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.163; TCGA ESCA -0.308; TCGA KIRC -0.315; TCGA KIRP -0.156; TCGA LGG -0.065; TCGA LIHC -0.082; TCGA LUAD -0.2; TCGA PAAD -0.228; TCGA STAD -0.099
hsa-miR-146b-5p
CDC42BPA
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.132; TCGA BRCA -0.078; TCGA CESC -0.173; TCGA ESCA -0.238; TCGA HNSC -0.09; TCGA KIRC -0.141; TCGA KIRP -0.111; TCGA PAAD -0.127; TCGA PRAD -0.156; TCGA SARC -0.167; TCGA STAD -0.165; TCGA UCEC -0.23
hsa-miR-146b-5p
MMP16
9 cancers: BRCA; CESC; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNAWalker2 validate; MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BRCA -0.275; TCGA CESC -0.222; TCGA LGG -0.332; TCGA LUAD -0.167; TCGA LUSC -0.252; TCGA OV -0.165; TCGA PRAD -0.131; TCGA STAD -0.251; TCGA UCEC -0.29
hsa-miR-146b-5p
TRAF6
11 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.147; TCGA HNSC -0.123; TCGA KIRC -0.092; TCGA KIRP -0.091; TCGA LGG -0.056; TCGA LIHC -0.068; TCGA LUAD -0.103; TCGA PRAD -0.118; TCGA SARC -0.08; TCGA THCA -0.112; TCGA UCEC -0.066
hsa-miR-146b-5p
FAM98B
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC
MirTarget
TCGA BRCA -0.099; TCGA HNSC -0.064; TCGA KIRC -0.102; TCGA KIRP -0.133; TCGA LGG -0.09; TCGA LIHC -0.059; TCGA LUAD -0.148; TCGA LUSC -0.116; TCGA SARC -0.059
hsa-miR-146b-5p
FAM168B
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
MirTarget; miRanda
TCGA BRCA -0.054; TCGA CESC -0.089; TCGA COAD -0.175; TCGA ESCA -0.141; TCGA HNSC -0.175; TCGA KIRC -0.124; TCGA KIRP -0.089; TCGA LGG -0.052; TCGA LUAD -0.112; TCGA LUSC -0.176; TCGA PRAD -0.113; TCGA SARC -0.148; TCGA STAD -0.174
hsa-miR-146b-5p
ZNF813
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; OV; PRAD; SARC; THCA; STAD
MirTarget; PITA; miRanda
TCGA BRCA -0.22; TCGA HNSC -0.326; TCGA KIRC -0.116; TCGA KIRP -0.157; TCGA LGG -0.151; TCGA OV -0.114; TCGA PRAD -0.195; TCGA SARC -0.136; TCGA THCA -0.051; TCGA STAD -0.17
hsa-miR-146b-5p
USP37
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC
MirTarget; miRanda
TCGA BRCA -0.118; TCGA CESC -0.149; TCGA COAD -0.178; TCGA HNSC -0.09; TCGA KIRP -0.051; TCGA LGG -0.105; TCGA LIHC -0.062; TCGA LUAD -0.057; TCGA LUSC -0.118; TCGA PAAD -0.093; TCGA SARC -0.136
hsa-miR-146b-5p
ESYT2
9 cancers: BRCA; HNSC; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BRCA -0.053; TCGA HNSC -0.15; TCGA KIRP -0.053; TCGA LIHC -0.077; TCGA PRAD -0.061; TCGA SARC -0.225; TCGA THCA -0.072; TCGA STAD -0.078; TCGA UCEC -0.061
hsa-miR-146b-5p
DLG1
9 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD
MirTarget; miRanda
TCGA BRCA -0.097; TCGA CESC -0.14; TCGA COAD -0.119; TCGA HNSC -0.239; TCGA LIHC -0.05; TCGA LUAD -0.056; TCGA LUSC -0.223; TCGA PAAD -0.06; TCGA PRAD -0.065
hsa-miR-146b-5p
CXXC4
9 cancers: BRCA; COAD; ESCA; LGG; LUAD; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.402; TCGA COAD -0.66; TCGA ESCA -0.352; TCGA LGG -0.448; TCGA LUAD -0.465; TCGA PAAD -0.562; TCGA THCA -0.27; TCGA STAD -0.393; TCGA UCEC -0.224
hsa-miR-146b-5p
APPL1
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; UCEC
MirTarget; PITA; miRanda
TCGA BRCA -0.154; TCGA COAD -0.089; TCGA ESCA -0.122; TCGA HNSC -0.11; TCGA KIRC -0.105; TCGA KIRP -0.096; TCGA LGG -0.102; TCGA PRAD -0.065; TCGA UCEC -0.071
hsa-miR-146b-5p
IGFBP5
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BRCA -0.197; TCGA CESC -0.356; TCGA HNSC -0.168; TCGA KIRC -0.177; TCGA KIRP -0.223; TCGA LIHC -0.194; TCGA LUAD -0.317; TCGA SARC -0.278; TCGA STAD -0.265; TCGA UCEC -0.338
hsa-miR-146b-5p
INTS2
9 cancers: BRCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA
MirTarget; miRanda; miRNATAP
TCGA BRCA -0.158; TCGA HNSC -0.11; TCGA LGG -0.124; TCGA LUAD -0.055; TCGA LUSC -0.132; TCGA PAAD -0.103; TCGA PRAD -0.082; TCGA SARC -0.113; TCGA THCA -0.067
hsa-miR-146b-5p
YLPM1
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.115; TCGA HNSC -0.088; TCGA KIRC -0.143; TCGA KIRP -0.117; TCGA LGG -0.158; TCGA LUAD -0.098; TCGA LUSC -0.105; TCGA PAAD -0.071; TCGA PRAD -0.068
hsa-miR-146b-5p
FRMD6
9 cancers: BRCA; HNSC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BRCA -0.132; TCGA HNSC -0.173; TCGA KIRP -0.131; TCGA LIHC -0.11; TCGA LUSC -0.299; TCGA PRAD -0.25; TCGA SARC -0.148; TCGA STAD -0.228; TCGA UCEC -0.317
hsa-miR-146b-5p
EXOC5
10 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
MirTarget; miRanda
TCGA BRCA -0.103; TCGA CESC -0.097; TCGA HNSC -0.097; TCGA KIRP -0.063; TCGA LGG -0.108; TCGA LIHC -0.072; TCGA LUAD -0.055; TCGA LUSC -0.079; TCGA PRAD -0.05; TCGA SARC -0.067
hsa-miR-146b-5p
HIPK3
13 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.366; TCGA ESCA -0.174; TCGA HNSC -0.379; TCGA KIRC -0.161; TCGA KIRP -0.259; TCGA LGG -0.094; TCGA LIHC -0.167; TCGA LUAD -0.108; TCGA PRAD -0.311; TCGA SARC -0.34; TCGA THCA -0.051; TCGA STAD -0.217; TCGA UCEC -0.189
hsa-miR-146b-5p
NTRK2
11 cancers: BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BRCA -0.314; TCGA CESC -0.612; TCGA HNSC -0.608; TCGA KIRC -0.53; TCGA LGG -0.286; TCGA LIHC -0.211; TCGA LUSC -0.536; TCGA PRAD -0.321; TCGA SARC -0.552; TCGA STAD -0.45; TCGA UCEC -0.377
hsa-miR-146b-5p
RUNX1T1
11 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BRCA -0.254; TCGA HNSC -0.168; TCGA KIRC -0.194; TCGA KIRP -0.234; TCGA LGG -0.374; TCGA LUAD -0.126; TCGA PRAD -0.199; TCGA SARC -0.246; TCGA THCA -0.2; TCGA STAD -0.283; TCGA UCEC -0.34
hsa-miR-146b-5p
FBXL3
11 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; THCA; UCEC
PITA; miRanda
TCGA BRCA -0.175; TCGA HNSC -0.108; TCGA KIRC -0.128; TCGA KIRP -0.169; TCGA LIHC -0.092; TCGA LUAD -0.066; TCGA OV -0.129; TCGA PRAD -0.107; TCGA SARC -0.133; TCGA THCA -0.071; TCGA UCEC -0.095
hsa-miR-146b-5p
PCLO
12 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; THCA; STAD
PITA; miRanda
TCGA BRCA -0.368; TCGA CESC -0.527; TCGA COAD -0.65; TCGA HNSC -0.253; TCGA KIRC -0.167; TCGA KIRP -0.101; TCGA LUSC -0.235; TCGA OV -0.227; TCGA PAAD -0.522; TCGA PRAD -0.13; TCGA THCA -0.205; TCGA STAD -0.829
hsa-miR-146b-5p
WDR47
11 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BRCA -0.168; TCGA CESC -0.121; TCGA HNSC -0.182; TCGA KIRP -0.067; TCGA LIHC -0.07; TCGA LUAD -0.054; TCGA LUSC -0.098; TCGA PRAD -0.101; TCGA SARC -0.151; TCGA STAD -0.147; TCGA UCEC -0.122
hsa-miR-146b-5p
LIN7C
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; UCEC
PITA; miRanda
TCGA BRCA -0.097; TCGA HNSC -0.076; TCGA KIRC -0.064; TCGA KIRP -0.061; TCGA LUAD -0.098; TCGA LUSC -0.118; TCGA OV -0.053; TCGA PRAD -0.057; TCGA UCEC -0.066
hsa-miR-146b-5p
STRBP
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; SARC
PITA; miRanda
TCGA BRCA -0.064; TCGA CESC -0.12; TCGA COAD -0.121; TCGA HNSC -0.149; TCGA KIRC -0.202; TCGA KIRP -0.054; TCGA LUAD -0.092; TCGA LUSC -0.168; TCGA OV -0.069; TCGA PAAD -0.17; TCGA SARC -0.092
hsa-miR-146b-5p
TEAD1
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BRCA -0.191; TCGA CESC -0.103; TCGA COAD -0.142; TCGA ESCA -0.118; TCGA HNSC -0.118; TCGA KIRP -0.069; TCGA LGG -0.205; TCGA LIHC -0.15; TCGA LUAD -0.066; TCGA PRAD -0.222; TCGA SARC -0.184; TCGA STAD -0.281; TCGA UCEC -0.076
hsa-miR-146b-5p
ZNF148
9 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC
PITA; miRanda; miRNATAP
TCGA BRCA -0.125; TCGA COAD -0.077; TCGA HNSC -0.142; TCGA KIRP -0.078; TCGA LGG -0.068; TCGA LIHC -0.057; TCGA LUSC -0.114; TCGA PRAD -0.084; TCGA SARC -0.085
hsa-miR-146b-5p
TRIM9
10 cancers: BRCA; CESC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BRCA -0.137; TCGA CESC -0.435; TCGA LGG -0.146; TCGA LUSC -0.418; TCGA PAAD -0.371; TCGA PRAD -0.346; TCGA SARC -0.25; TCGA THCA -0.106; TCGA STAD -0.297; TCGA UCEC -0.295
hsa-miR-146b-5p
THAP5
11 cancers: BRCA; CESC; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; UCEC
PITA; miRanda
TCGA BRCA -0.16; TCGA CESC -0.054; TCGA HNSC -0.067; TCGA KIRP -0.126; TCGA LGG -0.064; TCGA LUSC -0.07; TCGA PAAD -0.18; TCGA PRAD -0.059; TCGA SARC -0.111; TCGA THCA -0.051; TCGA UCEC -0.095
hsa-miR-146b-5p
ITFG1
10 cancers: BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BRCA -0.123; TCGA COAD -0.066; TCGA HNSC -0.053; TCGA KIRC -0.067; TCGA LUAD -0.116; TCGA LUSC -0.063; TCGA PAAD -0.135; TCGA PRAD -0.067; TCGA SARC -0.056; TCGA STAD -0.063
hsa-miR-146b-5p
NDUFS1
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BRCA -0.151; TCGA ESCA -0.108; TCGA HNSC -0.184; TCGA KIRC -0.218; TCGA KIRP -0.093; TCGA LUAD -0.116; TCGA LUSC -0.126; TCGA PRAD -0.113; TCGA SARC -0.071; TCGA STAD -0.072
hsa-miR-146b-5p
SIK3
9 cancers: BRCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BRCA -0.161; TCGA KIRC -0.141; TCGA KIRP -0.085; TCGA LGG -0.127; TCGA PAAD -0.102; TCGA PRAD -0.116; TCGA SARC -0.077; TCGA THCA -0.059; TCGA STAD -0.155
hsa-miR-146b-5p
SNX19
11 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.153; TCGA HNSC -0.068; TCGA KIRC -0.107; TCGA KIRP -0.087; TCGA LGG -0.073; TCGA LIHC -0.094; TCGA PRAD -0.094; TCGA SARC -0.132; TCGA THCA -0.057; TCGA STAD -0.177; TCGA UCEC -0.071
hsa-miR-146b-5p
SPIN1
11 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC
miRanda
TCGA BRCA -0.093; TCGA COAD -0.056; TCGA KIRC -0.1; TCGA KIRP -0.098; TCGA LIHC -0.104; TCGA LUAD -0.087; TCGA LUSC -0.093; TCGA OV -0.081; TCGA PRAD -0.104; TCGA SARC -0.127; TCGA UCEC -0.124
hsa-miR-146b-5p
GPM6A
11 cancers: BRCA; COAD; KIRC; KIRP; LGG; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.249; TCGA COAD -0.693; TCGA KIRC -0.378; TCGA KIRP -0.17; TCGA LGG -0.159; TCGA OV -0.302; TCGA PRAD -0.293; TCGA SARC -0.439; TCGA THCA -0.361; TCGA STAD -0.974; TCGA UCEC -0.357
hsa-miR-146b-5p
GFPT1
10 cancers: BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BRCA -0.157; TCGA CESC -0.141; TCGA COAD -0.155; TCGA HNSC -0.143; TCGA LGG -0.066; TCGA LIHC -0.05; TCGA LUAD -0.094; TCGA LUSC -0.086; TCGA PAAD -0.214; TCGA PRAD -0.067
hsa-miR-146b-5p
AK7
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; THCA; UCEC
miRanda
TCGA BRCA -0.357; TCGA CESC -0.409; TCGA ESCA -0.297; TCGA HNSC -0.391; TCGA KIRC -0.302; TCGA LUAD -0.221; TCGA PAAD -0.235; TCGA PRAD -0.147; TCGA THCA -0.181; TCGA UCEC -0.197
hsa-miR-146b-5p
FHL1
10 cancers: BRCA; COAD; ESCA; HNSC; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.237; TCGA COAD -0.27; TCGA ESCA -0.333; TCGA HNSC -0.211; TCGA LGG -0.144; TCGA PRAD -0.36; TCGA SARC -0.503; TCGA THCA -0.432; TCGA STAD -0.848; TCGA UCEC -0.299
hsa-miR-146b-5p
CFL2
9 cancers: BRCA; CESC; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.105; TCGA CESC -0.227; TCGA KIRC -0.094; TCGA KIRP -0.068; TCGA PRAD -0.248; TCGA SARC -0.326; TCGA THCA -0.104; TCGA STAD -0.493; TCGA UCEC -0.112
hsa-miR-146b-5p
KDM6A
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; SARC; UCEC
miRanda
TCGA BRCA -0.124; TCGA CESC -0.102; TCGA COAD -0.107; TCGA HNSC -0.101; TCGA KIRC -0.055; TCGA KIRP -0.147; TCGA LGG -0.059; TCGA LIHC -0.091; TCGA LUSC -0.088; TCGA SARC -0.13; TCGA UCEC -0.073
hsa-miR-146b-5p
PPP2R5E
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.109; TCGA HNSC -0.073; TCGA KIRC -0.091; TCGA KIRP -0.1; TCGA LGG -0.065; TCGA LIHC -0.106; TCGA LUSC -0.149; TCGA PRAD -0.074; TCGA SARC -0.062
hsa-miR-146b-5p
PTPRA
9 cancers: BRCA; CESC; COAD; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BRCA -0.118; TCGA CESC -0.059; TCGA COAD -0.12; TCGA KIRP -0.077; TCGA LIHC -0.071; TCGA LUAD -0.12; TCGA LUSC -0.098; TCGA PAAD -0.111; TCGA PRAD -0.05
hsa-miR-146b-5p
ZFX
11 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; THCA; UCEC
miRanda; mirMAP; miRNATAP
TCGA BRCA -0.258; TCGA CESC -0.099; TCGA HNSC -0.146; TCGA KIRP -0.153; TCGA LGG -0.084; TCGA LIHC -0.108; TCGA LUSC -0.086; TCGA PRAD -0.195; TCGA SARC -0.182; TCGA THCA -0.058; TCGA UCEC -0.119
hsa-miR-146b-5p
SSFA2
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; UCEC
miRanda
TCGA BRCA -0.274; TCGA CESC -0.223; TCGA ESCA -0.12; TCGA HNSC -0.145; TCGA KIRC -0.108; TCGA KIRP -0.124; TCGA LUAD -0.169; TCGA PRAD -0.067; TCGA SARC -0.096; TCGA UCEC -0.207
hsa-miR-146b-5p
SP3
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.094; TCGA CESC -0.109; TCGA COAD -0.117; TCGA HNSC -0.115; TCGA KIRP -0.076; TCGA LGG -0.067; TCGA LIHC -0.056; TCGA LUAD -0.056; TCGA LUSC -0.125; TCGA PRAD -0.077; TCGA SARC -0.115
hsa-miR-146b-5p
RAB3GAP1
9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BRCA -0.108; TCGA COAD -0.051; TCGA ESCA -0.073; TCGA HNSC -0.086; TCGA LUAD -0.062; TCGA LUSC -0.134; TCGA PRAD -0.104; TCGA SARC -0.122; TCGA STAD -0.088
hsa-miR-146b-5p
ASXL2
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.243; TCGA HNSC -0.279; TCGA KIRC -0.124; TCGA KIRP -0.218; TCGA LGG -0.152; TCGA LIHC -0.119; TCGA LUAD -0.107; TCGA LUSC -0.117; TCGA PRAD -0.239; TCGA SARC -0.161
hsa-miR-146b-5p
SORBS1
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.342; TCGA CESC -0.27; TCGA COAD -0.378; TCGA ESCA -0.553; TCGA HNSC -0.242; TCGA LGG -0.096; TCGA PRAD -0.41; TCGA SARC -0.757; TCGA STAD -0.769; TCGA UCEC -0.312
hsa-miR-146b-5p
UBE2Q2
10 cancers: BRCA; CESC; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.091; TCGA CESC -0.102; TCGA ESCA -0.166; TCGA LGG -0.058; TCGA LUAD -0.086; TCGA LUSC -0.063; TCGA PRAD -0.058; TCGA SARC -0.08; TCGA STAD -0.171; TCGA UCEC -0.08
hsa-miR-146b-5p
ITPR1
9 cancers: BRCA; KIRC; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.409; TCGA KIRC -0.196; TCGA KIRP -0.305; TCGA LIHC -0.094; TCGA PRAD -0.417; TCGA SARC -0.423; TCGA THCA -0.405; TCGA STAD -0.305; TCGA UCEC -0.37
hsa-miR-146b-5p
IMPACT
12 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA
miRanda
TCGA BRCA -0.211; TCGA HNSC -0.11; TCGA KIRC -0.078; TCGA KIRP -0.073; TCGA LIHC -0.064; TCGA LUAD -0.075; TCGA LUSC -0.199; TCGA OV -0.087; TCGA PAAD -0.151; TCGA PRAD -0.077; TCGA SARC -0.104; TCGA THCA -0.075
hsa-miR-146b-5p
PLCL1
10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.246; TCGA KIRC -0.521; TCGA KIRP -0.367; TCGA LGG -0.094; TCGA LIHC -0.086; TCGA PRAD -0.331; TCGA SARC -0.235; TCGA THCA -0.179; TCGA STAD -0.323; TCGA UCEC -0.235
hsa-miR-146b-5p
ATPAF1
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; SARC; STAD
miRanda
TCGA BRCA -0.182; TCGA COAD -0.096; TCGA ESCA -0.093; TCGA HNSC -0.082; TCGA KIRC -0.148; TCGA LUSC -0.081; TCGA PAAD -0.175; TCGA SARC -0.103; TCGA STAD -0.124
hsa-miR-146b-5p
ZNF619
9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC
miRanda
TCGA BRCA -0.283; TCGA ESCA -0.113; TCGA HNSC -0.101; TCGA KIRC -0.169; TCGA KIRP -0.18; TCGA LGG -0.186; TCGA LIHC -0.085; TCGA PRAD -0.103; TCGA SARC -0.176
hsa-miR-146b-5p
ZFPM2
9 cancers: BRCA; CESC; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.234; TCGA CESC -0.315; TCGA LGG -0.298; TCGA LIHC -0.175; TCGA PRAD -0.34; TCGA SARC -0.26; TCGA THCA -0.154; TCGA STAD -0.429; TCGA UCEC -0.3
hsa-miR-146b-5p
FAM120AOS
9 cancers: BRCA; CESC; COAD; KIRP; LUSC; OV; PAAD; SARC; STAD
miRanda
TCGA BRCA -0.196; TCGA CESC -0.083; TCGA COAD -0.087; TCGA KIRP -0.075; TCGA LUSC -0.105; TCGA OV -0.055; TCGA PAAD -0.155; TCGA SARC -0.101; TCGA STAD -0.087
hsa-miR-146b-5p
BMPR1B
9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD
miRanda
TCGA BRCA -0.764; TCGA CESC -0.666; TCGA KIRC -0.726; TCGA KIRP -0.349; TCGA LGG -0.126; TCGA LUAD -0.324; TCGA LUSC -0.259; TCGA THCA -0.123; TCGA STAD -0.648
hsa-miR-146b-5p
CELF3
9 cancers: BRCA; COAD; ESCA; LGG; LUAD; PAAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.277; TCGA COAD -0.574; TCGA ESCA -0.827; TCGA LGG -0.172; TCGA LUAD -0.277; TCGA PAAD -0.447; TCGA SARC -0.654; TCGA STAD -0.521; TCGA UCEC -0.255
hsa-miR-146b-5p
CLN5
10 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; THCA
miRanda
TCGA BRCA -0.113; TCGA COAD -0.121; TCGA KIRC -0.158; TCGA KIRP -0.072; TCGA LIHC -0.056; TCGA LUAD -0.095; TCGA OV -0.135; TCGA PAAD -0.09; TCGA PRAD -0.111; TCGA THCA -0.112
hsa-miR-146b-5p
SPTBN1
9 cancers: BRCA; HNSC; KIRC; LIHC; LUAD; PRAD; SARC; THCA; UCEC
miRanda
TCGA BRCA -0.197; TCGA HNSC -0.128; TCGA KIRC -0.177; TCGA LIHC -0.069; TCGA LUAD -0.135; TCGA PRAD -0.175; TCGA SARC -0.088; TCGA THCA -0.116; TCGA UCEC -0.187
hsa-miR-146b-5p
UBXN7
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC
miRanda; mirMAP
TCGA BRCA -0.158; TCGA CESC -0.132; TCGA HNSC -0.165; TCGA KIRC -0.095; TCGA KIRP -0.157; TCGA LGG -0.199; TCGA LIHC -0.101; TCGA LUSC -0.22; TCGA PRAD -0.144; TCGA SARC -0.089
hsa-miR-146b-5p
PRDM5
12 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; OV; PRAD; SARC; THCA; STAD
miRanda
TCGA BRCA -0.136; TCGA COAD -0.417; TCGA HNSC -0.165; TCGA KIRC -0.162; TCGA KIRP -0.207; TCGA LGG -0.075; TCGA LIHC -0.161; TCGA OV -0.171; TCGA PRAD -0.239; TCGA SARC -0.171; TCGA THCA -0.083; TCGA STAD -0.545
hsa-miR-146b-5p
ANGPTL1
9 cancers: BRCA; KIRC; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.171; TCGA KIRC -0.586; TCGA KIRP -0.264; TCGA LIHC -0.403; TCGA PRAD -0.254; TCGA SARC -0.377; TCGA THCA -0.25; TCGA STAD -0.904; TCGA UCEC -0.457
hsa-miR-146b-5p
SUCLA2
13 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD
miRanda
TCGA BRCA -0.205; TCGA ESCA -0.151; TCGA HNSC -0.119; TCGA KIRC -0.211; TCGA KIRP -0.14; TCGA LIHC -0.051; TCGA LUAD -0.129; TCGA LUSC -0.074; TCGA OV -0.131; TCGA PAAD -0.117; TCGA PRAD -0.121; TCGA THCA -0.076; TCGA STAD -0.09
hsa-miR-146b-5p
ASAP2
10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC
miRanda
TCGA BRCA -0.076; TCGA CESC -0.152; TCGA ESCA -0.111; TCGA KIRC -0.199; TCGA KIRP -0.198; TCGA LUAD -0.25; TCGA LUSC -0.218; TCGA OV -0.07; TCGA PRAD -0.062; TCGA SARC -0.082
hsa-miR-146b-5p
PCYOX1
15 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.316; TCGA COAD -0.108; TCGA ESCA -0.154; TCGA HNSC -0.251; TCGA KIRC -0.117; TCGA KIRP -0.171; TCGA LIHC -0.133; TCGA LUAD -0.188; TCGA LUSC -0.123; TCGA OV -0.056; TCGA PAAD -0.143; TCGA PRAD -0.178; TCGA SARC -0.112; TCGA STAD -0.192; TCGA UCEC -0.069
hsa-miR-146b-5p
PPM1B
9 cancers: BRCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.088; TCGA HNSC -0.08; TCGA KIRC -0.053; TCGA LGG -0.059; TCGA LIHC -0.105; TCGA LUAD -0.079; TCGA LUSC -0.071; TCGA PRAD -0.051; TCGA SARC -0.078
hsa-miR-146b-5p
SYNJ2
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; UCEC
miRanda
TCGA BRCA -0.103; TCGA CESC -0.223; TCGA COAD -0.083; TCGA ESCA -0.148; TCGA HNSC -0.097; TCGA KIRC -0.095; TCGA KIRP -0.157; TCGA LIHC -0.122; TCGA LUSC -0.106; TCGA SARC -0.108; TCGA UCEC -0.156
hsa-miR-146b-5p
SPTLC2
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD
miRanda
TCGA BRCA -0.191; TCGA CESC -0.132; TCGA ESCA -0.149; TCGA HNSC -0.142; TCGA KIRC -0.181; TCGA KIRP -0.157; TCGA LUAD -0.071; TCGA LUSC -0.112; TCGA PRAD -0.068
hsa-miR-146b-5p
TMCC1
9 cancers: BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; SARC; UCEC
miRanda
TCGA BRCA -0.083; TCGA CESC -0.07; TCGA COAD -0.135; TCGA HNSC -0.075; TCGA LGG -0.187; TCGA LUAD -0.062; TCGA LUSC -0.087; TCGA SARC -0.064; TCGA UCEC -0.051
hsa-miR-146b-5p
VPS4B
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BRCA -0.113; TCGA HNSC -0.153; TCGA KIRC -0.056; TCGA KIRP -0.078; TCGA LUAD -0.103; TCGA LUSC -0.08; TCGA PRAD -0.081; TCGA SARC -0.081; TCGA UCEC -0.062
hsa-miR-146b-5p
MRVI1
11 cancers: BRCA; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.102; TCGA ESCA -0.27; TCGA HNSC -0.118; TCGA KIRC -0.086; TCGA LGG -0.116; TCGA LIHC -0.104; TCGA LUAD -0.092; TCGA PRAD -0.223; TCGA SARC -0.694; TCGA STAD -0.535; TCGA UCEC -0.31
hsa-miR-146b-5p
STRN
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC
miRanda; miRNATAP
TCGA BRCA -0.159; TCGA HNSC -0.328; TCGA KIRC -0.147; TCGA KIRP -0.264; TCGA LIHC -0.128; TCGA LUAD -0.077; TCGA LUSC -0.158; TCGA PRAD -0.129; TCGA SARC -0.117
hsa-miR-146b-5p
PIP4K2C
9 cancers: BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC
miRanda
TCGA BRCA -0.095; TCGA KIRC -0.163; TCGA KIRP -0.078; TCGA LIHC -0.057; TCGA LUAD -0.052; TCGA LUSC -0.124; TCGA PAAD -0.11; TCGA PRAD -0.079; TCGA SARC -0.109
hsa-miR-146b-5p
OSBPL1A
11 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.206; TCGA HNSC -0.132; TCGA KIRC -0.126; TCGA KIRP -0.104; TCGA LUAD -0.203; TCGA OV -0.069; TCGA PRAD -0.083; TCGA SARC -0.148; TCGA THCA -0.169; TCGA STAD -0.324; TCGA UCEC -0.233
hsa-miR-146b-5p
WDR7
12 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.172; TCGA ESCA -0.094; TCGA HNSC -0.085; TCGA KIRC -0.055; TCGA KIRP -0.055; TCGA LIHC -0.055; TCGA LUAD -0.064; TCGA PAAD -0.149; TCGA PRAD -0.143; TCGA SARC -0.102; TCGA STAD -0.087; TCGA UCEC -0.097
hsa-miR-146b-5p
DST
12 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.1; TCGA CESC -0.24; TCGA COAD -0.181; TCGA HNSC -0.115; TCGA KIRP -0.065; TCGA LGG -0.175; TCGA LIHC -0.116; TCGA LUSC -0.21; TCGA PRAD -0.102; TCGA SARC -0.264; TCGA STAD -0.357; TCGA UCEC -0.283
hsa-miR-146b-5p
PRKAR2A
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD
miRanda
TCGA BRCA -0.274; TCGA ESCA -0.24; TCGA HNSC -0.323; TCGA KIRC -0.203; TCGA KIRP -0.214; TCGA LGG -0.089; TCGA LUSC -0.102; TCGA PRAD -0.207; TCGA SARC -0.223; TCGA THCA -0.098; TCGA STAD -0.073
hsa-miR-146b-5p
VAPB
10 cancers: BRCA; COAD; HNSC; KIRC; LUAD; LUSC; OV; PAAD; THCA; STAD
miRanda
TCGA BRCA -0.068; TCGA COAD -0.158; TCGA HNSC -0.051; TCGA KIRC -0.063; TCGA LUAD -0.126; TCGA LUSC -0.08; TCGA OV -0.067; TCGA PAAD -0.201; TCGA THCA -0.116; TCGA STAD -0.057
hsa-miR-146b-5p
CNTN1
14 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.165; TCGA CESC -0.738; TCGA HNSC -0.362; TCGA KIRC -0.765; TCGA KIRP -0.332; TCGA LGG -0.324; TCGA LIHC -0.23; TCGA LUAD -0.279; TCGA LUSC -0.438; TCGA OV -0.211; TCGA PRAD -0.311; TCGA THCA -0.113; TCGA STAD -0.963; TCGA UCEC -0.564
hsa-miR-146b-5p
HCFC2
9 cancers: BRCA; ESCA; HNSC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.17; TCGA ESCA -0.098; TCGA HNSC -0.095; TCGA KIRP -0.079; TCGA LGG -0.122; TCGA PRAD -0.15; TCGA SARC -0.159; TCGA STAD -0.224; TCGA UCEC -0.154
hsa-miR-146b-5p
DAAM2
10 cancers: BRCA; ESCA; HNSC; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.196; TCGA ESCA -0.397; TCGA HNSC -0.205; TCGA LGG -0.337; TCGA LIHC -0.12; TCGA PRAD -0.339; TCGA SARC -0.286; TCGA THCA -0.142; TCGA STAD -0.584; TCGA UCEC -0.314
hsa-miR-146b-5p
DYNLL2
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BRCA -0.172; TCGA COAD -0.117; TCGA ESCA -0.087; TCGA HNSC -0.09; TCGA KIRC -0.219; TCGA KIRP -0.113; TCGA LIHC -0.056; TCGA LUSC -0.1; TCGA PAAD -0.14; TCGA PRAD -0.078; TCGA SARC -0.08; TCGA THCA -0.087; TCGA STAD -0.111
hsa-miR-146b-5p
FECH
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.133; TCGA HNSC -0.086; TCGA KIRC -0.276; TCGA KIRP -0.147; TCGA LUAD -0.133; TCGA LUSC -0.111; TCGA THCA -0.102; TCGA STAD -0.111; TCGA UCEC -0.076
hsa-miR-146b-5p
WDR31
15 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.392; TCGA CESC -0.25; TCGA ESCA -0.216; TCGA HNSC -0.25; TCGA KIRC -0.304; TCGA KIRP -0.181; TCGA LGG -0.088; TCGA LIHC -0.124; TCGA LUSC -0.121; TCGA PAAD -0.366; TCGA PRAD -0.222; TCGA SARC -0.326; TCGA THCA -0.166; TCGA STAD -0.154; TCGA UCEC -0.287
hsa-miR-146b-5p
ENPP3
9 cancers: BRCA; COAD; ESCA; LGG; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.172; TCGA COAD -1.105; TCGA ESCA -0.483; TCGA LGG -0.131; TCGA PAAD -0.284; TCGA PRAD -0.213; TCGA THCA -0.356; TCGA STAD -0.604; TCGA UCEC -0.724
hsa-miR-146b-5p
LRRC57
10 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; UCEC
miRanda
TCGA BRCA -0.073; TCGA CESC -0.111; TCGA COAD -0.073; TCGA HNSC -0.111; TCGA KIRC -0.126; TCGA KIRP -0.105; TCGA LUAD -0.078; TCGA LUSC -0.125; TCGA SARC -0.07; TCGA UCEC -0.058
hsa-miR-146b-5p
SERINC1
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.286; TCGA CESC -0.15; TCGA HNSC -0.088; TCGA KIRC -0.121; TCGA KIRP -0.084; TCGA LIHC -0.059; TCGA LUAD -0.062; TCGA PRAD -0.096; TCGA SARC -0.115; TCGA STAD -0.151; TCGA UCEC -0.104
hsa-miR-146b-5p
DDHD2
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.187; TCGA CESC -0.093; TCGA HNSC -0.098; TCGA KIRC -0.094; TCGA KIRP -0.068; TCGA LIHC -0.071; TCGA LUAD -0.161; TCGA PRAD -0.13; TCGA SARC -0.065; TCGA STAD -0.114; TCGA UCEC -0.096
hsa-miR-146b-5p
ZC3H14
10 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; UCEC
miRanda
TCGA BRCA -0.147; TCGA CESC -0.119; TCGA KIRC -0.126; TCGA KIRP -0.075; TCGA LGG -0.074; TCGA LIHC -0.059; TCGA LUAD -0.071; TCGA PAAD -0.143; TCGA PRAD -0.076; TCGA UCEC -0.056
hsa-miR-146b-5p
TM9SF2
11 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD
miRanda; miRNATAP
TCGA BRCA -0.122; TCGA COAD -0.119; TCGA HNSC -0.102; TCGA KIRC -0.098; TCGA KIRP -0.094; TCGA LIHC -0.069; TCGA LUAD -0.167; TCGA LUSC -0.08; TCGA OV -0.126; TCGA PAAD -0.172; TCGA PRAD -0.085
hsa-miR-146b-5p
CALCRL
10 cancers: BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; SARC; THCA; UCEC
miRanda
TCGA BRCA -0.25; TCGA CESC -0.169; TCGA HNSC -0.165; TCGA KIRP -0.104; TCGA LGG -0.534; TCGA LIHC -0.111; TCGA LUAD -0.109; TCGA SARC -0.083; TCGA THCA -0.081; TCGA UCEC -0.224
hsa-miR-146b-5p
FERMT2
9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.121; TCGA CESC -0.273; TCGA KIRC -0.144; TCGA KIRP -0.163; TCGA LIHC -0.064; TCGA PRAD -0.224; TCGA SARC -0.248; TCGA STAD -0.462; TCGA UCEC -0.152
hsa-miR-146b-5p
KCNE4
9 cancers: BRCA; CESC; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.396; TCGA CESC -0.218; TCGA LIHC -0.169; TCGA LUAD -0.385; TCGA PRAD -0.224; TCGA SARC -0.282; TCGA THCA -0.087; TCGA STAD -0.283; TCGA UCEC -0.401
hsa-miR-146b-5p
NHLRC2
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA
miRanda
TCGA BRCA -0.244; TCGA ESCA -0.108; TCGA HNSC -0.163; TCGA KIRC -0.171; TCGA KIRP -0.225; TCGA LGG -0.173; TCGA LIHC -0.081; TCGA LUAD -0.122; TCGA LUSC -0.08; TCGA PRAD -0.151; TCGA THCA -0.072
hsa-miR-146b-5p
FNDC5
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; THCA; STAD
miRanda
TCGA BRCA -0.324; TCGA CESC -0.28; TCGA COAD -0.241; TCGA ESCA -0.332; TCGA HNSC -0.327; TCGA KIRC -0.276; TCGA KIRP -0.16; TCGA LIHC -0.48; TCGA PAAD -0.21; TCGA THCA -0.114; TCGA STAD -0.715
hsa-miR-146b-5p
LIN52
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BRCA -0.18; TCGA CESC -0.151; TCGA HNSC -0.116; TCGA KIRC -0.205; TCGA KIRP -0.157; TCGA LUAD -0.072; TCGA LUSC -0.129; TCGA PAAD -0.122; TCGA PRAD -0.092; TCGA SARC -0.113; TCGA STAD -0.063
hsa-miR-146b-5p
SNAPC3
10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; PRAD; SARC; UCEC
miRanda
TCGA BRCA -0.094; TCGA COAD -0.091; TCGA ESCA -0.129; TCGA KIRC -0.096; TCGA KIRP -0.074; TCGA LGG -0.085; TCGA LIHC -0.061; TCGA PRAD -0.074; TCGA SARC -0.097; TCGA UCEC -0.106
hsa-miR-146b-5p
CDON
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BRCA -0.377; TCGA CESC -0.291; TCGA COAD -0.171; TCGA ESCA -0.208; TCGA HNSC -0.278; TCGA LGG -0.31; TCGA LUAD -0.209; TCGA THCA -0.372; TCGA STAD -0.483; TCGA UCEC -0.127
hsa-miR-146b-5p
RBBP5
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.16; TCGA HNSC -0.146; TCGA KIRC -0.103; TCGA KIRP -0.115; TCGA LIHC -0.067; TCGA LUAD -0.086; TCGA LUSC -0.169; TCGA PRAD -0.119; TCGA SARC -0.114
hsa-miR-146b-5p
RNMT
9 cancers: BRCA; CESC; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC
miRanda
TCGA BRCA -0.053; TCGA CESC -0.095; TCGA HNSC -0.131; TCGA KIRP -0.068; TCGA LGG -0.059; TCGA LUSC -0.158; TCGA PAAD -0.095; TCGA PRAD -0.079; TCGA SARC -0.08
hsa-miR-146b-5p
TLK1
10 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD
miRanda
TCGA BRCA -0.106; TCGA CESC -0.086; TCGA COAD -0.103; TCGA HNSC -0.061; TCGA KIRC -0.083; TCGA KIRP -0.102; TCGA LUAD -0.102; TCGA LUSC -0.065; TCGA SARC -0.062; TCGA STAD -0.072
hsa-miR-146b-5p
TIMP4
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; PRAD; THCA; STAD
miRanda; miRNATAP
TCGA BRCA -0.402; TCGA CESC -0.265; TCGA ESCA -0.484; TCGA HNSC -0.207; TCGA KIRC -0.156; TCGA LGG -0.186; TCGA PRAD -0.239; TCGA THCA -0.289; TCGA STAD -0.541
hsa-miR-146b-5p
ZFP28
9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; OV; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.11; TCGA COAD -0.546; TCGA KIRC -0.273; TCGA KIRP -0.205; TCGA LIHC -0.121; TCGA OV -0.094; TCGA SARC -0.273; TCGA STAD -0.417; TCGA UCEC -0.099
hsa-miR-146b-5p
TMEM17
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD
miRanda
TCGA BRCA -0.087; TCGA HNSC -0.088; TCGA KIRC -0.062; TCGA KIRP -0.054; TCGA LUAD -0.182; TCGA LUSC -0.16; TCGA PAAD -0.267; TCGA SARC -0.07; TCGA STAD -0.187
hsa-miR-146b-5p
ZBTB6
9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC
miRanda
TCGA BRCA -0.133; TCGA CESC -0.06; TCGA KIRC -0.054; TCGA KIRP -0.069; TCGA LGG -0.144; TCGA LUAD -0.061; TCGA LUSC -0.073; TCGA PAAD -0.09; TCGA SARC -0.089
hsa-miR-146b-5p
STX17
9 cancers: BRCA; KIRC; KIRP; LGG; LIHC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.083; TCGA KIRC -0.08; TCGA KIRP -0.069; TCGA LGG -0.055; TCGA LIHC -0.07; TCGA PAAD -0.082; TCGA SARC -0.128; TCGA STAD -0.074; TCGA UCEC -0.089
hsa-miR-146b-5p
AHNAK
9 cancers: BRCA; ESCA; HNSC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.363; TCGA ESCA -0.242; TCGA HNSC -0.236; TCGA KIRP -0.138; TCGA LGG -0.155; TCGA PRAD -0.132; TCGA SARC -0.117; TCGA STAD -0.367; TCGA UCEC -0.137
hsa-miR-146b-5p
FOXJ2
10 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.081; TCGA HNSC -0.085; TCGA KIRP -0.051; TCGA LGG -0.097; TCGA LIHC -0.087; TCGA LUAD -0.067; TCGA PRAD -0.116; TCGA SARC -0.104; TCGA STAD -0.105; TCGA UCEC -0.16
hsa-miR-146b-5p
GPRASP2
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BRCA -0.221; TCGA CESC -0.166; TCGA COAD -0.246; TCGA HNSC -0.209; TCGA KIRC -0.2; TCGA KIRP -0.129; TCGA LIHC -0.083; TCGA PAAD -0.271; TCGA PRAD -0.134; TCGA SARC -0.177; TCGA UCEC -0.181
hsa-miR-146b-5p
CDC73
9 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.11; TCGA CESC -0.08; TCGA ESCA -0.074; TCGA HNSC -0.092; TCGA KIRP -0.073; TCGA LUAD -0.083; TCGA LUSC -0.105; TCGA PRAD -0.067; TCGA SARC -0.092
hsa-miR-146b-5p
SYNE2
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; SARC; THCA; UCEC
miRanda
TCGA BRCA -0.086; TCGA HNSC -0.107; TCGA KIRC -0.246; TCGA KIRP -0.114; TCGA LGG -0.181; TCGA LIHC -0.146; TCGA LUAD -0.154; TCGA SARC -0.344; TCGA THCA -0.083; TCGA UCEC -0.113
hsa-miR-146b-5p
ZNF592
9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC
miRanda
TCGA BRCA -0.076; TCGA CESC -0.062; TCGA HNSC -0.06; TCGA KIRC -0.062; TCGA KIRP -0.064; TCGA LGG -0.104; TCGA LUAD -0.074; TCGA LUSC -0.062; TCGA SARC -0.06
hsa-miR-146b-5p
ACO1
9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; OV; PRAD; STAD
miRanda
TCGA BRCA -0.15; TCGA CESC -0.085; TCGA ESCA -0.211; TCGA KIRC -0.073; TCGA LGG -0.084; TCGA LIHC -0.119; TCGA OV -0.071; TCGA PRAD -0.073; TCGA STAD -0.149
hsa-miR-146b-5p
RBM18
9 cancers: BRCA; CESC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; UCEC
miRanda
TCGA BRCA -0.166; TCGA CESC -0.078; TCGA KIRC -0.116; TCGA KIRP -0.105; TCGA LUAD -0.059; TCGA LUSC -0.077; TCGA OV -0.082; TCGA PAAD -0.142; TCGA UCEC -0.065
hsa-miR-146b-5p
FAM122A
15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.16; TCGA CESC -0.091; TCGA COAD -0.058; TCGA ESCA -0.126; TCGA HNSC -0.085; TCGA KIRC -0.146; TCGA KIRP -0.115; TCGA LIHC -0.05; TCGA OV -0.091; TCGA PAAD -0.151; TCGA PRAD -0.114; TCGA SARC -0.106; TCGA THCA -0.059; TCGA STAD -0.127; TCGA UCEC -0.143
hsa-miR-146b-5p
IGF1R
12 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BRCA -0.477; TCGA COAD -0.173; TCGA HNSC -0.122; TCGA KIRC -0.152; TCGA KIRP -0.148; TCGA LGG -0.188; TCGA LIHC -0.131; TCGA LUAD -0.303; TCGA LUSC -0.283; TCGA PRAD -0.239; TCGA SARC -0.228; TCGA UCEC -0.198
hsa-miR-146b-5p
MAP2K5
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BRCA -0.103; TCGA ESCA -0.155; TCGA HNSC -0.058; TCGA KIRC -0.063; TCGA KIRP -0.071; TCGA LUAD -0.07; TCGA LUSC -0.109; TCGA PAAD -0.089; TCGA SARC -0.066; TCGA STAD -0.122; TCGA UCEC -0.061
hsa-miR-146b-5p
CDADC1
10 cancers: BRCA; KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.102; TCGA KIRC -0.149; TCGA KIRP -0.094; TCGA LUAD -0.06; TCGA OV -0.077; TCGA PAAD -0.163; TCGA PRAD -0.106; TCGA THCA -0.163; TCGA STAD -0.112; TCGA UCEC -0.087
hsa-miR-146b-5p
RIF1
9 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
miRanda
TCGA BRCA -0.091; TCGA HNSC -0.128; TCGA KIRP -0.171; TCGA LGG -0.077; TCGA LIHC -0.089; TCGA LUAD -0.073; TCGA LUSC -0.165; TCGA PRAD -0.146; TCGA SARC -0.206
hsa-miR-146b-5p
NUCKS1
10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC
miRanda; miRNATAP
TCGA BRCA -0.081; TCGA KIRC -0.074; TCGA KIRP -0.088; TCGA LGG -0.069; TCGA LIHC -0.068; TCGA LUAD -0.056; TCGA LUSC -0.159; TCGA PAAD -0.054; TCGA PRAD -0.08; TCGA SARC -0.073
hsa-miR-146b-5p
ZNF765
9 cancers: BRCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA
miRanda
TCGA BRCA -0.079; TCGA HNSC -0.099; TCGA KIRP -0.088; TCGA LUAD -0.07; TCGA LUSC -0.118; TCGA OV -0.138; TCGA PRAD -0.083; TCGA SARC -0.063; TCGA THCA -0.065
hsa-miR-146b-5p
GBE1
9 cancers: BRCA; CESC; HNSC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.24; TCGA CESC -0.148; TCGA HNSC -0.138; TCGA KIRP -0.105; TCGA PRAD -0.068; TCGA SARC -0.089; TCGA THCA -0.056; TCGA STAD -0.057; TCGA UCEC -0.153
hsa-miR-146b-5p
SPAG9
12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BRCA -0.124; TCGA CESC -0.09; TCGA HNSC -0.106; TCGA KIRC -0.053; TCGA KIRP -0.06; TCGA LGG -0.173; TCGA LIHC -0.082; TCGA LUSC -0.07; TCGA PRAD -0.059; TCGA SARC -0.067; TCGA THCA -0.064; TCGA UCEC -0.108
hsa-miR-146b-5p
CBX5
9 cancers: BRCA; COAD; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BRCA -0.104; TCGA COAD -0.121; TCGA LGG -0.087; TCGA LIHC -0.084; TCGA LUAD -0.062; TCGA LUSC -0.149; TCGA PAAD -0.115; TCGA PRAD -0.107; TCGA SARC -0.059
hsa-miR-146b-5p
CDS2
9 cancers: BRCA; COAD; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BRCA -0.134; TCGA COAD -0.095; TCGA LGG -0.086; TCGA LUAD -0.106; TCGA LUSC -0.071; TCGA PAAD -0.121; TCGA PRAD -0.071; TCGA SARC -0.101; TCGA STAD -0.17
hsa-miR-146b-5p
RGP1
11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BRCA -0.179; TCGA ESCA -0.197; TCGA HNSC -0.168; TCGA KIRC -0.247; TCGA KIRP -0.221; TCGA LGG -0.067; TCGA LUAD -0.089; TCGA PAAD -0.141; TCGA PRAD -0.197; TCGA SARC -0.201; TCGA STAD -0.105
hsa-miR-146b-5p
RND2
10 cancers: BRCA; COAD; HNSC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP; miRNATAP
TCGA BRCA -0.169; TCGA COAD -0.324; TCGA HNSC -0.246; TCGA LGG -0.311; TCGA LUSC -0.416; TCGA PAAD -0.493; TCGA PRAD -0.243; TCGA SARC -0.284; TCGA THCA -0.059; TCGA STAD -0.687
hsa-miR-146b-5p
PANK3
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA
mirMAP
TCGA BRCA -0.187; TCGA ESCA -0.15; TCGA HNSC -0.129; TCGA KIRC -0.094; TCGA KIRP -0.128; TCGA LGG -0.061; TCGA LUAD -0.094; TCGA LUSC -0.113; TCGA PRAD -0.069; TCGA THCA -0.062
hsa-miR-146b-5p
PIK3CA
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC
mirMAP
TCGA BRCA -0.102; TCGA CESC -0.104; TCGA HNSC -0.149; TCGA KIRC -0.066; TCGA KIRP -0.107; TCGA LGG -0.132; TCGA LIHC -0.071; TCGA LUAD -0.058; TCGA LUSC -0.252; TCGA PRAD -0.073; TCGA SARC -0.072
hsa-miR-146b-5p
FOXP2
13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.233; TCGA CESC -0.549; TCGA ESCA -0.537; TCGA HNSC -0.898; TCGA KIRC -0.185; TCGA LGG -0.263; TCGA LUAD -0.165; TCGA LUSC -0.312; TCGA PRAD -0.481; TCGA SARC -0.254; TCGA THCA -0.427; TCGA STAD -0.781; TCGA UCEC -0.576
hsa-miR-146b-5p
ZBED3
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BRCA -0.175; TCGA COAD -0.176; TCGA ESCA -0.287; TCGA HNSC -0.185; TCGA KIRC -0.148; TCGA KIRP -0.132; TCGA LGG -0.242; TCGA LIHC -0.105; TCGA LUAD -0.118; TCGA PAAD -0.156; TCGA PRAD -0.193; TCGA SARC -0.271; TCGA THCA -0.109
hsa-miR-146b-5p
CLOCK
13 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.236; TCGA ESCA -0.204; TCGA HNSC -0.242; TCGA KIRC -0.101; TCGA KIRP -0.217; TCGA LIHC -0.185; TCGA LUAD -0.07; TCGA LUSC -0.098; TCGA PRAD -0.21; TCGA SARC -0.148; TCGA THCA -0.062; TCGA STAD -0.075; TCGA UCEC -0.083
hsa-miR-146b-5p
TMEM132B
11 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.201; TCGA COAD -0.291; TCGA ESCA -0.308; TCGA HNSC -0.499; TCGA KIRP -0.146; TCGA LGG -0.151; TCGA LUSC -0.294; TCGA PAAD -0.301; TCGA PRAD -0.161; TCGA THCA -0.167; TCGA STAD -0.496
hsa-miR-146b-5p
SLC2A13
11 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; OV; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.144; TCGA CESC -0.222; TCGA ESCA -0.171; TCGA KIRC -0.079; TCGA LGG -0.086; TCGA LIHC -0.127; TCGA OV -0.116; TCGA PAAD -0.153; TCGA SARC -0.223; TCGA STAD -0.103; TCGA UCEC -0.158
hsa-miR-146b-5p
MGAT5
12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BRCA -0.205; TCGA CESC -0.264; TCGA ESCA -0.265; TCGA HNSC -0.323; TCGA KIRC -0.258; TCGA KIRP -0.328; TCGA LGG -0.091; TCGA LIHC -0.198; TCGA LUSC -0.257; TCGA PRAD -0.248; TCGA SARC -0.231; TCGA UCEC -0.15
hsa-miR-146b-5p
AP3S2
9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LUAD; PAAD; PRAD; SARC
mirMAP
TCGA BRCA -0.146; TCGA CESC -0.07; TCGA ESCA -0.151; TCGA KIRC -0.079; TCGA LGG -0.051; TCGA LUAD -0.063; TCGA PAAD -0.141; TCGA PRAD -0.063; TCGA SARC -0.053
hsa-miR-146b-5p
KIAA1958
15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BRCA -0.23; TCGA CESC -0.136; TCGA COAD -0.152; TCGA ESCA -0.238; TCGA HNSC -0.204; TCGA KIRC -0.216; TCGA KIRP -0.222; TCGA LGG -0.187; TCGA LIHC -0.091; TCGA LUAD -0.118; TCGA LUSC -0.233; TCGA PAAD -0.326; TCGA PRAD -0.122; TCGA SARC -0.247; TCGA THCA -0.066
hsa-miR-146b-5p
SGCD
9 cancers: BRCA; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.277; TCGA KIRP -0.176; TCGA LGG -0.271; TCGA LIHC -0.165; TCGA PRAD -0.176; TCGA SARC -0.256; TCGA THCA -0.365; TCGA STAD -0.367; TCGA UCEC -0.63
hsa-miR-146b-5p
PYGO1
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.27; TCGA HNSC -0.398; TCGA KIRC -0.178; TCGA KIRP -0.341; TCGA LGG -0.339; TCGA LUAD -0.127; TCGA OV -0.22; TCGA PRAD -0.415; TCGA THCA -0.142; TCGA STAD -0.489
hsa-miR-146b-5p
ZHX3
16 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.193; TCGA CESC -0.093; TCGA COAD -0.152; TCGA ESCA -0.196; TCGA HNSC -0.148; TCGA KIRC -0.218; TCGA KIRP -0.105; TCGA LGG -0.091; TCGA LIHC -0.06; TCGA LUAD -0.076; TCGA PAAD -0.145; TCGA PRAD -0.055; TCGA SARC -0.158; TCGA THCA -0.108; TCGA STAD -0.271; TCGA UCEC -0.104
hsa-miR-146b-5p
CSRNP3
12 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.175; TCGA ESCA -0.337; TCGA HNSC -0.512; TCGA KIRC -0.269; TCGA KIRP -0.209; TCGA LGG -0.251; TCGA LUAD -0.309; TCGA LUSC -0.265; TCGA PRAD -0.388; TCGA THCA -0.057; TCGA STAD -0.472; TCGA UCEC -0.215
hsa-miR-146b-5p
CUEDC1
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.118; TCGA CESC -0.249; TCGA COAD -0.138; TCGA ESCA -0.264; TCGA HNSC -0.089; TCGA KIRC -0.159; TCGA KIRP -0.053; TCGA LGG -0.107; TCGA LUSC -0.091; TCGA PRAD -0.082; TCGA SARC -0.089; TCGA STAD -0.267; TCGA UCEC -0.081
hsa-miR-146b-5p
MXRA7
9 cancers: BRCA; CESC; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.092; TCGA CESC -0.204; TCGA LUSC -0.153; TCGA OV -0.149; TCGA PAAD -0.138; TCGA PRAD -0.202; TCGA SARC -0.162; TCGA STAD -0.465; TCGA UCEC -0.101
hsa-miR-146b-5p
KIAA1671
12 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
mirMAP
TCGA BRCA -0.091; TCGA CESC -0.116; TCGA ESCA -0.231; TCGA HNSC -0.288; TCGA LGG -0.082; TCGA LIHC -0.1; TCGA LUAD -0.178; TCGA LUSC -0.196; TCGA PAAD -0.156; TCGA PRAD -0.144; TCGA SARC -0.221; TCGA UCEC -0.06
hsa-miR-146b-5p
MAN1A2
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BRCA -0.172; TCGA CESC -0.102; TCGA HNSC -0.197; TCGA KIRC -0.085; TCGA KIRP -0.148; TCGA LIHC -0.119; TCGA LUAD -0.15; TCGA LUSC -0.148; TCGA PRAD -0.132; TCGA SARC -0.134; TCGA UCEC -0.094
hsa-miR-146b-5p
ZFYVE1
9 cancers: BRCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.166; TCGA KIRC -0.14; TCGA KIRP -0.078; TCGA LUAD -0.052; TCGA LUSC -0.068; TCGA PRAD -0.065; TCGA SARC -0.08; TCGA STAD -0.161; TCGA UCEC -0.068
hsa-miR-146b-5p
RNF169
9 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; UCEC
miRNATAP
TCGA BRCA -0.142; TCGA HNSC -0.213; TCGA KIRP -0.12; TCGA LGG -0.133; TCGA LIHC -0.096; TCGA LUAD -0.07; TCGA PRAD -0.135; TCGA SARC -0.156; TCGA UCEC -0.108
hsa-miR-146b-5p
MED13
9 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC
miRNATAP
TCGA BRCA -0.187; TCGA CESC -0.074; TCGA COAD -0.096; TCGA HNSC -0.121; TCGA KIRC -0.062; TCGA KIRP -0.11; TCGA LGG -0.166; TCGA LIHC -0.05; TCGA LUSC -0.134
hsa-miR-146b-5p
PDZRN3
10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.082; TCGA COAD -0.225; TCGA KIRC -0.356; TCGA KIRP -0.189; TCGA LGG -0.058; TCGA LUAD -0.128; TCGA PRAD -0.085; TCGA SARC -0.4; TCGA STAD -0.649; TCGA UCEC -0.357
hsa-miR-146b-5p
WASF2
10 cancers: BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.059; TCGA CESC -0.09; TCGA HNSC -0.189; TCGA KIRP -0.052; TCGA LUAD -0.08; TCGA LUSC -0.111; TCGA PRAD -0.106; TCGA SARC -0.076; TCGA STAD -0.111; TCGA UCEC -0.09
hsa-miR-146b-5p
SVIL
11 cancers: CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA CESC -0.168; TCGA COAD -0.238; TCGA ESCA -0.154; TCGA HNSC -0.239; TCGA KIRP -0.135; TCGA LIHC -0.158; TCGA LUSC -0.158; TCGA PRAD -0.273; TCGA SARC -0.431; TCGA STAD -0.528; TCGA UCEC -0.186
hsa-miR-146b-5p
HMGCS1
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; THCA
miRanda
TCGA CESC -0.257; TCGA HNSC -0.217; TCGA KIRC -0.096; TCGA KIRP -0.06; TCGA LGG -0.1; TCGA LUAD -0.121; TCGA LUSC -0.181; TCGA OV -0.108; TCGA PRAD -0.145; TCGA THCA -0.099
hsa-miR-146b-5p
UBAP2
10 cancers: CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA
miRanda
TCGA CESC -0.068; TCGA COAD -0.098; TCGA ESCA -0.101; TCGA KIRC -0.079; TCGA LGG -0.177; TCGA LUAD -0.073; TCGA LUSC -0.089; TCGA PAAD -0.107; TCGA SARC -0.061; TCGA THCA -0.055
hsa-miR-146b-5p
ADCY2
13 cancers: CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA CESC -0.349; TCGA ESCA -0.477; TCGA HNSC -0.281; TCGA LGG -0.251; TCGA LUAD -0.279; TCGA LUSC -0.32; TCGA OV -0.531; TCGA PAAD -0.385; TCGA PRAD -0.189; TCGA SARC -0.717; TCGA THCA -0.067; TCGA STAD -0.625; TCGA UCEC -0.461
hsa-miR-146b-5p
PTGFR
9 cancers: CESC; HNSC; KIRP; LGG; LIHC; PRAD; THCA; STAD; UCEC
miRanda
TCGA CESC -0.295; TCGA HNSC -0.225; TCGA KIRP -0.269; TCGA LGG -0.141; TCGA LIHC -0.333; TCGA PRAD -0.266; TCGA THCA -0.102; TCGA STAD -0.221; TCGA UCEC -0.65
hsa-miR-146b-5p
CERK
10 cancers: CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA CESC -0.109; TCGA ESCA -0.173; TCGA HNSC -0.166; TCGA KIRP -0.061; TCGA LUAD -0.122; TCGA LUSC -0.116; TCGA OV -0.109; TCGA PAAD -0.114; TCGA STAD -0.213; TCGA UCEC -0.099
hsa-miR-146b-5p
POLDIP3
10 cancers: CESC; ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA CESC -0.051; TCGA ESCA -0.083; TCGA KIRC -0.087; TCGA KIRP -0.057; TCGA LGG -0.158; TCGA LUSC -0.081; TCGA OV -0.061; TCGA PAAD -0.063; TCGA STAD -0.06; TCGA UCEC -0.056
hsa-miR-146b-5p
PLEKHH2
9 cancers: CESC; COAD; HNSC; KIRC; LIHC; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA CESC -0.476; TCGA COAD -0.304; TCGA HNSC -0.152; TCGA KIRC -0.152; TCGA LIHC -0.146; TCGA SARC -0.277; TCGA THCA -0.056; TCGA STAD -0.267; TCGA UCEC -0.318
hsa-miR-146b-5p
CRY1
9 cancers: CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; SARC; THCA
miRanda; miRNATAP
TCGA CESC -0.107; TCGA ESCA -0.123; TCGA HNSC -0.071; TCGA KIRC -0.091; TCGA LGG -0.057; TCGA LIHC -0.071; TCGA LUAD -0.112; TCGA SARC -0.089; TCGA THCA -0.068
hsa-miR-146b-5p
ZNF644
9 cancers: CESC; HNSC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA
miRanda
TCGA CESC -0.071; TCGA HNSC -0.068; TCGA KIRP -0.062; TCGA LGG -0.053; TCGA LIHC -0.051; TCGA LUAD -0.054; TCGA PRAD -0.06; TCGA SARC -0.096; TCGA THCA -0.052
hsa-miR-146b-5p
BVES
9 cancers: CESC; KIRC; KIRP; LUAD; OV; PRAD; SARC; THCA; STAD
miRanda
TCGA CESC -0.312; TCGA KIRC -0.166; TCGA KIRP -0.194; TCGA LUAD -0.165; TCGA OV -0.217; TCGA PRAD -0.316; TCGA SARC -0.339; TCGA THCA -0.197; TCGA STAD -0.68
hsa-miR-146b-5p
PPP2R5C
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; STAD
miRanda
TCGA CESC -0.084; TCGA HNSC -0.072; TCGA KIRC -0.061; TCGA KIRP -0.07; TCGA LGG -0.105; TCGA LUSC -0.069; TCGA OV -0.059; TCGA PAAD -0.071; TCGA PRAD -0.052; TCGA STAD -0.073
hsa-miR-146b-5p
SOBP
10 cancers: CESC; ESCA; KIRC; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA CESC -0.379; TCGA ESCA -0.325; TCGA KIRC -0.099; TCGA LGG -0.098; TCGA LUAD -0.191; TCGA OV -0.122; TCGA PAAD -0.161; TCGA PRAD -0.142; TCGA STAD -0.519; TCGA UCEC -0.317
hsa-miR-146b-5p
LARP6
9 cancers: CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; STAD
miRanda
TCGA CESC -0.373; TCGA COAD -0.387; TCGA KIRC -0.088; TCGA KIRP -0.12; TCGA LIHC -0.254; TCGA LUAD -0.205; TCGA LUSC -0.151; TCGA OV -0.093; TCGA STAD -0.534
hsa-miR-146b-5p
KIAA1161
11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA CESC -0.202; TCGA ESCA -0.423; TCGA HNSC -0.122; TCGA KIRC -0.286; TCGA KIRP -0.165; TCGA LGG -0.197; TCGA LUAD -0.096; TCGA LUSC -0.17; TCGA PRAD -0.306; TCGA SARC -0.311; TCGA STAD -0.199
hsa-miR-146b-5p
KLF7
9 cancers: COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA COAD -0.272; TCGA KIRC -0.068; TCGA KIRP -0.224; TCGA LGG -0.086; TCGA LUAD -0.139; TCGA PRAD -0.174; TCGA SARC -0.177; TCGA STAD -0.27; TCGA UCEC -0.119
hsa-miR-146b-5p
FHOD3
11 cancers: COAD; KIRC; KIRP; LGG; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA COAD -0.441; TCGA KIRC -0.117; TCGA KIRP -0.103; TCGA LGG -0.06; TCGA LIHC -0.167; TCGA OV -0.196; TCGA PRAD -0.255; TCGA SARC -0.423; TCGA THCA -0.265; TCGA STAD -0.374; TCGA UCEC -0.209
hsa-miR-146b-5p
MED20
10 cancers: COAD; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA
miRanda
TCGA COAD -0.078; TCGA KIRC -0.112; TCGA KIRP -0.059; TCGA LGG -0.123; TCGA LUAD -0.086; TCGA LUSC -0.19; TCGA OV -0.075; TCGA PAAD -0.058; TCGA PRAD -0.051; TCGA THCA -0.089
hsa-miR-146b-5p
MED14
9 cancers: COAD; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC
miRanda
TCGA COAD -0.131; TCGA HNSC -0.093; TCGA KIRP -0.087; TCGA LGG -0.094; TCGA LIHC -0.093; TCGA LUSC -0.063; TCGA PAAD -0.078; TCGA PRAD -0.053; TCGA SARC -0.059
hsa-miR-146b-5p
KREMEN1
9 cancers: COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA COAD -0.163; TCGA HNSC -0.243; TCGA KIRC -0.136; TCGA KIRP -0.182; TCGA LUAD -0.103; TCGA LUSC -0.294; TCGA PRAD -0.166; TCGA STAD -0.144; TCGA UCEC -0.142
hsa-miR-146b-5p
NOS1
9 cancers: COAD; ESCA; HNSC; KIRC; KIRP; OV; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA COAD -0.795; TCGA ESCA -0.692; TCGA HNSC -0.74; TCGA KIRC -0.657; TCGA KIRP -0.415; TCGA OV -0.249; TCGA PRAD -0.646; TCGA THCA -0.32; TCGA STAD -1.065
hsa-miR-146b-5p
USP2
10 cancers: ESCA; HNSC; KIRC; KIRP; LIHC; OV; PRAD; SARC; THCA; STAD
miRanda
TCGA ESCA -0.282; TCGA HNSC -0.185; TCGA KIRC -0.43; TCGA KIRP -0.148; TCGA LIHC -0.138; TCGA OV -0.148; TCGA PRAD -0.131; TCGA SARC -0.203; TCGA THCA -0.197; TCGA STAD -0.675
hsa-miR-146b-5p
COX10
9 cancers: ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA
miRanda
TCGA ESCA -0.109; TCGA HNSC -0.062; TCGA KIRC -0.08; TCGA LIHC -0.088; TCGA LUAD -0.11; TCGA LUSC -0.074; TCGA PAAD -0.153; TCGA SARC -0.133; TCGA THCA -0.099
hsa-miR-146b-5p
PTPRZ1
9 cancers: ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; STAD
miRanda
TCGA ESCA -0.667; TCGA KIRC -0.166; TCGA KIRP -0.23; TCGA LGG -0.183; TCGA LUSC -0.714; TCGA OV -0.23; TCGA PAAD -0.365; TCGA PRAD -0.311; TCGA STAD -0.795
hsa-miR-146b-5p
B3GALNT2
10 cancers: ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA ESCA -0.135; TCGA HNSC -0.131; TCGA KIRP -0.078; TCGA LUAD -0.092; TCGA LUSC -0.22; TCGA PAAD -0.111; TCGA SARC -0.202; TCGA THCA -0.107; TCGA STAD -0.097; TCGA UCEC -0.059
hsa-miR-146b-5p
NPR3
10 cancers: HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA HNSC -0.591; TCGA KIRC -0.371; TCGA KIRP -0.334; TCGA LIHC -0.328; TCGA LUAD -0.327; TCGA OV -0.245; TCGA PRAD -0.182; TCGA THCA -0.372; TCGA STAD -0.552; TCGA UCEC -0.288
hsa-miR-146b-5p
ARHGEF4
10 cancers: HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
miRanda
TCGA HNSC -0.175; TCGA KIRP -0.21; TCGA LIHC -0.268; TCGA LUAD -0.193; TCGA LUSC -0.297; TCGA OV -0.124; TCGA PRAD -0.197; TCGA SARC -0.437; TCGA THCA -0.134; TCGA STAD -0.73
hsa-miR-146b-5p
ST6GAL2
11 cancers: HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
miRanda
TCGA HNSC -0.486; TCGA KIRP -0.24; TCGA LGG -0.356; TCGA LIHC -0.308; TCGA LUAD -0.324; TCGA LUSC -0.303; TCGA OV -0.237; TCGA PRAD -0.274; TCGA SARC -0.311; TCGA THCA -0.053; TCGA STAD -0.376
hsa-miR-146b-5p
RNF150
10 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; THCA; STAD
miRanda
TCGA HNSC -0.229; TCGA KIRC -0.672; TCGA KIRP -0.38; TCGA LGG -0.317; TCGA LIHC -0.165; TCGA LUAD -0.41; TCGA PRAD -0.266; TCGA SARC -0.436; TCGA THCA -0.375; TCGA STAD -0.603
hsa-miR-146b-5p
CNTFR
9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; STAD
miRNATAP
TCGA HNSC -0.297; TCGA KIRC -0.404; TCGA KIRP -0.239; TCGA LGG -0.252; TCGA LIHC -0.265; TCGA PRAD -0.397; TCGA SARC -0.415; TCGA THCA -0.513; TCGA STAD -1.038
hsa-miR-146b-5p
EGFR
9 cancers: HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA HNSC -0.205; TCGA KIRP -0.145; TCGA LGG -0.183; TCGA LIHC -0.221; TCGA LUSC -0.261; TCGA PRAD -0.213; TCGA SARC -0.126; TCGA STAD -0.184; TCGA UCEC -0.176
hsa-miR-146b-5p
AKT3
9 cancers: KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA KIRC -0.106; TCGA KIRP -0.112; TCGA LGG -0.149; TCGA LIHC -0.16; TCGA LUAD -0.145; TCGA PRAD -0.151; TCGA SARC -0.231; TCGA STAD -0.255; TCGA UCEC -0.286
hsa-miR-146b-5p
SMOC1
10 cancers: KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA KIRC -0.344; TCGA LGG -0.692; TCGA LUAD -0.739; TCGA LUSC -0.315; TCGA PAAD -0.63; TCGA PRAD -0.438; TCGA SARC -0.359; TCGA THCA -0.159; TCGA STAD -0.466; TCGA UCEC -0.354





Enriched cancer pathways of putative targets