microRNA information: hsa-miR-147a
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-147a | miRbase |
Accession: | MIMAT0000251 | miRbase |
Precursor name: | hsa-mir-147a | miRbase |
Precursor accession: | MI0000262 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | GUGUGUGGAAAUGCUUCUGC |
Reported expression in cancers: hsa-miR-147a
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-147a | B cell lymphoma | deregulation | "Importantly decreased expression of miR-138-5p and ......" | 24914240 | |
hsa-miR-147a | gastric cancer | deregulation | "The results from the miRNA microarray analysis wer ......" | 21475928 | qPCR; Microarray |
hsa-miR-147a | lung squamous cell cancer | downregulation | "Methods Quantitative real-time PCR qRT-PCR was use ......" | 26581116 | qPCR |
Reported cancer pathway affected by hsa-miR-147a
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-147a | breast cancer | cell cycle pathway | "Finally our approach led us to identify and valida ......" | 22333974 | |
hsa-miR-147a | breast cancer | cell cycle pathway; mTOR signaling pathway | "A previous study reported that miR-147 targets the ......" | 26870225 |
Reported cancer prognosis affected by hsa-miR-147a
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-147a | breast cancer | progression | "Finally our approach led us to identify and valida ......" | 22333974 | |
hsa-miR-147a | liver cancer | recurrence | "18 miRNAs including 6 up-regulated and 12 down-reg ......" | 22552153 | |
hsa-miR-147a | lung squamous cell cancer | poor survival; drug resistance | "miRNA microarray profiling was performed on diagno ......" | 20548249 | |
hsa-miR-147a | lung squamous cell cancer | worse prognosis; staging; metastasis; tumor size; poor survival | "Objectives In this study we intended to examine th ......" | 26581116 |
Reported gene related to hsa-miR-147a
miRNA | cancer | gene | reporting | PUBMED |
---|