microRNA information: hsa-miR-148a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-148a-3p | miRbase |
| Accession: | MIMAT0000243 | miRbase |
| Precursor name: | hsa-mir-148a | miRbase |
| Precursor accession: | MI0000253 | miRbase |
| Symbol: | MIR148A | HGNC |
| RefSeq ID: | NR_029597 | GenBank |
| Sequence: | UCAGUGCACUACAGAACUUUGU |
Reported expression in cancers: hsa-miR-148a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-148a-3p | bladder cancer | downregulation | "MicroRNA 148a represents an independent prognostic ......" | 26700670 | qPCR |
| hsa-miR-148a-3p | breast cancer | downregulation | "MicroRNA 148a inhibits breast cancer migration and ......" | 26707142 | |
| hsa-miR-148a-3p | colorectal cancer | upregulation | "High expression of miR-27b miR-148a and miR-326 we ......" | 24119443 | |
| hsa-miR-148a-3p | colorectal cancer | upregulation | "Signature miRNAs in colorectal cancers were reveal ......" | 26646696 | RNA-Seq |
| hsa-miR-148a-3p | gastric cancer | downregulation | "Our previous studies have revealed that miR-148a a ......" | 21205300 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "Herein we identified the role of miR-148a in gastr ......" | 21552422 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "In this study we investigate the role of miR-148a ......" | 21994419 | qPCR |
| hsa-miR-148a-3p | gastric cancer | downregulation | "MicroRNA 148a is silenced by hypermethylation and ......" | 22167392 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "microRNA 148a suppresses human gastric cancer cell ......" | 23873106 | qPCR |
| hsa-miR-148a-3p | gastric cancer | downregulation | "To identify miRNAs that are associated with some c ......" | 24283384 | Microarray; qPCR |
| hsa-miR-148a-3p | gastric cancer | downregulation | "The role of miR 148a in gastric cancer. MiR-148a i ......" | 24659367 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "MiR-375 and miR-148a were found downregulated in s ......" | 24902858 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "Expression level of miR-148a was detected by qRT-P ......" | 25341915 | qPCR |
| hsa-miR-148a-3p | gastric cancer | downregulation | "Using Limma package in R a total of 27 differentia ......" | 26692821 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "In this research we demonstrated that miR-148a exp ......" | 27518872 | |
| hsa-miR-148a-3p | gastric cancer | downregulation | "Expression and prognostic value of microRNA 26a an ......" | 27529338 | Reverse transcription PCR; qPCR |
| hsa-miR-148a-3p | liver cancer | downregulation | "Decreased expression and clinical significance of ......" | 25444499 | qPCR |
| hsa-miR-148a-3p | liver cancer | downregulation | "Decrease expression and clinicopathological signif ......" | 26248880 | qPCR |
| hsa-miR-148a-3p | liver cancer | downregulation | "Differentiation therapy for hepatocellular carcino ......" | 26599259 | |
| hsa-miR-148a-3p | lung squamous cell cancer | downregulation | "We found that miR-148a is significantly downregula ......" | 23670799 | |
| hsa-miR-148a-3p | lung squamous cell cancer | downregulation | "Serum miR 152 miR 148a miR 148b and miR 21 as nove ......" | 25501703 | qPCR |
| hsa-miR-148a-3p | lung squamous cell cancer | downregulation | "MicroRNA 148a Suppresses Invasion and Metastasis o ......" | 26584284 | Reverse transcription PCR |
| hsa-miR-148a-3p | ovarian cancer | deregulation | "Suppressive Role of MicroRNA 148a in Cell Prolifer ......" | 27712592 | |
| hsa-miR-148a-3p | pancreatic cancer | downregulation | "Our previous studies have revealed that miR-148a i ......" | 23975374 | qPCR |
| hsa-miR-148a-3p | pancreatic cancer | downregulation | "miR 148a and miR 216a regulated oncolytic adenovir ......" | 24895996 | |
| hsa-miR-148a-3p | prostate cancer | downregulation | "It has been recently reported that miR-148a expres ......" | 20406806 | |
| hsa-miR-148a-3p | sarcoma | upregulation | "The expression levels of circulating miR-148a were ......" | 25185654 | qPCR |
| hsa-miR-148a-3p | sarcoma | downregulation | "MATERIAL AND METHODS According to the qRT-PCR anal ......" | 26638007 | qPCR |
Reported cancer pathway affected by hsa-miR-148a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-148a-3p | bladder cancer | Apoptosis pathway | "miR 148a dependent apoptosis of bladder cancer cel ......" | 25865490 | |
| hsa-miR-148a-3p | bladder cancer | Apoptosis pathway | "MicroRNA 148a represents an independent prognostic ......" | 26700670 | |
| hsa-miR-148a-3p | breast cancer | Apoptosis pathway | "Based on the results obtained in the last decade s ......" | 26199650 | |
| hsa-miR-148a-3p | chordoma | cell cycle pathway; Apoptosis pathway | "The mRNA level of predicted and confirmed targets ......" | 27016303 | |
| hsa-miR-148a-3p | colorectal cancer | Apoptosis pathway | "MiR 148a promotes apoptosis by targeting Bcl 2 in ......" | 21455217 | |
| hsa-miR-148a-3p | gastric cancer | cell cycle pathway | "miR 148a promoted cell proliferation by targeting ......" | 21552422 | |
| hsa-miR-148a-3p | gastric cancer | Apoptosis pathway | "MicroRNA 148a is silenced by hypermethylation and ......" | 22167392 | Western blot |
| hsa-miR-148a-3p | gastric cancer | Epithelial mesenchymal transition pathway | "microRNA 148a suppresses human gastric cancer cell ......" | 23873106 | Western blot; Luciferase |
| hsa-miR-148a-3p | gastric cancer | Apoptosis pathway | "Expression and prognostic value of microRNA 26a an ......" | 27529338 | Colony formation |
| hsa-miR-148a-3p | glioblastoma | Apoptosis pathway | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 | |
| hsa-miR-148a-3p | liver cancer | cell cycle pathway | "Role of miR 148a in hepatitis B associated hepatoc ......" | 22496917 | Colony formation |
| hsa-miR-148a-3p | liver cancer | Wnt signaling pathway | "Inhibitions of epithelial to mesenchymal transitio ......" | 23861222 | |
| hsa-miR-148a-3p | ovarian cancer | Apoptosis pathway | "MicroRNA 148a inhibits the proliferation and promo ......" | 26004124 | Western blot; Luciferase |
| hsa-miR-148a-3p | pancreatic cancer | Apoptosis pathway | "MiR 148a regulates the growth and apoptosis in pan ......" | 23975374 | Colony formation; MTT assay; Western blot; Luciferase |
| hsa-miR-148a-3p | prostate cancer | Apoptosis pathway | "Seven miRNAs miR-21 miR-32 miR-99a miR-99b miR-148 ......" | 22266859 | Western blot; Luciferase |
| hsa-miR-148a-3p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-148a-3p | sarcoma | Apoptosis pathway | "Increased miR 155 5p and reduced miR 148a 3p contr ......" | 27041566 |
Reported cancer prognosis affected by hsa-miR-148a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-148a-3p | bladder cancer | worse prognosis; poor survival; metastasis; recurrence | "MicroRNA 148a represents an independent prognostic ......" | 26700670 | |
| hsa-miR-148a-3p | breast cancer | differentiation | "In order to identify which miRNAs are involved in ......" | 22562546 | |
| hsa-miR-148a-3p | breast cancer | staging | "Global miRNA analysis was performed on prospective ......" | 25004125 | |
| hsa-miR-148a-3p | breast cancer | immune evasion | "GPER mediated estradiol reduces miR 148a to promot ......" | 25063027 | |
| hsa-miR-148a-3p | breast cancer | metastasis; worse prognosis | "Based on the results obtained in the last decade s ......" | 26199650 | |
| hsa-miR-148a-3p | breast cancer | metastasis | "MicroRNA 148a inhibits migration of breast cancer ......" | 26298724 | Western blot; Luciferase |
| hsa-miR-148a-3p | breast cancer | metastasis | "MicroRNA 148a inhibits breast cancer migration and ......" | 26707142 | |
| hsa-miR-148a-3p | breast cancer | metastasis; worse prognosis | "MiR 148a functions to suppress metastasis and serv ......" | 26967387 | |
| hsa-miR-148a-3p | chordoma | progression; differentiation | "The mRNA level of predicted and confirmed targets ......" | 27016303 | |
| hsa-miR-148a-3p | colon cancer | recurrence | "Groups of five patients with and without disease r ......" | 24400111 | |
| hsa-miR-148a-3p | colorectal cancer | poor survival; progression | "The aim of this study was to investigate the hyper ......" | 21610744 | |
| hsa-miR-148a-3p | colorectal cancer | worse prognosis | "This article evaluates a recently published study ......" | 21902530 | |
| hsa-miR-148a-3p | colorectal cancer | staging; poor survival; drug resistance | "The clinical significance of MiR 148a as a predict ......" | 23056401 | |
| hsa-miR-148a-3p | colorectal cancer | recurrence | "TaqMan® Human MicroRNA Array Set v2.0 was used to ......" | 23280316 | |
| hsa-miR-148a-3p | colorectal cancer | staging | "Clinical significance of microRNA 148a in patients ......" | 23933284 | |
| hsa-miR-148a-3p | colorectal cancer | progression; poor survival | "High expression of miR-27b miR-148a and miR-326 we ......" | 24119443 | |
| hsa-miR-148a-3p | colorectal cancer | tumorigenesis; staging; progression | "Significance of miR 148a in Colorectal Neoplasia: ......" | 26389729 | |
| hsa-miR-148a-3p | esophageal cancer | differentiation; recurrence | "The expression of miR-21 miR-106a miR-148a miR-205 ......" | 20628822 | |
| hsa-miR-148a-3p | gastric cancer | metastasis | "Differential expression of miRNAs was studied usin ......" | 20726036 | |
| hsa-miR-148a-3p | gastric cancer | progression; staging | "miR 148a promoted cell proliferation by targeting ......" | 21552422 | |
| hsa-miR-148a-3p | gastric cancer | metastasis; poor survival | "The function of a specific miRNA miR-148a was furt ......" | 21703006 | |
| hsa-miR-148a-3p | gastric cancer | metastasis; staging; cell migration; progression | "MicroRNA 148a suppresses tumor cell invasion and m ......" | 21994419 | Luciferase |
| hsa-miR-148a-3p | gastric cancer | metastasis; staging | "In a pilot study serum levels of miR-21 miR-27a mi ......" | 23806809 | |
| hsa-miR-148a-3p | gastric cancer | progression | "Quantitative proteomics reveals diverse roles of m ......" | 23869555 | |
| hsa-miR-148a-3p | gastric cancer | metastasis; staging; worse prognosis | "microRNA 148a suppresses human gastric cancer cell ......" | 23873106 | Western blot; Luciferase |
| hsa-miR-148a-3p | gastric cancer | worse prognosis; progression; staging; metastasis | "MicroRNA 148a is downregulated in gastric cancer t ......" | 24283384 | Western blot |
| hsa-miR-148a-3p | gastric cancer | tumorigenesis | "MiR 148a regulates MEG3 in gastric cancer by targe ......" | 24515776 | |
| hsa-miR-148a-3p | gastric cancer | metastasis | "The role of miR 148a in gastric cancer; MiR-148a i ......" | 24659367 | |
| hsa-miR-148a-3p | gastric cancer | staging; metastasis | "Impact of miR 148a on the proliferation of gastric ......" | 25341915 | Western blot |
| hsa-miR-148a-3p | gastric cancer | worse prognosis | "A genetic variant of miR 148a binding site in the ......" | 25399950 | Luciferase |
| hsa-miR-148a-3p | gastric cancer | staging | "In the second stage differentially expressed miRNA ......" | 26172537 | |
| hsa-miR-148a-3p | gastric cancer | staging; metastasis | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | |
| hsa-miR-148a-3p | gastric cancer | metastasis; tumorigenesis | "MiR 148a Functions as a Tumor Suppressor by Target ......" | 27518872 | Western blot; Luciferase |
| hsa-miR-148a-3p | glioblastoma | poor survival | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 | |
| hsa-miR-148a-3p | glioblastoma | poor survival | "Inhibition of two "risky" miRNAs miR-148a and miR- ......" | 25903473 | |
| hsa-miR-148a-3p | liver cancer | metastasis | "Identification of metastasis related microRNAs of ......" | 19912688 | |
| hsa-miR-148a-3p | liver cancer | progression; cell migration | "Role of miR 148a in hepatitis B associated hepatoc ......" | 22496917 | Colony formation |
| hsa-miR-148a-3p | liver cancer | metastasis; differentiation | "Inhibitions of epithelial to mesenchymal transitio ......" | 23861222 | |
| hsa-miR-148a-3p | liver cancer | worse prognosis; poor survival; recurrence; progression | "microRNA 148a dysregulation discriminates poor pro ......" | 24798342 | |
| hsa-miR-148a-3p | liver cancer | staging; metastasis; tumorigenesis; worse prognosis | "Decreased expression and clinical significance of ......" | 25444499 | |
| hsa-miR-148a-3p | liver cancer | poor survival; staging; metastasis; recurrence; tumorigenesis | "Decrease expression and clinicopathological signif ......" | 26248880 | |
| hsa-miR-148a-3p | liver cancer | metastasis | "After transfection of the HepG2 and SMMC‑7721 HC ......" | 26530325 | Western blot; MTT assay; Luciferase |
| hsa-miR-148a-3p | liver cancer | differentiation; progression | "Differentiation therapy for hepatocellular carcino ......" | 26599259 | |
| hsa-miR-148a-3p | lung squamous cell cancer | metastasis | "MicroRNA 148a suppresses epithelial to mesenchymal ......" | 23670799 | Luciferase |
| hsa-miR-148a-3p | lung squamous cell cancer | metastasis; malignant trasformation; staging | "MicroRNA 148a Suppresses Invasion and Metastasis o ......" | 26584284 | |
| hsa-miR-148a-3p | lung squamous cell cancer | staging | "The aim of this study was to determine whether cir ......" | 27461630 | |
| hsa-miR-148a-3p | ovarian cancer | poor survival; drug resistance; tumorigenesis | "Altered expression of miR 152 and miR 148a in ovar ......" | 21971665 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-miR-148a-3p | ovarian cancer | progression; poor survival | "By analyzing multidimensional datasets of ovarian ......" | 25537514 | |
| hsa-miR-148a-3p | ovarian cancer | cell migration | "MicroRNA 148a inhibits migration and invasion of o ......" | 26004261 | Western blot; Luciferase; Transwell assay |
| hsa-miR-148a-3p | ovarian cancer | metastasis; worse prognosis; progression; poor survival | "Decreased expression of microRNA 148a predicts poo ......" | 27470550 | |
| hsa-miR-148a-3p | pancreatic cancer | staging; differentiation | "Expressions of miRNAs were determined with the Taq ......" | 22851141 | |
| hsa-miR-148a-3p | pancreatic cancer | staging | "miR 148a and miR 216a regulated oncolytic adenovir ......" | 24895996 | |
| hsa-miR-148a-3p | pancreatic cancer | metastasis; tumorigenesis | "The Interplay Between miR 148a and DNMT1 Might be ......" | 25950085 | |
| hsa-miR-148a-3p | pancreatic cancer | tumorigenesis | "MicroRNA 148a Suppresses the Proliferation and Mig ......" | 27518467 | Cell migration assay |
| hsa-miR-148a-3p | prostate cancer | drug resistance; cell migration | "MiR 148a attenuates paclitaxel resistance of hormo ......" | 20406806 | Luciferase |
| hsa-miR-148a-3p | prostate cancer | drug resistance | "To screen for epigenetically silenced miRNAs in pr ......" | 22310291 | |
| hsa-miR-148a-3p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-148a-3p | prostate cancer | staging; drug resistance | "Following global miRNA profiling of cell line mode ......" | 25053345 | |
| hsa-miR-148a-3p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-148a-3p | sarcoma | worse prognosis; metastasis; tumor size; poor survival; progression | "Circulating miR 148a is a significant diagnostic a ......" | 25185654 | |
| hsa-miR-148a-3p | sarcoma | differentiation | "Bufalin Inhibits the Differentiation and Prolifera ......" | 26111756 | |
| hsa-miR-148a-3p | sarcoma | metastasis; worse prognosis; differentiation | "Down Regulation of miR 148a Promotes Metastasis by ......" | 26638007 | Luciferase |
Reported gene related to hsa-miR-148a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-148a-3p | bladder cancer | DNMT1 | "miR 148a dependent apoptosis of bladder cancer cel ......" | 25865490 |
| hsa-miR-148a-3p | gastric cancer | DNMT1 | "Studies have shown that microRNA-148a miR-148a was ......" | 22167392 |
| hsa-miR-148a-3p | pancreatic cancer | DNMT1 | "The Interplay Between miR 148a and DNMT1 Might be ......" | 25950085 |
| hsa-miR-148a-3p | sarcoma | DNMT1 | "Moreover we found that miR-148a appeared to be a t ......" | 26111756 |
| hsa-miR-148a-3p | breast cancer | SMAD2 | "By targeting of the SMAD2-3'-UTR miR-148a blocked ......" | 25980823 |
| hsa-miR-148a-3p | gastric cancer | SMAD2 | "miR 148a downregulates the expression of transform ......" | 26983401 |
| hsa-miR-148a-3p | gastric cancer | SMAD2 | "Finally the SMAD2 gene was identified as the direc ......" | 23873106 |
| hsa-miR-148a-3p | liver cancer | SMAD2 | "MiR-148a which targeted the SMAD2-3'UTR decreased ......" | 24806207 |
| hsa-miR-148a-3p | breast cancer | MMP7 | "The overexpression of miR-148a reduced the mRNA an ......" | 26707142 |
| hsa-miR-148a-3p | colorectal cancer | MMP7 | "To further confirm the direct effect of miR-148a o ......" | 26389729 |
| hsa-miR-148a-3p | gastric cancer | MMP7 | "MicroRNA 148a is downregulated in gastric cancer t ......" | 24283384 |
| hsa-miR-148a-3p | colorectal cancer | BCL2 | "MiR 148a promotes apoptosis by targeting Bcl 2 in ......" | 21455217 |
| hsa-miR-148a-3p | pancreatic cancer | BCL2 | "MiR 148a regulates the growth and apoptosis in pan ......" | 23975374 |
| hsa-miR-148a-3p | gastric cancer | CCKBR | "More importantly siRNA-induced knockdown of CCK-BR ......" | 27518872 |
| hsa-miR-148a-3p | pancreatic cancer | CCKBR | "MiR 148a regulates the growth and apoptosis in pan ......" | 23975374 |
| hsa-miR-148a-3p | breast cancer | GLA | "Here we reported that GLA attenuated the CSC-like ......" | 25980823 |
| hsa-miR-148a-3p | liver cancer | GLA | "Here we found that GLA attenuated the CSCs-like pr ......" | 24806207 |
| hsa-miR-148a-3p | breast cancer | GPER1 | "GPER mediated estradiol reduces miR 148a to promot ......" | 25063027 |
| hsa-miR-148a-3p | breast cancer | GPER1 | "Estradiol induces HOTAIR levels via GPER mediated ......" | 25928008 |
| hsa-miR-148a-3p | breast cancer | HLA-G | "GPER mediated estradiol reduces miR 148a to promot ......" | 25063027 |
| hsa-miR-148a-3p | cervical and endocervical cancer | HLA-G | "Long non coding RNA HOTAIR modulates HLA G express ......" | 27574106 |
| hsa-miR-148a-3p | breast cancer | HOTAIR | "Estradiol induces HOTAIR levels via GPER mediated ......" | 25928008 |
| hsa-miR-148a-3p | cervical and endocervical cancer | HOTAIR | "Long non coding RNA HOTAIR modulates HLA G express ......" | 27574106 |
| hsa-miR-148a-3p | gastric cancer | ROCK1 | "MicroRNA 148a suppresses tumor cell invasion and m ......" | 21994419 |
| hsa-miR-148a-3p | lung squamous cell cancer | ROCK1 | "MicroRNA 148a suppresses epithelial to mesenchymal ......" | 23670799 |
| hsa-miR-148a-3p | breast cancer | WNT1 | "Mechanistically miR-148a appears to suppress the e ......" | 26967387 |
| hsa-miR-148a-3p | liver cancer | WNT1 | "Via TargetScan and microRNA.org algorithms miR-148 ......" | 23861222 |
| hsa-miR-148a-3p | prostate cancer | AR | "We found that androgen receptor is the most freque ......" | 27292025 |
| hsa-miR-148a-3p | glioblastoma | BCL2L11 | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 |
| hsa-miR-148a-3p | liver cancer | CD44 | "In MHCC97H and MHCC97L cells over-expression of mi ......" | 23861222 |
| hsa-miR-148a-3p | gastric cancer | CDC25B | "Gene CDC25B might be the target gene of miR-148a a ......" | 25341915 |
| hsa-miR-148a-3p | gastric cancer | CDH1 | "miR-148a overexpression also downregulated vimenti ......" | 23873106 |
| hsa-miR-148a-3p | esophageal cancer | CYLD | "In EAC miR-148a expression levels were inversely a ......" | 20628822 |
| hsa-miR-148a-3p | acute myeloid leukemia | DNMT3B | "Low ERG expressers presented with down-regulation ......" | 20841507 |
| hsa-miR-148a-3p | gastric cancer | DYNLL1 | "One miRNA miR-148a was identified and its function ......" | 21703006 |
| hsa-miR-148a-3p | glioblastoma | EGFR | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 |
| hsa-miR-148a-3p | pancreatic cancer | ERBB3 | "MicroRNA 148a Suppresses the Proliferation and Mig ......" | 27518467 |
| hsa-miR-148a-3p | acute myeloid leukemia | ERG | "Low ERG expressers presented with down-regulation ......" | 20841507 |
| hsa-miR-148a-3p | breast cancer | ESR1 | "miR-148a plays an important role in regulation of ......" | 25063027 |
| hsa-miR-148a-3p | glioblastoma | GSC | "miR-148a expression was elevated in human glioblas ......" | 24425048 |
| hsa-miR-148a-3p | gastric cancer | MEG3 | "MiR 148a regulates MEG3 in gastric cancer by targe ......" | 24515776 |
| hsa-miR-148a-3p | melanoma | MITF | "miR 148 regulates Mitf in melanoma cells; Furtherm ......" | 20644734 |
| hsa-miR-148a-3p | breast cancer | MMP13 | "MicroRNA 148a inhibits migration of breast cancer ......" | 26298724 |
| hsa-miR-148a-3p | ovarian cancer | MMP9 | "Overexpression of miR-148a caused a significant de ......" | 27712592 |
| hsa-miR-148a-3p | glioblastoma | NFASC | "NF κB induces miR 148a to sustain TGF β/Smad sig ......" | 25971746 |
| hsa-miR-148a-3p | breast cancer | NRP1 | "Mechanistically miR-148a appears to suppress the e ......" | 26967387 |
| hsa-miR-148a-3p | ovarian cancer | PDIA3 | "MicroRNA 148a inhibits the proliferation and promo ......" | 26004124 |
| hsa-miR-148a-3p | gastric cancer | PDYN | "Using bioinformatics tools we selected two SNPs SC ......" | 25399950 |
| hsa-miR-148a-3p | liver cancer | PTEN | "Introduction of anti-miR-148a increased PTEN prote ......" | 22496917 |
| hsa-miR-148a-3p | prostate cancer | RPS6KA5 | "MiR 148a attenuates paclitaxel resistance of hormo ......" | 20406806 |
| hsa-miR-148a-3p | gastric cancer | RUNX3 | "We investigated the role of microRNA-148a miR-148a ......" | 23549984 |
| hsa-miR-148a-3p | liver cancer | S1PR1 | "USP4 and S1P1 were up-regulated in mesenchymal-typ ......" | 24798342 |
| hsa-miR-148a-3p | gastric cancer | SCRN1 | "A genetic variant of miR 148a binding site in the ......" | 25399950 |
| hsa-miR-148a-3p | gastric cancer | SMAD4 | "In GC cell lines we constructed and transfected a ......" | 26983401 |
| hsa-miR-148a-3p | gastric cancer | STAT3 | "Taken together our results suggest that miR-148a s ......" | 27518872 |
| hsa-miR-148a-3p | gastric cancer | TCF3 | "MicroRNA 148a can regulate runt related transcript ......" | 23549984 |
| hsa-miR-148a-3p | breast cancer | TCF7L2 | "The overexpression of miR-148a reduced the mRNA an ......" | 26707142 |
| hsa-miR-148a-3p | sarcoma | TGIF2 | "Down Regulation of miR 148a Promotes Metastasis by ......" | 26638007 |
| hsa-miR-148a-3p | gastric cancer | THBS1 | "Using the TSP algorithm hsa-miR-196a and hsa-miR-1 ......" | 24527072 |
| hsa-miR-148a-3p | liver cancer | THY1 | "In MHCC97H and MHCC97L cells over-expression of mi ......" | 23861222 |
| hsa-miR-148a-3p | liver cancer | USP4 | "microRNA 148a dysregulation discriminates poor pro ......" | 24798342 |
| hsa-miR-148a-3p | gastric cancer | VIM | "miR-148a overexpression also downregulated vimenti ......" | 23873106 |
| hsa-miR-148a-3p | liver cancer | VWCE | "HBx and URG11 also alter the expression of multipl ......" | 22496917 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-148a-3p | ACVR1 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.111; TCGA CESC -0.098; TCGA COAD -0.162; TCGA ESCA -0.137; TCGA HNSC -0.159; TCGA LIHC -0.128; TCGA LUAD -0.058; TCGA LUSC -0.074; TCGA PAAD -0.136; TCGA PRAD -0.176; TCGA SARC -0.092; TCGA THCA -0.314; TCGA STAD -0.106 |
hsa-miR-148a-3p | ADARB1 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; THCA; STAD; UCEC | miRNAWalker2 validate; mirMAP | TCGA BLCA -0.308; TCGA BRCA -0.081; TCGA COAD -0.353; TCGA HNSC -0.165; TCGA KIRC -0.168; TCGA LUAD -0.141; TCGA LUSC -0.131; TCGA THCA -0.188; TCGA STAD -0.327; TCGA UCEC -0.162 |
hsa-miR-148a-3p | CCNI | 9 cancers: BLCA; CESC; LGG; LUAD; OV; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.09; TCGA CESC -0.117; TCGA LGG -0.082; TCGA LUAD -0.072; TCGA OV -0.075; TCGA PRAD -0.106; TCGA SARC -0.076; TCGA THCA -0.13; TCGA STAD -0.114 |
hsa-miR-148a-3p | DNAJB4 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.178; TCGA BRCA -0.061; TCGA CESC -0.13; TCGA COAD -0.341; TCGA ESCA -0.206; TCGA HNSC -0.156; TCGA LUAD -0.218; TCGA LUSC -0.223; TCGA OV -0.075; TCGA PRAD -0.586; TCGA SARC -0.118; TCGA STAD -0.347; TCGA UCEC -0.163 |
hsa-miR-148a-3p | DSTYK | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.089; TCGA CESC -0.11; TCGA COAD -0.119; TCGA ESCA -0.083; TCGA HNSC -0.056; TCGA KIRC -0.08; TCGA LIHC -0.2; TCGA LUAD -0.078; TCGA LUSC -0.097; TCGA PRAD -0.112; TCGA THCA -0.089; TCGA STAD -0.203 |
hsa-miR-148a-3p | GNB5 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.089; TCGA BRCA -0.083; TCGA CESC -0.097; TCGA COAD -0.383; TCGA ESCA -0.177; TCGA HNSC -0.116; TCGA KIRC -0.12; TCGA LGG -0.05; TCGA LUAD -0.052; TCGA PRAD -0.294; TCGA SARC -0.175; TCGA THCA -0.089; TCGA STAD -0.2 |
hsa-miR-148a-3p | IRS1 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; STAD | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.135; TCGA BRCA -0.3; TCGA COAD -0.393; TCGA ESCA -0.169; TCGA HNSC -0.354; TCGA LGG -0.052; TCGA LUAD -0.21; TCGA OV -0.157; TCGA PAAD -0.188; TCGA PRAD -0.194; TCGA STAD -0.215 |
hsa-miR-148a-3p | MTMR9 | 15 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.138; TCGA BRCA -0.092; TCGA COAD -0.222; TCGA KIRC -0.126; TCGA LGG -0.107; TCGA LIHC -0.071; TCGA LUAD -0.124; TCGA LUSC -0.083; TCGA OV -0.104; TCGA PAAD -0.082; TCGA PRAD -0.153; TCGA SARC -0.073; TCGA THCA -0.064; TCGA STAD -0.216; TCGA UCEC -0.108 |
hsa-miR-148a-3p | PRNP | 11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.198; TCGA COAD -0.46; TCGA ESCA -0.436; TCGA HNSC -0.291; TCGA LIHC -0.397; TCGA LUAD -0.066; TCGA PAAD -0.113; TCGA PRAD -0.36; TCGA THCA -0.245; TCGA STAD -0.368; TCGA UCEC -0.293 |
hsa-miR-148a-3p | RASSF8 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.218; TCGA BRCA -0.101; TCGA CESC -0.226; TCGA COAD -0.606; TCGA ESCA -0.217; TCGA LIHC -0.252; TCGA LUAD -0.271; TCGA PRAD -0.238; TCGA SARC -0.102; TCGA THCA -0.149; TCGA STAD -0.519 |
hsa-miR-148a-3p | SESTD1 | 15 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.121; TCGA BRCA -0.082; TCGA CESC -0.152; TCGA COAD -0.104; TCGA KIRC -0.17; TCGA KIRP -0.172; TCGA LIHC -0.109; TCGA LUAD -0.112; TCGA LUSC -0.134; TCGA OV -0.141; TCGA PAAD -0.184; TCGA PRAD -0.246; TCGA SARC -0.106; TCGA THCA -0.144; TCGA STAD -0.252 |
hsa-miR-148a-3p | MNT | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.052; TCGA COAD -0.072; TCGA ESCA -0.135; TCGA HNSC -0.085; TCGA LIHC -0.135; TCGA LUSC -0.082; TCGA OV -0.063; TCGA PAAD -0.095; TCGA THCA -0.135; TCGA STAD -0.077 |
hsa-miR-148a-3p | RBM24 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.451; TCGA BRCA -0.738; TCGA COAD -0.595; TCGA ESCA -0.31; TCGA HNSC -0.464; TCGA PAAD -0.404; TCGA PRAD -0.438; TCGA SARC -0.642; TCGA STAD -0.712; TCGA UCEC -0.154 |
hsa-miR-148a-3p | MTSS1L | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.197; TCGA BRCA -0.072; TCGA CESC -0.185; TCGA COAD -0.153; TCGA ESCA -0.302; TCGA HNSC -0.078; TCGA KIRC -0.115; TCGA LGG -0.161; TCGA OV -0.08; TCGA PAAD -0.206; TCGA PRAD -0.264; TCGA SARC -0.235; TCGA THCA -0.191; TCGA STAD -0.367 |
hsa-miR-148a-3p | FAM168B | 10 cancers: BLCA; CESC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.145; TCGA CESC -0.079; TCGA LGG -0.05; TCGA LUAD -0.074; TCGA LUSC -0.06; TCGA OV -0.099; TCGA PRAD -0.108; TCGA SARC -0.084; TCGA THCA -0.052; TCGA STAD -0.157 |
hsa-miR-148a-3p | PITPNM2 | 10 cancers: BLCA; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.254; TCGA ESCA -0.109; TCGA HNSC -0.208; TCGA KIRP -0.091; TCGA LUAD -0.123; TCGA LUSC -0.223; TCGA PRAD -0.311; TCGA SARC -0.095; TCGA STAD -0.252; TCGA UCEC -0.107 |
hsa-miR-148a-3p | TGFB2 | 9 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUAD; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.286; TCGA COAD -0.463; TCGA ESCA -0.22; TCGA KIRC -0.247; TCGA LIHC -0.661; TCGA LUAD -0.319; TCGA PRAD -0.346; TCGA THCA -0.286; TCGA STAD -0.322 |
hsa-miR-148a-3p | PTPN14 | 13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.129; TCGA COAD -0.255; TCGA ESCA -0.199; TCGA HNSC -0.138; TCGA KIRC -0.138; TCGA LIHC -0.431; TCGA LUAD -0.189; TCGA OV -0.126; TCGA PAAD -0.171; TCGA PRAD -0.334; TCGA SARC -0.118; TCGA THCA -0.309; TCGA STAD -0.303 |
hsa-miR-148a-3p | EPN2 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.108; TCGA CESC -0.118; TCGA COAD -0.119; TCGA ESCA -0.226; TCGA HNSC -0.066; TCGA KIRC -0.189; TCGA KIRP -0.249; TCGA LGG -0.145; TCGA LIHC -0.116; TCGA LUAD -0.143; TCGA LUSC -0.173; TCGA OV -0.074; TCGA PAAD -0.062; TCGA SARC -0.235; TCGA THCA -0.145; TCGA STAD -0.217; TCGA UCEC -0.056 |
hsa-miR-148a-3p | CYTH3 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.153; TCGA BRCA -0.144; TCGA COAD -0.247; TCGA ESCA -0.104; TCGA HNSC -0.189; TCGA KIRC -0.174; TCGA KIRP -0.099; TCGA LIHC -0.288; TCGA LUSC -0.095; TCGA PAAD -0.13; TCGA STAD -0.201; TCGA UCEC -0.106 |
hsa-miR-148a-3p | WDR47 | 11 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.098; TCGA CESC -0.156; TCGA COAD -0.14; TCGA ESCA -0.193; TCGA LIHC -0.087; TCGA LUAD -0.083; TCGA PAAD -0.115; TCGA PRAD -0.228; TCGA SARC -0.089; TCGA STAD -0.185; TCGA UCEC -0.109 |
hsa-miR-148a-3p | PRICKLE2 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.183; TCGA BRCA -0.137; TCGA COAD -0.545; TCGA HNSC -0.101; TCGA KIRC -0.098; TCGA LIHC -0.362; TCGA LUAD -0.09; TCGA PAAD -0.127; TCGA PRAD -0.69; TCGA SARC -0.108; TCGA STAD -0.6 |
hsa-miR-148a-3p | ABCA1 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.135; TCGA BRCA -0.146; TCGA COAD -0.3; TCGA ESCA -0.2; TCGA HNSC -0.164; TCGA LUAD -0.144; TCGA LUSC -0.104; TCGA PAAD -0.158; TCGA THCA -0.254; TCGA STAD -0.184; TCGA UCEC -0.068 |
hsa-miR-148a-3p | ERRFI1 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.253; TCGA CESC -0.158; TCGA COAD -0.238; TCGA HNSC -0.082; TCGA KIRP -0.212; TCGA LUAD -0.199; TCGA LUSC -0.304; TCGA OV -0.155; TCGA PAAD -0.258; TCGA PRAD -0.162; TCGA THCA -0.213; TCGA STAD -0.262 |
hsa-miR-148a-3p | CTTNBP2NL | 15 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.071; TCGA CESC -0.111; TCGA ESCA -0.069; TCGA HNSC -0.066; TCGA KIRC -0.077; TCGA KIRP -0.108; TCGA LIHC -0.4; TCGA LUAD -0.119; TCGA LUSC -0.062; TCGA OV -0.099; TCGA PAAD -0.085; TCGA PRAD -0.178; TCGA THCA -0.119; TCGA STAD -0.139; TCGA UCEC -0.051 |
hsa-miR-148a-3p | GPRC5A | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA | MirTarget | TCGA BLCA -0.271; TCGA CESC -0.279; TCGA COAD -0.301; TCGA HNSC -0.215; TCGA KIRC -0.345; TCGA LIHC -0.648; TCGA LUAD -0.331; TCGA LUSC -0.307; TCGA PRAD -0.28; TCGA THCA -0.188 |
hsa-miR-148a-3p | DNAJC18 | 12 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.127; TCGA BRCA -0.133; TCGA COAD -0.164; TCGA KIRC -0.068; TCGA LGG -0.094; TCGA LIHC -0.482; TCGA LUSC -0.106; TCGA PRAD -0.348; TCGA SARC -0.051; TCGA THCA -0.11; TCGA STAD -0.298; TCGA UCEC -0.114 |
hsa-miR-148a-3p | SLC24A3 | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.302; TCGA BRCA -0.175; TCGA COAD -0.664; TCGA HNSC -0.203; TCGA KIRC -0.326; TCGA LGG -0.216; TCGA LIHC -0.89; TCGA PAAD -0.185; TCGA PRAD -0.643; TCGA SARC -0.496; TCGA STAD -0.256; TCGA UCEC -0.133 |
hsa-miR-148a-3p | ATP2B4 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.338; TCGA BRCA -0.086; TCGA CESC -0.109; TCGA COAD -0.608; TCGA ESCA -0.257; TCGA LIHC -0.111; TCGA PAAD -0.241; TCGA PRAD -0.771; TCGA SARC -0.21; TCGA THCA -0.215; TCGA STAD -0.512 |
hsa-miR-148a-3p | CLCN6 | 10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.06; TCGA BRCA -0.128; TCGA COAD -0.086; TCGA KIRC -0.108; TCGA LGG -0.054; TCGA LUSC -0.125; TCGA PAAD -0.09; TCGA SARC -0.058; TCGA STAD -0.171; TCGA UCEC -0.088 |
hsa-miR-148a-3p | ARPP19 | 12 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.069; TCGA CESC -0.099; TCGA ESCA -0.081; TCGA HNSC -0.073; TCGA LUAD -0.118; TCGA LUSC -0.052; TCGA OV -0.058; TCGA PAAD -0.061; TCGA PRAD -0.129; TCGA SARC -0.158; TCGA THCA -0.079; TCGA STAD -0.165 |
hsa-miR-148a-3p | NPTN | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.131; TCGA CESC -0.131; TCGA COAD -0.087; TCGA ESCA -0.099; TCGA HNSC -0.052; TCGA LIHC -0.079; TCGA LUAD -0.067; TCGA LUSC -0.068; TCGA PAAD -0.109; TCGA PRAD -0.293; TCGA SARC -0.143; TCGA THCA -0.093; TCGA STAD -0.146 |
hsa-miR-148a-3p | UBE2D1 | 12 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.072; TCGA CESC -0.098; TCGA ESCA -0.141; TCGA HNSC -0.116; TCGA LIHC -0.171; TCGA LUAD -0.056; TCGA LUSC -0.105; TCGA OV -0.056; TCGA PAAD -0.083; TCGA THCA -0.06; TCGA STAD -0.138; TCGA UCEC -0.089 |
hsa-miR-148a-3p | ARHGEF12 | 9 cancers: BLCA; COAD; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA COAD -0.077; TCGA LUAD -0.108; TCGA LUSC -0.063; TCGA OV -0.071; TCGA PRAD -0.106; TCGA SARC -0.088; TCGA THCA -0.147; TCGA STAD -0.123 |
hsa-miR-148a-3p | B4GALT5 | 11 cancers: BLCA; CESC; COAD; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.104; TCGA CESC -0.16; TCGA COAD -0.086; TCGA LIHC -0.327; TCGA LUAD -0.131; TCGA LUSC -0.142; TCGA OV -0.13; TCGA PAAD -0.176; TCGA PRAD -0.248; TCGA THCA -0.267; TCGA UCEC -0.058 |
hsa-miR-148a-3p | SYNC | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.279; TCGA BRCA -0.131; TCGA COAD -0.934; TCGA ESCA -0.402; TCGA HNSC -0.238; TCGA KIRC -0.383; TCGA LIHC -0.607; TCGA LUSC -0.292; TCGA PRAD -0.3; TCGA SARC -0.297; TCGA STAD -0.218; TCGA UCEC -0.263 |
hsa-miR-148a-3p | HOMER1 | 10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD | MirTarget | TCGA BLCA -0.096; TCGA CESC -0.172; TCGA ESCA -0.257; TCGA HNSC -0.2; TCGA LIHC -0.667; TCGA LUAD -0.228; TCGA LUSC -0.108; TCGA PAAD -0.161; TCGA THCA -0.074; TCGA STAD -0.185 |
hsa-miR-148a-3p | SBF2 | 10 cancers: BLCA; BRCA; CESC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.126; TCGA BRCA -0.064; TCGA CESC -0.116; TCGA LGG -0.069; TCGA LUAD -0.111; TCGA PAAD -0.08; TCGA PRAD -0.106; TCGA SARC -0.079; TCGA THCA -0.141; TCGA STAD -0.193 |
hsa-miR-148a-3p | STK38L | 10 cancers: BLCA; CESC; ESCA; KIRC; LIHC; LUAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.109; TCGA CESC -0.11; TCGA ESCA -0.101; TCGA KIRC -0.106; TCGA LIHC -0.168; TCGA LUAD -0.077; TCGA PRAD -0.17; TCGA SARC -0.141; TCGA STAD -0.174; TCGA UCEC -0.069 |
hsa-miR-148a-3p | EGR3 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.224; TCGA BRCA -0.325; TCGA COAD -0.403; TCGA ESCA -0.185; TCGA KIRC -0.223; TCGA LIHC -0.209; TCGA PRAD -0.321; TCGA THCA -0.199; TCGA STAD -0.145 |
hsa-miR-148a-3p | MAFG | 12 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.098; TCGA BRCA -0.104; TCGA ESCA -0.098; TCGA HNSC -0.064; TCGA LIHC -0.168; TCGA LUAD -0.099; TCGA LUSC -0.118; TCGA OV -0.081; TCGA PAAD -0.132; TCGA PRAD -0.114; TCGA SARC -0.086; TCGA STAD -0.094 |
hsa-miR-148a-3p | ITPK1 | 9 cancers: BLCA; BRCA; HNSC; LGG; LUSC; PRAD; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.158; TCGA BRCA -0.18; TCGA HNSC -0.091; TCGA LGG -0.077; TCGA LUSC -0.103; TCGA PRAD -0.059; TCGA SARC -0.148; TCGA THCA -0.183; TCGA UCEC -0.057 |
hsa-miR-148a-3p | DMPK | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.231; TCGA BRCA -0.211; TCGA COAD -0.168; TCGA ESCA -0.139; TCGA HNSC -0.127; TCGA KIRC -0.239; TCGA KIRP -0.252; TCGA LIHC -0.308; TCGA LUAD -0.072; TCGA PRAD -0.344; TCGA SARC -0.269; TCGA STAD -0.546; TCGA UCEC -0.073 |
hsa-miR-148a-3p | TEAD1 | 12 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.251; TCGA BRCA -0.08; TCGA COAD -0.139; TCGA HNSC -0.098; TCGA LUAD -0.141; TCGA LUSC -0.11; TCGA PAAD -0.132; TCGA PRAD -0.428; TCGA SARC -0.136; TCGA THCA -0.191; TCGA STAD -0.409; TCGA UCEC -0.085 |
hsa-miR-148a-3p | CFL2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.314; TCGA BRCA -0.157; TCGA COAD -0.59; TCGA ESCA -0.122; TCGA HNSC -0.143; TCGA LUAD -0.18; TCGA LUSC -0.223; TCGA PRAD -0.535; TCGA SARC -0.395; TCGA STAD -0.595; TCGA UCEC -0.254 |
hsa-miR-148a-3p | ZDHHC7 | 9 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD | MirTarget; miRNATAP | TCGA BLCA -0.066; TCGA CESC -0.081; TCGA HNSC -0.053; TCGA KIRP -0.087; TCGA LIHC -0.349; TCGA LUAD -0.062; TCGA LUSC -0.094; TCGA PAAD -0.132; TCGA PRAD -0.062 |
hsa-miR-148a-3p | PPP1R12A | 12 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.205; TCGA COAD -0.123; TCGA ESCA -0.127; TCGA LGG -0.073; TCGA LIHC -0.102; TCGA LUAD -0.084; TCGA LUSC -0.053; TCGA PAAD -0.093; TCGA PRAD -0.323; TCGA SARC -0.242; TCGA STAD -0.343; TCGA UCEC -0.054 |
hsa-miR-148a-3p | TPPP | 9 cancers: BLCA; BRCA; COAD; KIRC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; mirMAP | TCGA BLCA -0.375; TCGA BRCA -0.355; TCGA COAD -0.342; TCGA KIRC -0.224; TCGA LUSC -0.192; TCGA PRAD -0.152; TCGA SARC -0.531; TCGA STAD -0.216; TCGA UCEC -0.228 |
hsa-miR-148a-3p | LTBP1 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.123; TCGA COAD -0.531; TCGA ESCA -0.328; TCGA HNSC -0.246; TCGA KIRC -0.228; TCGA PAAD -0.17; TCGA PRAD -0.458; TCGA SARC -0.174; TCGA THCA -0.392; TCGA STAD -0.409 |
hsa-miR-148a-3p | ARHGAP21 | 9 cancers: BLCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.09; TCGA CESC -0.157; TCGA HNSC -0.093; TCGA LUAD -0.126; TCGA LUSC -0.098; TCGA PAAD -0.089; TCGA PRAD -0.072; TCGA SARC -0.11; TCGA STAD -0.055 |
hsa-miR-148a-3p | STXBP1 | 9 cancers: BLCA; BRCA; LGG; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.135; TCGA BRCA -0.152; TCGA LGG -0.162; TCGA LUSC -0.162; TCGA OV -0.128; TCGA PRAD -0.137; TCGA SARC -0.057; TCGA STAD -0.133; TCGA UCEC -0.089 |
hsa-miR-148a-3p | PDE5A | 10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.24; TCGA BRCA -0.311; TCGA COAD -0.379; TCGA KIRC -0.229; TCGA LIHC -0.553; TCGA LUAD -0.214; TCGA PRAD -0.686; TCGA SARC -0.405; TCGA THCA -0.914; TCGA STAD -0.45 |
hsa-miR-148a-3p | PITPNM3 | 13 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.224; TCGA CESC -0.184; TCGA ESCA -0.399; TCGA KIRC -0.498; TCGA KIRP -0.215; TCGA LIHC -0.339; TCGA LUAD -0.118; TCGA OV -0.187; TCGA PAAD -0.185; TCGA PRAD -0.434; TCGA SARC -0.441; TCGA THCA -0.119; TCGA STAD -0.5 |
hsa-miR-148a-3p | SRF | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.11; TCGA COAD -0.071; TCGA ESCA -0.115; TCGA LUAD -0.094; TCGA LUSC -0.084; TCGA PRAD -0.238; TCGA SARC -0.221; TCGA STAD -0.25; TCGA UCEC -0.091 |
hsa-miR-148a-3p | CHD5 | 10 cancers: BLCA; COAD; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.248; TCGA COAD -0.554; TCGA KIRC -0.716; TCGA KIRP -0.455; TCGA LUSC -0.251; TCGA PRAD -0.774; TCGA SARC -0.447; TCGA THCA -0.191; TCGA STAD -0.632; TCGA UCEC -0.19 |
hsa-miR-148a-3p | ESYT2 | 12 cancers: BLCA; CESC; ESCA; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.139; TCGA CESC -0.088; TCGA ESCA -0.122; TCGA KIRP -0.099; TCGA LUAD -0.089; TCGA LUSC -0.134; TCGA OV -0.072; TCGA PAAD -0.131; TCGA PRAD -0.083; TCGA SARC -0.212; TCGA STAD -0.19; TCGA UCEC -0.052 |
hsa-miR-148a-3p | SEPT7 | 9 cancers: BLCA; CESC; ESCA; LIHC; LUAD; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.076; TCGA CESC -0.06; TCGA ESCA -0.087; TCGA LIHC -0.065; TCGA LUAD -0.051; TCGA PAAD -0.124; TCGA PRAD -0.148; TCGA STAD -0.19; TCGA UCEC -0.095 |
hsa-miR-148a-3p | CHST3 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; STAD | mirMAP | TCGA BLCA -0.244; TCGA COAD -0.66; TCGA ESCA -0.204; TCGA HNSC -0.153; TCGA KIRC -0.14; TCGA KIRP -0.186; TCGA LGG -0.158; TCGA LIHC -0.544; TCGA LUAD -0.209; TCGA PRAD -0.604; TCGA STAD -0.373 |
hsa-miR-148a-3p | SCRN1 | 10 cancers: BLCA; COAD; HNSC; KIRC; LIHC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.101; TCGA COAD -0.376; TCGA HNSC -0.096; TCGA KIRC -0.186; TCGA LIHC -0.566; TCGA PAAD -0.136; TCGA PRAD -0.523; TCGA THCA -0.238; TCGA STAD -0.343; TCGA UCEC -0.166 |
hsa-miR-148a-3p | KIAA1644 | 11 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.47; TCGA COAD -1.078; TCGA ESCA -0.436; TCGA HNSC -0.379; TCGA LGG -0.369; TCGA LIHC -0.61; TCGA OV -0.474; TCGA PAAD -0.304; TCGA PRAD -0.811; TCGA STAD -0.645; TCGA UCEC -0.212 |
hsa-miR-148a-3p | WNT9A | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.271; TCGA BRCA -0.298; TCGA CESC -0.433; TCGA COAD -0.727; TCGA ESCA -0.62; TCGA LGG -0.197; TCGA LUAD -0.118; TCGA LUSC -0.196; TCGA PRAD -0.256; TCGA STAD -0.744; TCGA UCEC -0.134 |
hsa-miR-148a-3p | EXOC6B | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.164; TCGA CESC -0.217; TCGA COAD -0.131; TCGA ESCA -0.164; TCGA HNSC -0.204; TCGA LUAD -0.208; TCGA PRAD -0.347; TCGA SARC -0.155; TCGA THCA -0.197; TCGA STAD -0.131 |
hsa-miR-148a-3p | GFOD1 | 10 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.168; TCGA ESCA -0.237; TCGA HNSC -0.25; TCGA KIRC -0.172; TCGA LUAD -0.124; TCGA PAAD -0.161; TCGA PRAD -0.409; TCGA SARC -0.115; TCGA STAD -0.41; TCGA UCEC -0.158 |
hsa-miR-148a-3p | RNF217 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.181; TCGA CESC -0.232; TCGA COAD -0.454; TCGA ESCA -0.422; TCGA HNSC -0.253; TCGA KIRC -0.087; TCGA PAAD -0.163; TCGA PRAD -0.29; TCGA SARC -0.13; TCGA THCA -0.083; TCGA STAD -0.337 |
hsa-miR-148a-3p | PLXDC1 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.124; TCGA BRCA -0.176; TCGA COAD -0.339; TCGA ESCA -0.177; TCGA HNSC -0.127; TCGA LIHC -0.884; TCGA PAAD -0.11; TCGA PRAD -0.149; TCGA THCA -0.232; TCGA STAD -0.178 |
hsa-miR-148a-3p | ADCY9 | 9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.199; TCGA BRCA -0.132; TCGA COAD -0.099; TCGA ESCA -0.094; TCGA LUAD -0.087; TCGA PRAD -0.288; TCGA SARC -0.137; TCGA STAD -0.212; TCGA UCEC -0.392 |
hsa-miR-148a-3p | ELFN2 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; OV; PAAD; THCA; UCEC | mirMAP | TCGA BLCA -0.314; TCGA BRCA -0.372; TCGA COAD -0.642; TCGA HNSC -0.281; TCGA KIRP -0.289; TCGA LGG -0.512; TCGA LIHC -0.483; TCGA OV -0.462; TCGA PAAD -0.363; TCGA THCA -1.396; TCGA UCEC -0.443 |
hsa-miR-148a-3p | IGF2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; OV; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.414; TCGA BRCA -0.483; TCGA COAD -0.605; TCGA ESCA -0.328; TCGA HNSC -0.248; TCGA KIRC -0.654; TCGA OV -0.577; TCGA PRAD -0.422; TCGA THCA -0.301; TCGA STAD -0.394; TCGA UCEC -0.235 |
hsa-miR-148a-3p | SYNPO | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.205; TCGA BRCA -0.226; TCGA COAD -0.319; TCGA HNSC -0.139; TCGA LUAD -0.111; TCGA PRAD -0.445; TCGA SARC -0.155; TCGA THCA -0.336; TCGA STAD -0.179 |
hsa-miR-148a-3p | ZHX3 | 9 cancers: BLCA; BRCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.177; TCGA BRCA -0.123; TCGA HNSC -0.163; TCGA KIRC -0.112; TCGA LUAD -0.088; TCGA LUSC -0.109; TCGA PRAD -0.06; TCGA STAD -0.242; TCGA UCEC -0.075 |
hsa-miR-148a-3p | ARL10 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.149; TCGA BRCA -0.111; TCGA COAD -0.498; TCGA ESCA -0.291; TCGA HNSC -0.108; TCGA LGG -0.115; TCGA PAAD -0.164; TCGA PRAD -0.562; TCGA THCA -0.231; TCGA STAD -0.323; TCGA UCEC -0.124 |
hsa-miR-148a-3p | LYNX1 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; OV; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.402; TCGA COAD -0.881; TCGA ESCA -0.366; TCGA HNSC -0.19; TCGA KIRC -0.154; TCGA OV -0.306; TCGA PRAD -0.41; TCGA SARC -0.36; TCGA THCA -0.208; TCGA STAD -0.509 |
hsa-miR-148a-3p | KCTD2 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.075; TCGA BRCA -0.119; TCGA COAD -0.119; TCGA ESCA -0.053; TCGA HNSC -0.078; TCGA KIRC -0.062; TCGA KIRP -0.143; TCGA LIHC -0.141; TCGA LUAD -0.116; TCGA LUSC -0.078; TCGA PRAD -0.061; TCGA STAD -0.095; TCGA UCEC -0.07 |
hsa-miR-148a-3p | MXRA7 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.289; TCGA BRCA -0.228; TCGA CESC -0.166; TCGA COAD -0.47; TCGA ESCA -0.324; TCGA HNSC -0.149; TCGA LIHC -0.327; TCGA LUAD -0.199; TCGA OV -0.101; TCGA PAAD -0.126; TCGA PRAD -0.535; TCGA SARC -0.205; TCGA THCA -0.09; TCGA STAD -0.47; TCGA UCEC -0.115 |
hsa-miR-148a-3p | BCL9L | 12 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.073; TCGA COAD -0.258; TCGA ESCA -0.107; TCGA HNSC -0.16; TCGA LGG -0.114; TCGA LIHC -0.253; TCGA LUAD -0.14; TCGA PAAD -0.163; TCGA PRAD -0.081; TCGA SARC -0.074; TCGA THCA -0.138; TCGA STAD -0.104 |
hsa-miR-148a-3p | TECPR2 | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.119; TCGA COAD -0.083; TCGA ESCA -0.066; TCGA HNSC -0.065; TCGA KIRC -0.105; TCGA LUSC -0.067; TCGA PRAD -0.134; TCGA THCA -0.061; TCGA STAD -0.164 |
hsa-miR-148a-3p | MYO5A | 9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.109; TCGA COAD -0.552; TCGA ESCA -0.358; TCGA HNSC -0.291; TCGA LGG -0.114; TCGA LIHC -0.345; TCGA PRAD -0.118; TCGA STAD -0.174; TCGA UCEC -0.068 |
hsa-miR-148a-3p | BMPR2 | 10 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.117; TCGA COAD -0.15; TCGA HNSC -0.095; TCGA KIRC -0.078; TCGA LUAD -0.163; TCGA LUSC -0.17; TCGA PAAD -0.129; TCGA PRAD -0.18; TCGA THCA -0.121; TCGA STAD -0.182 |
hsa-miR-148a-3p | MITF | 10 cancers: BLCA; BRCA; COAD; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.204; TCGA BRCA -0.085; TCGA COAD -0.785; TCGA KIRP -0.172; TCGA LIHC -0.468; TCGA PRAD -0.411; TCGA SARC -0.218; TCGA THCA -0.142; TCGA STAD -0.313; TCGA UCEC -0.1 |
hsa-miR-148a-3p | ITGA5 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.335; TCGA BRCA -0.096; TCGA COAD -0.726; TCGA ESCA -0.271; TCGA HNSC -0.461; TCGA LIHC -0.308; TCGA LUAD -0.191; TCGA LUSC -0.161; TCGA PAAD -0.288; TCGA PRAD -0.546; TCGA SARC -0.201; TCGA THCA -0.079; TCGA STAD -0.397 |
hsa-miR-148a-3p | KLF6 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.089; TCGA BRCA -0.136; TCGA CESC -0.171; TCGA COAD -0.147; TCGA ESCA -0.102; TCGA HNSC -0.109; TCGA KIRC -0.113; TCGA LUAD -0.229; TCGA LUSC -0.2; TCGA PAAD -0.191; TCGA PRAD -0.254; TCGA THCA -0.14; TCGA STAD -0.083; TCGA UCEC -0.11 |
hsa-miR-148a-3p | DTNA | 10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.302; TCGA BRCA -0.206; TCGA COAD -0.737; TCGA ESCA -0.262; TCGA LIHC -0.419; TCGA PRAD -0.592; TCGA SARC -0.494; TCGA THCA -0.095; TCGA STAD -0.617; TCGA UCEC -0.273 |
hsa-miR-148a-3p | ADAMTS5 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.225; TCGA BRCA -0.212; TCGA COAD -0.352; TCGA HNSC -0.168; TCGA LGG -0.132; TCGA LIHC -0.307; TCGA PAAD -0.171; TCGA PRAD -0.798; TCGA STAD -0.215; TCGA UCEC -0.162 |
hsa-miR-148a-3p | SERPINE1 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.194; TCGA BRCA -0.108; TCGA COAD -0.633; TCGA ESCA -0.437; TCGA HNSC -0.589; TCGA LIHC -0.209; TCGA PAAD -0.237; TCGA PRAD -0.213; TCGA THCA -0.303; TCGA STAD -0.199 |
hsa-miR-148a-3p | KCNQ5 | 10 cancers: BLCA; COAD; ESCA; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.263; TCGA COAD -0.832; TCGA ESCA -0.639; TCGA KIRP -0.256; TCGA LGG -0.316; TCGA PRAD -0.778; TCGA SARC -0.212; TCGA THCA -0.229; TCGA STAD -0.371; TCGA UCEC -0.201 |
hsa-miR-148a-3p | EPAS1 | 9 cancers: BLCA; BRCA; COAD; KIRC; LUAD; LUSC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.159; TCGA BRCA -0.182; TCGA COAD -0.165; TCGA KIRC -0.198; TCGA LUAD -0.29; TCGA LUSC -0.167; TCGA PRAD -0.381; TCGA SARC -0.146; TCGA STAD -0.075 |
hsa-miR-148a-3p | NFAT5 | 10 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.103; TCGA HNSC -0.08; TCGA KIRC -0.125; TCGA KIRP -0.124; TCGA LUAD -0.065; TCGA LUSC -0.153; TCGA PAAD -0.079; TCGA PRAD -0.152; TCGA THCA -0.098; TCGA STAD -0.2 |
hsa-miR-148a-3p | AHDC1 | 12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.159; TCGA CESC -0.117; TCGA COAD -0.259; TCGA ESCA -0.156; TCGA KIRC -0.169; TCGA KIRP -0.108; TCGA LIHC -0.118; TCGA PAAD -0.114; TCGA PRAD -0.298; TCGA SARC -0.067; TCGA THCA -0.112; TCGA STAD -0.237 |
hsa-miR-148a-3p | NRP1 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.152; TCGA BRCA -0.103; TCGA COAD -0.502; TCGA ESCA -0.16; TCGA HNSC -0.163; TCGA KIRP -0.118; TCGA LIHC -0.189; TCGA LUAD -0.14; TCGA LUSC -0.125; TCGA PRAD -0.198; TCGA THCA -0.099; TCGA STAD -0.166; TCGA UCEC -0.136 |
hsa-miR-148a-3p | PPP1CB | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; OV; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.095; TCGA CESC -0.109; TCGA ESCA -0.148; TCGA HNSC -0.073; TCGA KIRP -0.058; TCGA LUAD -0.076; TCGA OV -0.073; TCGA SARC -0.126; TCGA THCA -0.113; TCGA STAD -0.188 |
hsa-miR-148a-3p | MECP2 | 12 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.09; TCGA COAD -0.075; TCGA KIRC -0.088; TCGA LIHC -0.108; TCGA LUAD -0.058; TCGA OV -0.06; TCGA PRAD -0.17; TCGA SARC -0.082; TCGA THCA -0.06; TCGA STAD -0.169; TCGA UCEC -0.072 |
hsa-miR-148a-3p | ARHGEF17 | 14 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.244; TCGA BRCA -0.099; TCGA COAD -0.556; TCGA KIRC -0.15; TCGA LGG -0.087; TCGA LIHC -0.457; TCGA LUSC -0.173; TCGA OV -0.107; TCGA PAAD -0.192; TCGA PRAD -0.46; TCGA SARC -0.232; TCGA THCA -0.11; TCGA STAD -0.384; TCGA UCEC -0.108 |
hsa-miR-148a-3p | AP4E1 | 9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.08; TCGA ESCA -0.082; TCGA HNSC -0.158; TCGA LUAD -0.097; TCGA LUSC -0.067; TCGA PRAD -0.186; TCGA SARC -0.071; TCGA THCA -0.101; TCGA STAD -0.112 |
hsa-miR-148a-3p | OTUD4 | 9 cancers: BLCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.079; TCGA HNSC -0.072; TCGA KIRP -0.078; TCGA LUAD -0.098; TCGA LUSC -0.069; TCGA OV -0.075; TCGA PRAD -0.151; TCGA THCA -0.102; TCGA STAD -0.115 |
hsa-miR-148a-3p | ZFPM2 | 11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.324; TCGA BRCA -0.226; TCGA COAD -0.882; TCGA ESCA -0.194; TCGA LGG -0.159; TCGA LIHC -0.169; TCGA LUAD -0.128; TCGA PAAD -0.229; TCGA PRAD -0.683; TCGA STAD -0.548; TCGA UCEC -0.164 |
hsa-miR-148a-3p | CNN1 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.595; TCGA BRCA -0.395; TCGA COAD -1.485; TCGA ESCA -0.409; TCGA KIRC -0.343; TCGA LIHC -0.498; TCGA PAAD -0.237; TCGA PRAD -0.807; TCGA SARC -0.992; TCGA THCA -0.166; TCGA STAD -1.04; TCGA UCEC -0.358 |
hsa-miR-148a-3p | CAMK2A | 10 cancers: BLCA; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.449; TCGA ESCA -0.325; TCGA HNSC -0.66; TCGA KIRC -0.493; TCGA LUSC -0.291; TCGA PAAD -0.199; TCGA PRAD -0.76; TCGA SARC -0.301; TCGA STAD -0.646; TCGA UCEC -0.253 |
hsa-miR-148a-3p | COL4A1 | 11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.227; TCGA COAD -0.298; TCGA ESCA -0.187; TCGA HNSC -0.287; TCGA LIHC -0.507; TCGA LUAD -0.104; TCGA PAAD -0.144; TCGA PRAD -0.427; TCGA SARC -0.138; TCGA THCA -0.167; TCGA STAD -0.254 |
hsa-miR-148a-3p | ARHGAP20 | 9 cancers: BLCA; BRCA; COAD; ESCA; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.375; TCGA BRCA -0.298; TCGA COAD -0.615; TCGA ESCA -0.201; TCGA PAAD -0.253; TCGA PRAD -0.871; TCGA SARC -0.16; TCGA STAD -0.437; TCGA UCEC -0.2 |
hsa-miR-148a-3p | CDC42BPB | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.12; TCGA BRCA -0.065; TCGA CESC -0.108; TCGA COAD -0.075; TCGA HNSC -0.174; TCGA KIRC -0.111; TCGA LUAD -0.149; TCGA LUSC -0.104; TCGA PAAD -0.113; TCGA PRAD -0.076; TCGA THCA -0.107; TCGA STAD -0.086 |
hsa-miR-148a-3p | PICALM | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.065; TCGA CESC -0.087; TCGA COAD -0.111; TCGA ESCA -0.087; TCGA HNSC -0.094; TCGA LUAD -0.066; TCGA PAAD -0.068; TCGA THCA -0.094; TCGA STAD -0.102 |
hsa-miR-148a-3p | LDLR | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA | miRNATAP | TCGA BLCA -0.173; TCGA CESC -0.132; TCGA COAD -0.123; TCGA ESCA -0.114; TCGA HNSC -0.087; TCGA KIRC -0.324; TCGA LUAD -0.227; TCGA LUSC -0.248; TCGA PRAD -0.221; TCGA SARC -0.201; TCGA THCA -0.609 |
hsa-miR-148a-3p | KLC2 | 9 cancers: BLCA; ESCA; HNSC; LGG; LIHC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.068; TCGA ESCA -0.203; TCGA HNSC -0.129; TCGA LGG -0.07; TCGA LIHC -0.397; TCGA PAAD -0.158; TCGA SARC -0.164; TCGA THCA -0.08; TCGA STAD -0.107 |
hsa-miR-148a-3p | ABLIM3 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.269; TCGA BRCA -0.298; TCGA COAD -0.724; TCGA HNSC -0.257; TCGA LGG -0.091; TCGA LUAD -0.205; TCGA PAAD -0.258; TCGA PRAD -0.107; TCGA STAD -0.363; TCGA UCEC -0.183 |
hsa-miR-148a-3p | CSPG4 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.453; TCGA BRCA -0.192; TCGA COAD -0.429; TCGA ESCA -0.296; TCGA HNSC -0.459; TCGA LIHC -0.471; TCGA LUAD -0.148; TCGA PAAD -0.193; TCGA PRAD -0.593; TCGA SARC -0.28; TCGA THCA -0.137; TCGA STAD -0.545 |
hsa-miR-148a-3p | GAS1 | 10 cancers: BRCA; COAD; ESCA; KIRC; LIHC; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.179; TCGA COAD -1.379; TCGA ESCA -0.517; TCGA KIRC -0.289; TCGA LIHC -0.447; TCGA OV -0.157; TCGA PAAD -0.248; TCGA PRAD -0.705; TCGA STAD -0.59; TCGA UCEC -0.375 |
hsa-miR-148a-3p | RAB34 | 13 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BRCA -0.146; TCGA COAD -0.649; TCGA ESCA -0.366; TCGA HNSC -0.074; TCGA KIRP -0.295; TCGA LIHC -0.797; TCGA LUAD -0.056; TCGA OV -0.087; TCGA PAAD -0.199; TCGA PRAD -0.446; TCGA SARC -0.137; TCGA THCA -0.261; TCGA STAD -0.282 |
hsa-miR-148a-3p | SLC2A3 | 9 cancers: BRCA; COAD; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.13; TCGA COAD -0.496; TCGA LIHC -0.191; TCGA LUAD -0.144; TCGA PAAD -0.326; TCGA PRAD -0.226; TCGA THCA -0.368; TCGA STAD -0.092; TCGA UCEC -0.085 |
hsa-miR-148a-3p | TCF4 | 9 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.141; TCGA COAD -0.463; TCGA ESCA -0.128; TCGA KIRC -0.141; TCGA LGG -0.141; TCGA LIHC -0.199; TCGA PRAD -0.323; TCGA STAD -0.204; TCGA UCEC -0.09 |
hsa-miR-148a-3p | SSBP2 | 11 cancers: BRCA; COAD; ESCA; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.054; TCGA COAD -0.391; TCGA ESCA -0.178; TCGA LIHC -0.63; TCGA LUAD -0.076; TCGA OV -0.095; TCGA PRAD -0.24; TCGA SARC -0.15; TCGA THCA -0.074; TCGA STAD -0.369; TCGA UCEC -0.158 |
hsa-miR-148a-3p | DOCK6 | 9 cancers: BRCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA | MirTarget | TCGA BRCA -0.19; TCGA CESC -0.096; TCGA HNSC -0.126; TCGA KIRC -0.193; TCGA LIHC -0.242; TCGA LUAD -0.12; TCGA LUSC -0.17; TCGA PAAD -0.091; TCGA THCA -0.171 |
hsa-miR-148a-3p | MATN3 | 9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.134; TCGA COAD -0.71; TCGA HNSC -0.379; TCGA LIHC -0.572; TCGA LUAD -0.195; TCGA PRAD -0.309; TCGA THCA -0.359; TCGA STAD -0.21; TCGA UCEC -0.133 |
hsa-miR-148a-3p | EPB41L1 | 10 cancers: BRCA; KIRC; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BRCA -0.084; TCGA KIRC -0.163; TCGA LIHC -0.303; TCGA LUAD -0.117; TCGA OV -0.091; TCGA PAAD -0.18; TCGA PRAD -0.198; TCGA SARC -0.069; TCGA THCA -0.179; TCGA UCEC -0.132 |
hsa-miR-148a-3p | CELSR1 | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; OV; PAAD; PRAD; THCA | MirTarget | TCGA BRCA -0.117; TCGA CESC -0.139; TCGA ESCA -0.233; TCGA HNSC -0.138; TCGA KIRC -0.113; TCGA LIHC -0.208; TCGA OV -0.135; TCGA PAAD -0.211; TCGA PRAD -0.235; TCGA THCA -0.263 |
hsa-miR-148a-3p | NOG | 10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; OV; PAAD; PRAD; STAD | MirTarget; miRNATAP | TCGA BRCA -0.161; TCGA ESCA -0.286; TCGA HNSC -0.341; TCGA KIRC -0.338; TCGA KIRP -0.355; TCGA LGG -0.554; TCGA OV -0.291; TCGA PAAD -0.39; TCGA PRAD -0.658; TCGA STAD -0.495 |
hsa-miR-148a-3p | EFNB2 | 10 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.125; TCGA HNSC -0.255; TCGA KIRC -0.178; TCGA KIRP -0.389; TCGA LIHC -0.186; TCGA LUAD -0.133; TCGA OV -0.233; TCGA PAAD -0.13; TCGA THCA -0.14; TCGA UCEC -0.273 |
hsa-miR-148a-3p | USP32 | 11 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.145; TCGA COAD -0.068; TCGA ESCA -0.113; TCGA HNSC -0.141; TCGA LUAD -0.138; TCGA LUSC -0.08; TCGA PAAD -0.085; TCGA PRAD -0.141; TCGA SARC -0.061; TCGA THCA -0.059; TCGA STAD -0.094 |
hsa-miR-148a-3p | ZNF665 | 9 cancers: BRCA; KIRC; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.098; TCGA KIRC -0.12; TCGA LIHC -0.245; TCGA LUAD -0.128; TCGA OV -0.101; TCGA PRAD -0.189; TCGA SARC -0.164; TCGA THCA -0.079; TCGA STAD -0.289 |
hsa-miR-148a-3p | MPP2 | 9 cancers: BRCA; COAD; KIRC; LIHC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.356; TCGA COAD -0.577; TCGA KIRC -0.516; TCGA LIHC -0.577; TCGA PAAD -0.196; TCGA PRAD -0.749; TCGA SARC -0.211; TCGA STAD -0.386; TCGA UCEC -0.12 |
hsa-miR-148a-3p | ZBTB46 | 9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BRCA -0.135; TCGA COAD -0.415; TCGA KIRC -0.196; TCGA KIRP -0.167; TCGA LIHC -0.261; TCGA PAAD -0.128; TCGA PRAD -0.139; TCGA THCA -0.056; TCGA UCEC -0.148 |
hsa-miR-148a-3p | TANC2 | 14 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.102; TCGA COAD -0.42; TCGA ESCA -0.257; TCGA HNSC -0.18; TCGA KIRC -0.108; TCGA KIRP -0.126; TCGA LGG -0.111; TCGA LIHC -0.621; TCGA LUAD -0.097; TCGA LUSC -0.127; TCGA PAAD -0.166; TCGA THCA -0.264; TCGA STAD -0.174; TCGA UCEC -0.178 |
hsa-miR-148a-3p | SRRM3 | 9 cancers: BRCA; COAD; ESCA; LGG; LIHC; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BRCA -0.388; TCGA COAD -0.526; TCGA ESCA -0.404; TCGA LGG -0.409; TCGA LIHC -0.705; TCGA PAAD -0.162; TCGA PRAD -0.274; TCGA THCA -0.234; TCGA UCEC -0.194 |
hsa-miR-148a-3p | CNTN4 | 10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; OV; PRAD; THCA; STAD | miRNATAP | TCGA BRCA -0.35; TCGA COAD -0.544; TCGA KIRC -0.285; TCGA KIRP -0.424; TCGA LGG -0.116; TCGA LIHC -0.268; TCGA OV -0.342; TCGA PRAD -0.363; TCGA THCA -0.226; TCGA STAD -0.215 |
hsa-miR-148a-3p | MMD | 11 cancers: BRCA; COAD; ESCA; KIRP; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.332; TCGA COAD -0.085; TCGA ESCA -0.292; TCGA KIRP -0.136; TCGA LIHC -0.373; TCGA LUAD -0.125; TCGA OV -0.114; TCGA PAAD -0.244; TCGA PRAD -0.186; TCGA STAD -0.236; TCGA UCEC -0.075 |
hsa-miR-148a-3p | NAT14 | 10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LIHC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.081; TCGA COAD -0.207; TCGA ESCA -0.164; TCGA KIRC -0.193; TCGA KIRP -0.192; TCGA LIHC -0.456; TCGA OV -0.136; TCGA PAAD -0.205; TCGA STAD -0.122; TCGA UCEC -0.098 |
hsa-miR-148a-3p | ZFHX3 | 10 cancers: BRCA; COAD; HNSC; KIRC; LUAD; LUSC; OV; SARC; THCA; STAD | miRNATAP | TCGA BRCA -0.097; TCGA COAD -0.176; TCGA HNSC -0.102; TCGA KIRC -0.129; TCGA LUAD -0.087; TCGA LUSC -0.107; TCGA OV -0.089; TCGA SARC -0.087; TCGA THCA -0.099; TCGA STAD -0.25 |
hsa-miR-148a-3p | CDK19 | 10 cancers: CESC; KIRC; KIRP; LGG; LIHC; LUAD; OV; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA CESC -0.115; TCGA KIRC -0.104; TCGA KIRP -0.172; TCGA LGG -0.057; TCGA LIHC -0.236; TCGA LUAD -0.063; TCGA OV -0.135; TCGA THCA -0.142; TCGA STAD -0.067; TCGA UCEC -0.086 |
hsa-miR-148a-3p | GPATCH8 | 9 cancers: CESC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate; MirTarget | TCGA CESC -0.082; TCGA KIRC -0.056; TCGA KIRP -0.123; TCGA LGG -0.059; TCGA LUAD -0.083; TCGA PAAD -0.078; TCGA PRAD -0.097; TCGA THCA -0.084; TCGA STAD -0.074 |
hsa-miR-148a-3p | MAP3K4 | 9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; SARC; STAD | miRNAWalker2 validate | TCGA CESC -0.15; TCGA ESCA -0.071; TCGA HNSC -0.094; TCGA KIRC -0.135; TCGA KIRP -0.059; TCGA LGG -0.062; TCGA LUAD -0.085; TCGA SARC -0.057; TCGA STAD -0.095 |
hsa-miR-148a-3p | RAB12 | 11 cancers: CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA CESC -0.137; TCGA COAD -0.212; TCGA ESCA -0.223; TCGA HNSC -0.074; TCGA LUAD -0.091; TCGA PAAD -0.15; TCGA PRAD -0.238; TCGA SARC -0.099; TCGA THCA -0.084; TCGA STAD -0.259; TCGA UCEC -0.163 |
hsa-miR-148a-3p | RALBP1 | 11 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA CESC -0.095; TCGA COAD -0.094; TCGA ESCA -0.087; TCGA HNSC -0.122; TCGA KIRC -0.119; TCGA LUAD -0.119; TCGA OV -0.073; TCGA PAAD -0.099; TCGA SARC -0.081; TCGA THCA -0.111; TCGA STAD -0.082 |
hsa-miR-148a-3p | BACH2 | 9 cancers: CESC; COAD; KIRC; LGG; OV; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.198; TCGA COAD -0.638; TCGA KIRC -0.21; TCGA LGG -0.107; TCGA OV -0.239; TCGA PRAD -0.288; TCGA THCA -0.163; TCGA STAD -0.19; TCGA UCEC -0.113 |
hsa-miR-148a-3p | ARL8B | 11 cancers: CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.084; TCGA ESCA -0.151; TCGA HNSC -0.061; TCGA LUAD -0.069; TCGA LUSC -0.081; TCGA PAAD -0.07; TCGA PRAD -0.073; TCGA SARC -0.083; TCGA THCA -0.1; TCGA STAD -0.122; TCGA UCEC -0.076 |
hsa-miR-148a-3p | BTBD10 | 9 cancers: CESC; ESCA; HNSC; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA CESC -0.105; TCGA ESCA -0.083; TCGA HNSC -0.096; TCGA LIHC -0.174; TCGA PAAD -0.11; TCGA PRAD -0.066; TCGA SARC -0.054; TCGA THCA -0.136; TCGA STAD -0.075 |
hsa-miR-148a-3p | STK24 | 9 cancers: CESC; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PRAD; THCA | mirMAP | TCGA CESC -0.098; TCGA ESCA -0.081; TCGA HNSC -0.112; TCGA KIRC -0.052; TCGA LIHC -0.172; TCGA LUAD -0.064; TCGA OV -0.082; TCGA PRAD -0.051; TCGA THCA -0.106 |
hsa-miR-148a-3p | PHF3 | 9 cancers: CESC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA CESC -0.084; TCGA LGG -0.055; TCGA LUAD -0.066; TCGA LUSC -0.084; TCGA PRAD -0.082; TCGA SARC -0.051; TCGA THCA -0.075; TCGA STAD -0.078; TCGA UCEC -0.062 |
hsa-miR-148a-3p | IL17RD | 9 cancers: CESC; COAD; KIRC; LIHC; LUAD; OV; PRAD; THCA; STAD | miRNATAP | TCGA CESC -0.286; TCGA COAD -0.206; TCGA KIRC -0.252; TCGA LIHC -0.827; TCGA LUAD -0.14; TCGA OV -0.164; TCGA PRAD -0.412; TCGA THCA -0.698; TCGA STAD -0.523 |
hsa-miR-148a-3p | RAI14 | 9 cancers: COAD; ESCA; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA COAD -0.373; TCGA ESCA -0.231; TCGA LUAD -0.083; TCGA OV -0.131; TCGA PAAD -0.184; TCGA PRAD -0.194; TCGA THCA -0.137; TCGA STAD -0.245; TCGA UCEC -0.184 |
hsa-miR-148a-3p | PANX1 | 9 cancers: COAD; ESCA; HNSC; LGG; OV; PAAD; PRAD; SARC; STAD | MirTarget | TCGA COAD -0.142; TCGA ESCA -0.171; TCGA HNSC -0.263; TCGA LGG -0.066; TCGA OV -0.066; TCGA PAAD -0.123; TCGA PRAD -0.058; TCGA SARC -0.061; TCGA STAD -0.075 |
hsa-miR-148a-3p | PEA15 | 11 cancers: COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA COAD -0.193; TCGA ESCA -0.162; TCGA HNSC -0.063; TCGA LGG -0.151; TCGA LIHC -0.165; TCGA LUSC -0.086; TCGA PAAD -0.102; TCGA PRAD -0.098; TCGA SARC -0.073; TCGA THCA -0.195; TCGA STAD -0.173 |
hsa-miR-148a-3p | DOCK3 | 12 cancers: COAD; KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA COAD -0.246; TCGA KIRC -0.243; TCGA KIRP -0.443; TCGA LGG -0.119; TCGA LIHC -0.284; TCGA OV -0.238; TCGA PAAD -0.236; TCGA PRAD -0.433; TCGA SARC -0.652; TCGA THCA -0.218; TCGA STAD -0.733; TCGA UCEC -0.307 |
hsa-miR-148a-3p | SULF1 | 10 cancers: COAD; ESCA; HNSC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA COAD -0.941; TCGA ESCA -0.43; TCGA HNSC -0.162; TCGA KIRP -0.304; TCGA LIHC -1.088; TCGA PAAD -0.304; TCGA PRAD -0.445; TCGA SARC -0.239; TCGA THCA -0.182; TCGA STAD -0.406 |
hsa-miR-148a-3p | SOX11 | 9 cancers: COAD; ESCA; HNSC; LGG; LIHC; OV; PAAD; THCA; STAD | miRNATAP | TCGA COAD -0.702; TCGA ESCA -0.401; TCGA HNSC -0.519; TCGA LGG -0.229; TCGA LIHC -1.071; TCGA OV -0.8; TCGA PAAD -0.652; TCGA THCA -0.917; TCGA STAD -0.517 |
hsa-miR-148a-3p | ACSL4 | 9 cancers: COAD; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRNATAP | TCGA COAD -0.118; TCGA KIRC -0.12; TCGA LGG -0.052; TCGA LIHC -0.646; TCGA LUAD -0.12; TCGA LUSC -0.107; TCGA PRAD -0.578; TCGA THCA -0.05; TCGA STAD -0.072 |
Enriched cancer pathways of putative targets