microRNA information: hsa-miR-148a-3p

SectionIDlink
Mature name: hsa-miR-148a-3pmiRbase
Accession: MIMAT0000243miRbase
Precursor name: hsa-mir-148a miRbase
Precursor accession: MI0000253miRbase
Symbol: MIR148AHGNC
RefSeq ID: NR_029597GenBank
Sequence: UCAGUGCACUACAGAACUUUGU



Reported expression in cancers: hsa-miR-148a-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-148a-3p

bladder cancerdownregulation"MicroRNA 148a represents an independent prognostic ......"26700670qPCR
hsa-miR-148a-3p

breast cancerdownregulation"MicroRNA 148a inhibits breast cancer migration and ......"26707142
hsa-miR-148a-3p

colorectal cancerupregulation"High expression of miR-27b miR-148a and miR-326 we ......"24119443
hsa-miR-148a-3p

colorectal cancerupregulation"Signature miRNAs in colorectal cancers were reveal ......"26646696RNA-Seq
hsa-miR-148a-3p

gastric cancerdownregulation"Our previous studies have revealed that miR-148a a ......"21205300
hsa-miR-148a-3p

gastric cancerdownregulation"Herein we identified the role of miR-148a in gastr ......"21552422
hsa-miR-148a-3p

gastric cancerdownregulation"In this study we investigate the role of miR-148a ......"21994419qPCR
hsa-miR-148a-3p

gastric cancerdownregulation"MicroRNA 148a is silenced by hypermethylation and ......"22167392
hsa-miR-148a-3p

gastric cancerdownregulation"microRNA 148a suppresses human gastric cancer cell ......"23873106qPCR
hsa-miR-148a-3p

gastric cancerdownregulation"To identify miRNAs that are associated with some c ......"24283384Microarray; qPCR
hsa-miR-148a-3p

gastric cancerdownregulation"The role of miR 148a in gastric cancer. MiR-148a i ......"24659367
hsa-miR-148a-3p

gastric cancerdownregulation"MiR-375 and miR-148a were found downregulated in s ......"24902858
hsa-miR-148a-3p

gastric cancerdownregulation"Expression level of miR-148a was detected by qRT-P ......"25341915qPCR
hsa-miR-148a-3p

gastric cancerdownregulation"Using Limma package in R a total of 27 differentia ......"26692821
hsa-miR-148a-3p

gastric cancerdownregulation"In this research we demonstrated that miR-148a exp ......"27518872
hsa-miR-148a-3p

gastric cancerdownregulation"Expression and prognostic value of microRNA 26a an ......"27529338Reverse transcription PCR; qPCR
hsa-miR-148a-3p

liver cancerdownregulation"Decreased expression and clinical significance of ......"25444499qPCR
hsa-miR-148a-3p

liver cancerdownregulation"Decrease expression and clinicopathological signif ......"26248880qPCR
hsa-miR-148a-3p

liver cancerdownregulation"Differentiation therapy for hepatocellular carcino ......"26599259
hsa-miR-148a-3p

lung squamous cell cancerdownregulation"We found that miR-148a is significantly downregula ......"23670799
hsa-miR-148a-3p

lung squamous cell cancerdownregulation"Serum miR 152 miR 148a miR 148b and miR 21 as nove ......"25501703qPCR
hsa-miR-148a-3p

lung squamous cell cancerdownregulation"MicroRNA 148a Suppresses Invasion and Metastasis o ......"26584284Reverse transcription PCR
hsa-miR-148a-3p

ovarian cancerderegulation"Suppressive Role of MicroRNA 148a in Cell Prolifer ......"27712592
hsa-miR-148a-3p

pancreatic cancerdownregulation"Our previous studies have revealed that miR-148a i ......"23975374qPCR
hsa-miR-148a-3p

pancreatic cancerdownregulation"miR 148a and miR 216a regulated oncolytic adenovir ......"24895996
hsa-miR-148a-3p

prostate cancerdownregulation"It has been recently reported that miR-148a expres ......"20406806
hsa-miR-148a-3p

sarcomaupregulation"The expression levels of circulating miR-148a were ......"25185654qPCR
hsa-miR-148a-3p

sarcomadownregulation"MATERIAL AND METHODS According to the qRT-PCR anal ......"26638007qPCR



Reported cancer pathway affected by hsa-miR-148a-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-148a-3p

bladder cancerApoptosis pathway"miR 148a dependent apoptosis of bladder cancer cel ......"25865490
hsa-miR-148a-3p

bladder cancerApoptosis pathway"MicroRNA 148a represents an independent prognostic ......"26700670
hsa-miR-148a-3p

breast cancerApoptosis pathway"Based on the results obtained in the last decade s ......"26199650
hsa-miR-148a-3p

chordomacell cycle pathway; Apoptosis pathway"The mRNA level of predicted and confirmed targets ......"27016303
hsa-miR-148a-3p

colorectal cancerApoptosis pathway"MiR 148a promotes apoptosis by targeting Bcl 2 in ......"21455217
hsa-miR-148a-3p

gastric cancercell cycle pathway"miR 148a promoted cell proliferation by targeting ......"21552422
hsa-miR-148a-3p

gastric cancerApoptosis pathway"MicroRNA 148a is silenced by hypermethylation and ......"22167392Western blot
hsa-miR-148a-3p

gastric cancerEpithelial mesenchymal transition pathway"microRNA 148a suppresses human gastric cancer cell ......"23873106Western blot; Luciferase
hsa-miR-148a-3p

gastric cancerApoptosis pathway"Expression and prognostic value of microRNA 26a an ......"27529338Colony formation
hsa-miR-148a-3p

glioblastomaApoptosis pathway"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-3p

liver cancercell cycle pathway"Role of miR 148a in hepatitis B associated hepatoc ......"22496917Colony formation
hsa-miR-148a-3p

liver cancerWnt signaling pathway"Inhibitions of epithelial to mesenchymal transitio ......"23861222
hsa-miR-148a-3p

ovarian cancerApoptosis pathway"MicroRNA 148a inhibits the proliferation and promo ......"26004124Western blot; Luciferase
hsa-miR-148a-3p

pancreatic cancerApoptosis pathway"MiR 148a regulates the growth and apoptosis in pan ......"23975374Colony formation; MTT assay; Western blot; Luciferase
hsa-miR-148a-3p

prostate cancerApoptosis pathway"Seven miRNAs miR-21 miR-32 miR-99a miR-99b miR-148 ......"22266859Western blot; Luciferase
hsa-miR-148a-3p

prostate cancerApoptosis pathway"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-148a-3p

sarcomaApoptosis pathway"Increased miR 155 5p and reduced miR 148a 3p contr ......"27041566



Reported cancer prognosis affected by hsa-miR-148a-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-148a-3p

bladder cancerworse prognosis; poor survival; metastasis; recurrence"MicroRNA 148a represents an independent prognostic ......"26700670
hsa-miR-148a-3p

breast cancerdifferentiation"In order to identify which miRNAs are involved in ......"22562546
hsa-miR-148a-3p

breast cancerstaging"Global miRNA analysis was performed on prospective ......"25004125
hsa-miR-148a-3p

breast cancerimmune evasion"GPER mediated estradiol reduces miR 148a to promot ......"25063027
hsa-miR-148a-3p

breast cancermetastasis; worse prognosis"Based on the results obtained in the last decade s ......"26199650
hsa-miR-148a-3p

breast cancermetastasis"MicroRNA 148a inhibits migration of breast cancer ......"26298724Western blot; Luciferase
hsa-miR-148a-3p

breast cancermetastasis"MicroRNA 148a inhibits breast cancer migration and ......"26707142
hsa-miR-148a-3p

breast cancermetastasis; worse prognosis"MiR 148a functions to suppress metastasis and serv ......"26967387
hsa-miR-148a-3p

chordomaprogression; differentiation"The mRNA level of predicted and confirmed targets ......"27016303
hsa-miR-148a-3p

colon cancerrecurrence"Groups of five patients with and without disease r ......"24400111
hsa-miR-148a-3p

colorectal cancerpoor survival; progression"The aim of this study was to investigate the hyper ......"21610744
hsa-miR-148a-3p

colorectal cancerworse prognosis"This article evaluates a recently published study ......"21902530
hsa-miR-148a-3p

colorectal cancerstaging; poor survival; drug resistance"The clinical significance of MiR 148a as a predict ......"23056401
hsa-miR-148a-3p

colorectal cancerrecurrence"TaqMan® Human MicroRNA Array Set v2.0 was used to ......"23280316
hsa-miR-148a-3p

colorectal cancerstaging"Clinical significance of microRNA 148a in patients ......"23933284
hsa-miR-148a-3p

colorectal cancerprogression; poor survival"High expression of miR-27b miR-148a and miR-326 we ......"24119443
hsa-miR-148a-3p

colorectal cancertumorigenesis; staging; progression"Significance of miR 148a in Colorectal Neoplasia: ......"26389729
hsa-miR-148a-3p

esophageal cancerdifferentiation; recurrence"The expression of miR-21 miR-106a miR-148a miR-205 ......"20628822
hsa-miR-148a-3p

gastric cancermetastasis"Differential expression of miRNAs was studied usin ......"20726036
hsa-miR-148a-3p

gastric cancerprogression; staging"miR 148a promoted cell proliferation by targeting ......"21552422
hsa-miR-148a-3p

gastric cancermetastasis; poor survival"The function of a specific miRNA miR-148a was furt ......"21703006
hsa-miR-148a-3p

gastric cancermetastasis; staging; cell migration; progression"MicroRNA 148a suppresses tumor cell invasion and m ......"21994419Luciferase
hsa-miR-148a-3p

gastric cancermetastasis; staging"In a pilot study serum levels of miR-21 miR-27a mi ......"23806809
hsa-miR-148a-3p

gastric cancerprogression"Quantitative proteomics reveals diverse roles of m ......"23869555
hsa-miR-148a-3p

gastric cancermetastasis; staging; worse prognosis"microRNA 148a suppresses human gastric cancer cell ......"23873106Western blot; Luciferase
hsa-miR-148a-3p

gastric cancerworse prognosis; progression; staging; metastasis"MicroRNA 148a is downregulated in gastric cancer t ......"24283384Western blot
hsa-miR-148a-3p

gastric cancertumorigenesis"MiR 148a regulates MEG3 in gastric cancer by targe ......"24515776
hsa-miR-148a-3p

gastric cancermetastasis"The role of miR 148a in gastric cancer; MiR-148a i ......"24659367
hsa-miR-148a-3p

gastric cancerstaging; metastasis"Impact of miR 148a on the proliferation of gastric ......"25341915Western blot
hsa-miR-148a-3p

gastric cancerworse prognosis"A genetic variant of miR 148a binding site in the ......"25399950Luciferase
hsa-miR-148a-3p

gastric cancerstaging"In the second stage differentially expressed miRNA ......"26172537
hsa-miR-148a-3p

gastric cancerstaging; metastasis"Evaluation of miR 29c miR 124 miR 135a and miR 148 ......"26885198
hsa-miR-148a-3p

gastric cancermetastasis; tumorigenesis"MiR 148a Functions as a Tumor Suppressor by Target ......"27518872Western blot; Luciferase
hsa-miR-148a-3p

glioblastomapoor survival"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-3p

glioblastomapoor survival"Inhibition of two "risky" miRNAs miR-148a and miR- ......"25903473
hsa-miR-148a-3p

liver cancermetastasis"Identification of metastasis related microRNAs of ......"19912688
hsa-miR-148a-3p

liver cancerprogression; cell migration"Role of miR 148a in hepatitis B associated hepatoc ......"22496917Colony formation
hsa-miR-148a-3p

liver cancermetastasis; differentiation"Inhibitions of epithelial to mesenchymal transitio ......"23861222
hsa-miR-148a-3p

liver cancerworse prognosis; poor survival; recurrence; progression"microRNA 148a dysregulation discriminates poor pro ......"24798342
hsa-miR-148a-3p

liver cancerstaging; metastasis; tumorigenesis; worse prognosis"Decreased expression and clinical significance of ......"25444499
hsa-miR-148a-3p

liver cancerpoor survival; staging; metastasis; recurrence; tumorigenesis"Decrease expression and clinicopathological signif ......"26248880
hsa-miR-148a-3p

liver cancermetastasis"After transfection of the HepG2 and SMMC‑7721 HC ......"26530325Western blot; MTT assay; Luciferase
hsa-miR-148a-3p

liver cancerdifferentiation; progression"Differentiation therapy for hepatocellular carcino ......"26599259
hsa-miR-148a-3p

lung squamous cell cancermetastasis"MicroRNA 148a suppresses epithelial to mesenchymal ......"23670799Luciferase
hsa-miR-148a-3p

lung squamous cell cancermetastasis; malignant trasformation; staging"MicroRNA 148a Suppresses Invasion and Metastasis o ......"26584284
hsa-miR-148a-3p

lung squamous cell cancerstaging"The aim of this study was to determine whether cir ......"27461630
hsa-miR-148a-3p

ovarian cancerpoor survival; drug resistance; tumorigenesis"Altered expression of miR 152 and miR 148a in ovar ......"21971665Cell proliferation assay; Cell Proliferation Assay
hsa-miR-148a-3p

ovarian cancerprogression; poor survival"By analyzing multidimensional datasets of ovarian ......"25537514
hsa-miR-148a-3p

ovarian cancercell migration"MicroRNA 148a inhibits migration and invasion of o ......"26004261Western blot; Luciferase; Transwell assay
hsa-miR-148a-3p

ovarian cancermetastasis; worse prognosis; progression; poor survival"Decreased expression of microRNA 148a predicts poo ......"27470550
hsa-miR-148a-3p

pancreatic cancerstaging; differentiation"Expressions of miRNAs were determined with the Taq ......"22851141
hsa-miR-148a-3p

pancreatic cancerstaging"miR 148a and miR 216a regulated oncolytic adenovir ......"24895996
hsa-miR-148a-3p

pancreatic cancermetastasis; tumorigenesis"The Interplay Between miR 148a and DNMT1 Might be ......"25950085
hsa-miR-148a-3p

pancreatic cancertumorigenesis"MicroRNA 148a Suppresses the Proliferation and Mig ......"27518467Cell migration assay
hsa-miR-148a-3p

prostate cancerdrug resistance; cell migration"MiR 148a attenuates paclitaxel resistance of hormo ......"20406806Luciferase
hsa-miR-148a-3p

prostate cancerdrug resistance"To screen for epigenetically silenced miRNAs in pr ......"22310291
hsa-miR-148a-3p

prostate cancerstaging; malignant trasformation"Comparative microRNA profiling of prostate carcino ......"24337069
hsa-miR-148a-3p

prostate cancerstaging; drug resistance"Following global miRNA profiling of cell line mode ......"25053345
hsa-miR-148a-3p

prostate cancerdrug resistance"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-148a-3p

sarcomaworse prognosis; metastasis; tumor size; poor survival; progression"Circulating miR 148a is a significant diagnostic a ......"25185654
hsa-miR-148a-3p

sarcomadifferentiation"Bufalin Inhibits the Differentiation and Prolifera ......"26111756
hsa-miR-148a-3p

sarcomametastasis; worse prognosis; differentiation"Down Regulation of miR 148a Promotes Metastasis by ......"26638007Luciferase



Reported gene related to hsa-miR-148a-3p

miRNAcancergenereportingPUBMED
hsa-miR-148a-3p

bladder cancerDNMT1"miR 148a dependent apoptosis of bladder cancer cel ......"25865490
hsa-miR-148a-3p

gastric cancerDNMT1"Studies have shown that microRNA-148a miR-148a was ......"22167392
hsa-miR-148a-3p

pancreatic cancerDNMT1"The Interplay Between miR 148a and DNMT1 Might be ......"25950085
hsa-miR-148a-3p

sarcomaDNMT1"Moreover we found that miR-148a appeared to be a t ......"26111756
hsa-miR-148a-3p

breast cancerSMAD2"By targeting of the SMAD2-3'-UTR miR-148a blocked ......"25980823
hsa-miR-148a-3p

gastric cancerSMAD2"miR 148a downregulates the expression of transform ......"26983401
hsa-miR-148a-3p

gastric cancerSMAD2"Finally the SMAD2 gene was identified as the direc ......"23873106
hsa-miR-148a-3p

liver cancerSMAD2"MiR-148a which targeted the SMAD2-3'UTR decreased ......"24806207
hsa-miR-148a-3p

breast cancerMMP7"The overexpression of miR-148a reduced the mRNA an ......"26707142
hsa-miR-148a-3p

colorectal cancerMMP7"To further confirm the direct effect of miR-148a o ......"26389729
hsa-miR-148a-3p

gastric cancerMMP7"MicroRNA 148a is downregulated in gastric cancer t ......"24283384
hsa-miR-148a-3p

colorectal cancerBCL2"MiR 148a promotes apoptosis by targeting Bcl 2 in ......"21455217
hsa-miR-148a-3p

pancreatic cancerBCL2"MiR 148a regulates the growth and apoptosis in pan ......"23975374
hsa-miR-148a-3p

gastric cancerCCKBR"More importantly siRNA-induced knockdown of CCK-BR ......"27518872
hsa-miR-148a-3p

pancreatic cancerCCKBR"MiR 148a regulates the growth and apoptosis in pan ......"23975374
hsa-miR-148a-3p

breast cancerGLA"Here we reported that GLA attenuated the CSC-like ......"25980823
hsa-miR-148a-3p

liver cancerGLA"Here we found that GLA attenuated the CSCs-like pr ......"24806207
hsa-miR-148a-3p

breast cancerGPER1"GPER mediated estradiol reduces miR 148a to promot ......"25063027
hsa-miR-148a-3p

breast cancerGPER1"Estradiol induces HOTAIR levels via GPER mediated ......"25928008
hsa-miR-148a-3p

breast cancerHLA-G"GPER mediated estradiol reduces miR 148a to promot ......"25063027
hsa-miR-148a-3p

cervical and endocervical cancerHLA-G"Long non coding RNA HOTAIR modulates HLA G express ......"27574106
hsa-miR-148a-3p

breast cancerHOTAIR"Estradiol induces HOTAIR levels via GPER mediated ......"25928008
hsa-miR-148a-3p

cervical and endocervical cancerHOTAIR"Long non coding RNA HOTAIR modulates HLA G express ......"27574106
hsa-miR-148a-3p

gastric cancerROCK1"MicroRNA 148a suppresses tumor cell invasion and m ......"21994419
hsa-miR-148a-3p

lung squamous cell cancerROCK1"MicroRNA 148a suppresses epithelial to mesenchymal ......"23670799
hsa-miR-148a-3p

breast cancerWNT1"Mechanistically miR-148a appears to suppress the e ......"26967387
hsa-miR-148a-3p

liver cancerWNT1"Via TargetScan and microRNA.org algorithms miR-148 ......"23861222
hsa-miR-148a-3p

prostate cancerAR"We found that androgen receptor is the most freque ......"27292025
hsa-miR-148a-3p

glioblastomaBCL2L11"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-3p

liver cancerCD44"In MHCC97H and MHCC97L cells over-expression of mi ......"23861222
hsa-miR-148a-3p

gastric cancerCDC25B"Gene CDC25B might be the target gene of miR-148a a ......"25341915
hsa-miR-148a-3p

gastric cancerCDH1"miR-148a overexpression also downregulated vimenti ......"23873106
hsa-miR-148a-3p

esophageal cancerCYLD"In EAC miR-148a expression levels were inversely a ......"20628822
hsa-miR-148a-3p

acute myeloid leukemiaDNMT3B"Low ERG expressers presented with down-regulation ......"20841507
hsa-miR-148a-3p

gastric cancerDYNLL1"One miRNA miR-148a was identified and its function ......"21703006
hsa-miR-148a-3p

glioblastomaEGFR"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-3p

pancreatic cancerERBB3"MicroRNA 148a Suppresses the Proliferation and Mig ......"27518467
hsa-miR-148a-3p

acute myeloid leukemiaERG"Low ERG expressers presented with down-regulation ......"20841507
hsa-miR-148a-3p

breast cancerESR1"miR-148a plays an important role in regulation of ......"25063027
hsa-miR-148a-3p

glioblastomaGSC"miR-148a expression was elevated in human glioblas ......"24425048
hsa-miR-148a-3p

gastric cancerMEG3"MiR 148a regulates MEG3 in gastric cancer by targe ......"24515776
hsa-miR-148a-3p

melanomaMITF"miR 148 regulates Mitf in melanoma cells; Furtherm ......"20644734
hsa-miR-148a-3p

breast cancerMMP13"MicroRNA 148a inhibits migration of breast cancer ......"26298724
hsa-miR-148a-3p

ovarian cancerMMP9"Overexpression of miR-148a caused a significant de ......"27712592
hsa-miR-148a-3p

glioblastomaNFASC"NF κB induces miR 148a to sustain TGF β/Smad sig ......"25971746
hsa-miR-148a-3p

breast cancerNRP1"Mechanistically miR-148a appears to suppress the e ......"26967387
hsa-miR-148a-3p

ovarian cancerPDIA3"MicroRNA 148a inhibits the proliferation and promo ......"26004124
hsa-miR-148a-3p

gastric cancerPDYN"Using bioinformatics tools we selected two SNPs SC ......"25399950
hsa-miR-148a-3p

liver cancerPTEN"Introduction of anti-miR-148a increased PTEN prote ......"22496917
hsa-miR-148a-3p

prostate cancerRPS6KA5"MiR 148a attenuates paclitaxel resistance of hormo ......"20406806
hsa-miR-148a-3p

gastric cancerRUNX3"We investigated the role of microRNA-148a miR-148a ......"23549984
hsa-miR-148a-3p

liver cancerS1PR1"USP4 and S1P1 were up-regulated in mesenchymal-typ ......"24798342
hsa-miR-148a-3p

gastric cancerSCRN1"A genetic variant of miR 148a binding site in the ......"25399950
hsa-miR-148a-3p

gastric cancerSMAD4"In GC cell lines we constructed and transfected a ......"26983401
hsa-miR-148a-3p

gastric cancerSTAT3"Taken together our results suggest that miR-148a s ......"27518872
hsa-miR-148a-3p

gastric cancerTCF3"MicroRNA 148a can regulate runt related transcript ......"23549984
hsa-miR-148a-3p

breast cancerTCF7L2"The overexpression of miR-148a reduced the mRNA an ......"26707142
hsa-miR-148a-3p

sarcomaTGIF2"Down Regulation of miR 148a Promotes Metastasis by ......"26638007
hsa-miR-148a-3p

gastric cancerTHBS1"Using the TSP algorithm hsa-miR-196a and hsa-miR-1 ......"24527072
hsa-miR-148a-3p

liver cancerTHY1"In MHCC97H and MHCC97L cells over-expression of mi ......"23861222
hsa-miR-148a-3p

liver cancerUSP4"microRNA 148a dysregulation discriminates poor pro ......"24798342
hsa-miR-148a-3p

gastric cancerVIM"miR-148a overexpression also downregulated vimenti ......"23873106
hsa-miR-148a-3p

liver cancerVWCE"HBx and URG11 also alter the expression of multipl ......"22496917



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-148a-3p
ACVR1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.111; TCGA CESC -0.098; TCGA COAD -0.162; TCGA ESCA -0.137; TCGA HNSC -0.159; TCGA LIHC -0.128; TCGA LUAD -0.058; TCGA LUSC -0.074; TCGA PAAD -0.136; TCGA PRAD -0.176; TCGA SARC -0.092; TCGA THCA -0.314; TCGA STAD -0.106
hsa-miR-148a-3p
ADARB1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; mirMAP
TCGA BLCA -0.308; TCGA BRCA -0.081; TCGA COAD -0.353; TCGA HNSC -0.165; TCGA KIRC -0.168; TCGA LUAD -0.141; TCGA LUSC -0.131; TCGA THCA -0.188; TCGA STAD -0.327; TCGA UCEC -0.162
hsa-miR-148a-3p
CCNI
9 cancers: BLCA; CESC; LGG; LUAD; OV; PRAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.09; TCGA CESC -0.117; TCGA LGG -0.082; TCGA LUAD -0.072; TCGA OV -0.075; TCGA PRAD -0.106; TCGA SARC -0.076; TCGA THCA -0.13; TCGA STAD -0.114
hsa-miR-148a-3p
DNAJB4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.178; TCGA BRCA -0.061; TCGA CESC -0.13; TCGA COAD -0.341; TCGA ESCA -0.206; TCGA HNSC -0.156; TCGA LUAD -0.218; TCGA LUSC -0.223; TCGA OV -0.075; TCGA PRAD -0.586; TCGA SARC -0.118; TCGA STAD -0.347; TCGA UCEC -0.163
hsa-miR-148a-3p
DSTYK
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.089; TCGA CESC -0.11; TCGA COAD -0.119; TCGA ESCA -0.083; TCGA HNSC -0.056; TCGA KIRC -0.08; TCGA LIHC -0.2; TCGA LUAD -0.078; TCGA LUSC -0.097; TCGA PRAD -0.112; TCGA THCA -0.089; TCGA STAD -0.203
hsa-miR-148a-3p
GNB5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.089; TCGA BRCA -0.083; TCGA CESC -0.097; TCGA COAD -0.383; TCGA ESCA -0.177; TCGA HNSC -0.116; TCGA KIRC -0.12; TCGA LGG -0.05; TCGA LUAD -0.052; TCGA PRAD -0.294; TCGA SARC -0.175; TCGA THCA -0.089; TCGA STAD -0.2
hsa-miR-148a-3p
IRS1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; STAD
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.135; TCGA BRCA -0.3; TCGA COAD -0.393; TCGA ESCA -0.169; TCGA HNSC -0.354; TCGA LGG -0.052; TCGA LUAD -0.21; TCGA OV -0.157; TCGA PAAD -0.188; TCGA PRAD -0.194; TCGA STAD -0.215
hsa-miR-148a-3p
MTMR9
15 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.138; TCGA BRCA -0.092; TCGA COAD -0.222; TCGA KIRC -0.126; TCGA LGG -0.107; TCGA LIHC -0.071; TCGA LUAD -0.124; TCGA LUSC -0.083; TCGA OV -0.104; TCGA PAAD -0.082; TCGA PRAD -0.153; TCGA SARC -0.073; TCGA THCA -0.064; TCGA STAD -0.216; TCGA UCEC -0.108
hsa-miR-148a-3p
PRNP
11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.198; TCGA COAD -0.46; TCGA ESCA -0.436; TCGA HNSC -0.291; TCGA LIHC -0.397; TCGA LUAD -0.066; TCGA PAAD -0.113; TCGA PRAD -0.36; TCGA THCA -0.245; TCGA STAD -0.368; TCGA UCEC -0.293
hsa-miR-148a-3p
RASSF8
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.101; TCGA CESC -0.226; TCGA COAD -0.606; TCGA ESCA -0.217; TCGA LIHC -0.252; TCGA LUAD -0.271; TCGA PRAD -0.238; TCGA SARC -0.102; TCGA THCA -0.149; TCGA STAD -0.519
hsa-miR-148a-3p
SESTD1
15 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.082; TCGA CESC -0.152; TCGA COAD -0.104; TCGA KIRC -0.17; TCGA KIRP -0.172; TCGA LIHC -0.109; TCGA LUAD -0.112; TCGA LUSC -0.134; TCGA OV -0.141; TCGA PAAD -0.184; TCGA PRAD -0.246; TCGA SARC -0.106; TCGA THCA -0.144; TCGA STAD -0.252
hsa-miR-148a-3p
MNT
10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.052; TCGA COAD -0.072; TCGA ESCA -0.135; TCGA HNSC -0.085; TCGA LIHC -0.135; TCGA LUSC -0.082; TCGA OV -0.063; TCGA PAAD -0.095; TCGA THCA -0.135; TCGA STAD -0.077
hsa-miR-148a-3p
RBM24
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.451; TCGA BRCA -0.738; TCGA COAD -0.595; TCGA ESCA -0.31; TCGA HNSC -0.464; TCGA PAAD -0.404; TCGA PRAD -0.438; TCGA SARC -0.642; TCGA STAD -0.712; TCGA UCEC -0.154
hsa-miR-148a-3p
MTSS1L
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.197; TCGA BRCA -0.072; TCGA CESC -0.185; TCGA COAD -0.153; TCGA ESCA -0.302; TCGA HNSC -0.078; TCGA KIRC -0.115; TCGA LGG -0.161; TCGA OV -0.08; TCGA PAAD -0.206; TCGA PRAD -0.264; TCGA SARC -0.235; TCGA THCA -0.191; TCGA STAD -0.367
hsa-miR-148a-3p
FAM168B
10 cancers: BLCA; CESC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.145; TCGA CESC -0.079; TCGA LGG -0.05; TCGA LUAD -0.074; TCGA LUSC -0.06; TCGA OV -0.099; TCGA PRAD -0.108; TCGA SARC -0.084; TCGA THCA -0.052; TCGA STAD -0.157
hsa-miR-148a-3p
PITPNM2
10 cancers: BLCA; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.254; TCGA ESCA -0.109; TCGA HNSC -0.208; TCGA KIRP -0.091; TCGA LUAD -0.123; TCGA LUSC -0.223; TCGA PRAD -0.311; TCGA SARC -0.095; TCGA STAD -0.252; TCGA UCEC -0.107
hsa-miR-148a-3p
TGFB2
9 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.286; TCGA COAD -0.463; TCGA ESCA -0.22; TCGA KIRC -0.247; TCGA LIHC -0.661; TCGA LUAD -0.319; TCGA PRAD -0.346; TCGA THCA -0.286; TCGA STAD -0.322
hsa-miR-148a-3p
PTPN14
13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.129; TCGA COAD -0.255; TCGA ESCA -0.199; TCGA HNSC -0.138; TCGA KIRC -0.138; TCGA LIHC -0.431; TCGA LUAD -0.189; TCGA OV -0.126; TCGA PAAD -0.171; TCGA PRAD -0.334; TCGA SARC -0.118; TCGA THCA -0.309; TCGA STAD -0.303
hsa-miR-148a-3p
EPN2
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.108; TCGA CESC -0.118; TCGA COAD -0.119; TCGA ESCA -0.226; TCGA HNSC -0.066; TCGA KIRC -0.189; TCGA KIRP -0.249; TCGA LGG -0.145; TCGA LIHC -0.116; TCGA LUAD -0.143; TCGA LUSC -0.173; TCGA OV -0.074; TCGA PAAD -0.062; TCGA SARC -0.235; TCGA THCA -0.145; TCGA STAD -0.217; TCGA UCEC -0.056
hsa-miR-148a-3p
CYTH3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.144; TCGA COAD -0.247; TCGA ESCA -0.104; TCGA HNSC -0.189; TCGA KIRC -0.174; TCGA KIRP -0.099; TCGA LIHC -0.288; TCGA LUSC -0.095; TCGA PAAD -0.13; TCGA STAD -0.201; TCGA UCEC -0.106
hsa-miR-148a-3p
WDR47
11 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.098; TCGA CESC -0.156; TCGA COAD -0.14; TCGA ESCA -0.193; TCGA LIHC -0.087; TCGA LUAD -0.083; TCGA PAAD -0.115; TCGA PRAD -0.228; TCGA SARC -0.089; TCGA STAD -0.185; TCGA UCEC -0.109
hsa-miR-148a-3p
PRICKLE2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.183; TCGA BRCA -0.137; TCGA COAD -0.545; TCGA HNSC -0.101; TCGA KIRC -0.098; TCGA LIHC -0.362; TCGA LUAD -0.09; TCGA PAAD -0.127; TCGA PRAD -0.69; TCGA SARC -0.108; TCGA STAD -0.6
hsa-miR-148a-3p
ABCA1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.146; TCGA COAD -0.3; TCGA ESCA -0.2; TCGA HNSC -0.164; TCGA LUAD -0.144; TCGA LUSC -0.104; TCGA PAAD -0.158; TCGA THCA -0.254; TCGA STAD -0.184; TCGA UCEC -0.068
hsa-miR-148a-3p
ERRFI1
12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.253; TCGA CESC -0.158; TCGA COAD -0.238; TCGA HNSC -0.082; TCGA KIRP -0.212; TCGA LUAD -0.199; TCGA LUSC -0.304; TCGA OV -0.155; TCGA PAAD -0.258; TCGA PRAD -0.162; TCGA THCA -0.213; TCGA STAD -0.262
hsa-miR-148a-3p
CTTNBP2NL
15 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.071; TCGA CESC -0.111; TCGA ESCA -0.069; TCGA HNSC -0.066; TCGA KIRC -0.077; TCGA KIRP -0.108; TCGA LIHC -0.4; TCGA LUAD -0.119; TCGA LUSC -0.062; TCGA OV -0.099; TCGA PAAD -0.085; TCGA PRAD -0.178; TCGA THCA -0.119; TCGA STAD -0.139; TCGA UCEC -0.051
hsa-miR-148a-3p
GPRC5A
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA
MirTarget
TCGA BLCA -0.271; TCGA CESC -0.279; TCGA COAD -0.301; TCGA HNSC -0.215; TCGA KIRC -0.345; TCGA LIHC -0.648; TCGA LUAD -0.331; TCGA LUSC -0.307; TCGA PRAD -0.28; TCGA THCA -0.188
hsa-miR-148a-3p
DNAJC18
12 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.127; TCGA BRCA -0.133; TCGA COAD -0.164; TCGA KIRC -0.068; TCGA LGG -0.094; TCGA LIHC -0.482; TCGA LUSC -0.106; TCGA PRAD -0.348; TCGA SARC -0.051; TCGA THCA -0.11; TCGA STAD -0.298; TCGA UCEC -0.114
hsa-miR-148a-3p
SLC24A3
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.302; TCGA BRCA -0.175; TCGA COAD -0.664; TCGA HNSC -0.203; TCGA KIRC -0.326; TCGA LGG -0.216; TCGA LIHC -0.89; TCGA PAAD -0.185; TCGA PRAD -0.643; TCGA SARC -0.496; TCGA STAD -0.256; TCGA UCEC -0.133
hsa-miR-148a-3p
ATP2B4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.338; TCGA BRCA -0.086; TCGA CESC -0.109; TCGA COAD -0.608; TCGA ESCA -0.257; TCGA LIHC -0.111; TCGA PAAD -0.241; TCGA PRAD -0.771; TCGA SARC -0.21; TCGA THCA -0.215; TCGA STAD -0.512
hsa-miR-148a-3p
CLCN6
10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.06; TCGA BRCA -0.128; TCGA COAD -0.086; TCGA KIRC -0.108; TCGA LGG -0.054; TCGA LUSC -0.125; TCGA PAAD -0.09; TCGA SARC -0.058; TCGA STAD -0.171; TCGA UCEC -0.088
hsa-miR-148a-3p
ARPP19
12 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.069; TCGA CESC -0.099; TCGA ESCA -0.081; TCGA HNSC -0.073; TCGA LUAD -0.118; TCGA LUSC -0.052; TCGA OV -0.058; TCGA PAAD -0.061; TCGA PRAD -0.129; TCGA SARC -0.158; TCGA THCA -0.079; TCGA STAD -0.165
hsa-miR-148a-3p
NPTN
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.131; TCGA CESC -0.131; TCGA COAD -0.087; TCGA ESCA -0.099; TCGA HNSC -0.052; TCGA LIHC -0.079; TCGA LUAD -0.067; TCGA LUSC -0.068; TCGA PAAD -0.109; TCGA PRAD -0.293; TCGA SARC -0.143; TCGA THCA -0.093; TCGA STAD -0.146
hsa-miR-148a-3p
UBE2D1
12 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.072; TCGA CESC -0.098; TCGA ESCA -0.141; TCGA HNSC -0.116; TCGA LIHC -0.171; TCGA LUAD -0.056; TCGA LUSC -0.105; TCGA OV -0.056; TCGA PAAD -0.083; TCGA THCA -0.06; TCGA STAD -0.138; TCGA UCEC -0.089
hsa-miR-148a-3p
ARHGEF12
9 cancers: BLCA; COAD; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.093; TCGA COAD -0.077; TCGA LUAD -0.108; TCGA LUSC -0.063; TCGA OV -0.071; TCGA PRAD -0.106; TCGA SARC -0.088; TCGA THCA -0.147; TCGA STAD -0.123
hsa-miR-148a-3p
B4GALT5
11 cancers: BLCA; CESC; COAD; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.104; TCGA CESC -0.16; TCGA COAD -0.086; TCGA LIHC -0.327; TCGA LUAD -0.131; TCGA LUSC -0.142; TCGA OV -0.13; TCGA PAAD -0.176; TCGA PRAD -0.248; TCGA THCA -0.267; TCGA UCEC -0.058
hsa-miR-148a-3p
SYNC
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.279; TCGA BRCA -0.131; TCGA COAD -0.934; TCGA ESCA -0.402; TCGA HNSC -0.238; TCGA KIRC -0.383; TCGA LIHC -0.607; TCGA LUSC -0.292; TCGA PRAD -0.3; TCGA SARC -0.297; TCGA STAD -0.218; TCGA UCEC -0.263
hsa-miR-148a-3p
HOMER1
10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.096; TCGA CESC -0.172; TCGA ESCA -0.257; TCGA HNSC -0.2; TCGA LIHC -0.667; TCGA LUAD -0.228; TCGA LUSC -0.108; TCGA PAAD -0.161; TCGA THCA -0.074; TCGA STAD -0.185
hsa-miR-148a-3p
SBF2
10 cancers: BLCA; BRCA; CESC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.064; TCGA CESC -0.116; TCGA LGG -0.069; TCGA LUAD -0.111; TCGA PAAD -0.08; TCGA PRAD -0.106; TCGA SARC -0.079; TCGA THCA -0.141; TCGA STAD -0.193
hsa-miR-148a-3p
STK38L
10 cancers: BLCA; CESC; ESCA; KIRC; LIHC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.109; TCGA CESC -0.11; TCGA ESCA -0.101; TCGA KIRC -0.106; TCGA LIHC -0.168; TCGA LUAD -0.077; TCGA PRAD -0.17; TCGA SARC -0.141; TCGA STAD -0.174; TCGA UCEC -0.069
hsa-miR-148a-3p
EGR3
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.224; TCGA BRCA -0.325; TCGA COAD -0.403; TCGA ESCA -0.185; TCGA KIRC -0.223; TCGA LIHC -0.209; TCGA PRAD -0.321; TCGA THCA -0.199; TCGA STAD -0.145
hsa-miR-148a-3p
MAFG
12 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.098; TCGA BRCA -0.104; TCGA ESCA -0.098; TCGA HNSC -0.064; TCGA LIHC -0.168; TCGA LUAD -0.099; TCGA LUSC -0.118; TCGA OV -0.081; TCGA PAAD -0.132; TCGA PRAD -0.114; TCGA SARC -0.086; TCGA STAD -0.094
hsa-miR-148a-3p
ITPK1
9 cancers: BLCA; BRCA; HNSC; LGG; LUSC; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.18; TCGA HNSC -0.091; TCGA LGG -0.077; TCGA LUSC -0.103; TCGA PRAD -0.059; TCGA SARC -0.148; TCGA THCA -0.183; TCGA UCEC -0.057
hsa-miR-148a-3p
DMPK
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.231; TCGA BRCA -0.211; TCGA COAD -0.168; TCGA ESCA -0.139; TCGA HNSC -0.127; TCGA KIRC -0.239; TCGA KIRP -0.252; TCGA LIHC -0.308; TCGA LUAD -0.072; TCGA PRAD -0.344; TCGA SARC -0.269; TCGA STAD -0.546; TCGA UCEC -0.073
hsa-miR-148a-3p
TEAD1
12 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.251; TCGA BRCA -0.08; TCGA COAD -0.139; TCGA HNSC -0.098; TCGA LUAD -0.141; TCGA LUSC -0.11; TCGA PAAD -0.132; TCGA PRAD -0.428; TCGA SARC -0.136; TCGA THCA -0.191; TCGA STAD -0.409; TCGA UCEC -0.085
hsa-miR-148a-3p
CFL2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.314; TCGA BRCA -0.157; TCGA COAD -0.59; TCGA ESCA -0.122; TCGA HNSC -0.143; TCGA LUAD -0.18; TCGA LUSC -0.223; TCGA PRAD -0.535; TCGA SARC -0.395; TCGA STAD -0.595; TCGA UCEC -0.254
hsa-miR-148a-3p
ZDHHC7
9 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD
MirTarget; miRNATAP
TCGA BLCA -0.066; TCGA CESC -0.081; TCGA HNSC -0.053; TCGA KIRP -0.087; TCGA LIHC -0.349; TCGA LUAD -0.062; TCGA LUSC -0.094; TCGA PAAD -0.132; TCGA PRAD -0.062
hsa-miR-148a-3p
PPP1R12A
12 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.205; TCGA COAD -0.123; TCGA ESCA -0.127; TCGA LGG -0.073; TCGA LIHC -0.102; TCGA LUAD -0.084; TCGA LUSC -0.053; TCGA PAAD -0.093; TCGA PRAD -0.323; TCGA SARC -0.242; TCGA STAD -0.343; TCGA UCEC -0.054
hsa-miR-148a-3p
TPPP
9 cancers: BLCA; BRCA; COAD; KIRC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.375; TCGA BRCA -0.355; TCGA COAD -0.342; TCGA KIRC -0.224; TCGA LUSC -0.192; TCGA PRAD -0.152; TCGA SARC -0.531; TCGA STAD -0.216; TCGA UCEC -0.228
hsa-miR-148a-3p
LTBP1
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.123; TCGA COAD -0.531; TCGA ESCA -0.328; TCGA HNSC -0.246; TCGA KIRC -0.228; TCGA PAAD -0.17; TCGA PRAD -0.458; TCGA SARC -0.174; TCGA THCA -0.392; TCGA STAD -0.409
hsa-miR-148a-3p
ARHGAP21
9 cancers: BLCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.09; TCGA CESC -0.157; TCGA HNSC -0.093; TCGA LUAD -0.126; TCGA LUSC -0.098; TCGA PAAD -0.089; TCGA PRAD -0.072; TCGA SARC -0.11; TCGA STAD -0.055
hsa-miR-148a-3p
STXBP1
9 cancers: BLCA; BRCA; LGG; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.135; TCGA BRCA -0.152; TCGA LGG -0.162; TCGA LUSC -0.162; TCGA OV -0.128; TCGA PRAD -0.137; TCGA SARC -0.057; TCGA STAD -0.133; TCGA UCEC -0.089
hsa-miR-148a-3p
PDE5A
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.24; TCGA BRCA -0.311; TCGA COAD -0.379; TCGA KIRC -0.229; TCGA LIHC -0.553; TCGA LUAD -0.214; TCGA PRAD -0.686; TCGA SARC -0.405; TCGA THCA -0.914; TCGA STAD -0.45
hsa-miR-148a-3p
PITPNM3
13 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.224; TCGA CESC -0.184; TCGA ESCA -0.399; TCGA KIRC -0.498; TCGA KIRP -0.215; TCGA LIHC -0.339; TCGA LUAD -0.118; TCGA OV -0.187; TCGA PAAD -0.185; TCGA PRAD -0.434; TCGA SARC -0.441; TCGA THCA -0.119; TCGA STAD -0.5
hsa-miR-148a-3p
SRF
9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.11; TCGA COAD -0.071; TCGA ESCA -0.115; TCGA LUAD -0.094; TCGA LUSC -0.084; TCGA PRAD -0.238; TCGA SARC -0.221; TCGA STAD -0.25; TCGA UCEC -0.091
hsa-miR-148a-3p
CHD5
10 cancers: BLCA; COAD; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.248; TCGA COAD -0.554; TCGA KIRC -0.716; TCGA KIRP -0.455; TCGA LUSC -0.251; TCGA PRAD -0.774; TCGA SARC -0.447; TCGA THCA -0.191; TCGA STAD -0.632; TCGA UCEC -0.19
hsa-miR-148a-3p
ESYT2
12 cancers: BLCA; CESC; ESCA; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.139; TCGA CESC -0.088; TCGA ESCA -0.122; TCGA KIRP -0.099; TCGA LUAD -0.089; TCGA LUSC -0.134; TCGA OV -0.072; TCGA PAAD -0.131; TCGA PRAD -0.083; TCGA SARC -0.212; TCGA STAD -0.19; TCGA UCEC -0.052
hsa-miR-148a-3p
SEPT7
9 cancers: BLCA; CESC; ESCA; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.076; TCGA CESC -0.06; TCGA ESCA -0.087; TCGA LIHC -0.065; TCGA LUAD -0.051; TCGA PAAD -0.124; TCGA PRAD -0.148; TCGA STAD -0.19; TCGA UCEC -0.095
hsa-miR-148a-3p
CHST3
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; STAD
mirMAP
TCGA BLCA -0.244; TCGA COAD -0.66; TCGA ESCA -0.204; TCGA HNSC -0.153; TCGA KIRC -0.14; TCGA KIRP -0.186; TCGA LGG -0.158; TCGA LIHC -0.544; TCGA LUAD -0.209; TCGA PRAD -0.604; TCGA STAD -0.373
hsa-miR-148a-3p
SCRN1
10 cancers: BLCA; COAD; HNSC; KIRC; LIHC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.101; TCGA COAD -0.376; TCGA HNSC -0.096; TCGA KIRC -0.186; TCGA LIHC -0.566; TCGA PAAD -0.136; TCGA PRAD -0.523; TCGA THCA -0.238; TCGA STAD -0.343; TCGA UCEC -0.166
hsa-miR-148a-3p
KIAA1644
11 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.47; TCGA COAD -1.078; TCGA ESCA -0.436; TCGA HNSC -0.379; TCGA LGG -0.369; TCGA LIHC -0.61; TCGA OV -0.474; TCGA PAAD -0.304; TCGA PRAD -0.811; TCGA STAD -0.645; TCGA UCEC -0.212
hsa-miR-148a-3p
WNT9A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.271; TCGA BRCA -0.298; TCGA CESC -0.433; TCGA COAD -0.727; TCGA ESCA -0.62; TCGA LGG -0.197; TCGA LUAD -0.118; TCGA LUSC -0.196; TCGA PRAD -0.256; TCGA STAD -0.744; TCGA UCEC -0.134
hsa-miR-148a-3p
EXOC6B
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.164; TCGA CESC -0.217; TCGA COAD -0.131; TCGA ESCA -0.164; TCGA HNSC -0.204; TCGA LUAD -0.208; TCGA PRAD -0.347; TCGA SARC -0.155; TCGA THCA -0.197; TCGA STAD -0.131
hsa-miR-148a-3p
GFOD1
10 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.168; TCGA ESCA -0.237; TCGA HNSC -0.25; TCGA KIRC -0.172; TCGA LUAD -0.124; TCGA PAAD -0.161; TCGA PRAD -0.409; TCGA SARC -0.115; TCGA STAD -0.41; TCGA UCEC -0.158
hsa-miR-148a-3p
RNF217
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.181; TCGA CESC -0.232; TCGA COAD -0.454; TCGA ESCA -0.422; TCGA HNSC -0.253; TCGA KIRC -0.087; TCGA PAAD -0.163; TCGA PRAD -0.29; TCGA SARC -0.13; TCGA THCA -0.083; TCGA STAD -0.337
hsa-miR-148a-3p
PLXDC1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.124; TCGA BRCA -0.176; TCGA COAD -0.339; TCGA ESCA -0.177; TCGA HNSC -0.127; TCGA LIHC -0.884; TCGA PAAD -0.11; TCGA PRAD -0.149; TCGA THCA -0.232; TCGA STAD -0.178
hsa-miR-148a-3p
ADCY9
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.199; TCGA BRCA -0.132; TCGA COAD -0.099; TCGA ESCA -0.094; TCGA LUAD -0.087; TCGA PRAD -0.288; TCGA SARC -0.137; TCGA STAD -0.212; TCGA UCEC -0.392
hsa-miR-148a-3p
ELFN2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; OV; PAAD; THCA; UCEC
mirMAP
TCGA BLCA -0.314; TCGA BRCA -0.372; TCGA COAD -0.642; TCGA HNSC -0.281; TCGA KIRP -0.289; TCGA LGG -0.512; TCGA LIHC -0.483; TCGA OV -0.462; TCGA PAAD -0.363; TCGA THCA -1.396; TCGA UCEC -0.443
hsa-miR-148a-3p
IGF2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; OV; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.414; TCGA BRCA -0.483; TCGA COAD -0.605; TCGA ESCA -0.328; TCGA HNSC -0.248; TCGA KIRC -0.654; TCGA OV -0.577; TCGA PRAD -0.422; TCGA THCA -0.301; TCGA STAD -0.394; TCGA UCEC -0.235
hsa-miR-148a-3p
SYNPO
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.205; TCGA BRCA -0.226; TCGA COAD -0.319; TCGA HNSC -0.139; TCGA LUAD -0.111; TCGA PRAD -0.445; TCGA SARC -0.155; TCGA THCA -0.336; TCGA STAD -0.179
hsa-miR-148a-3p
ZHX3
9 cancers: BLCA; BRCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.123; TCGA HNSC -0.163; TCGA KIRC -0.112; TCGA LUAD -0.088; TCGA LUSC -0.109; TCGA PRAD -0.06; TCGA STAD -0.242; TCGA UCEC -0.075
hsa-miR-148a-3p
ARL10
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.149; TCGA BRCA -0.111; TCGA COAD -0.498; TCGA ESCA -0.291; TCGA HNSC -0.108; TCGA LGG -0.115; TCGA PAAD -0.164; TCGA PRAD -0.562; TCGA THCA -0.231; TCGA STAD -0.323; TCGA UCEC -0.124
hsa-miR-148a-3p
LYNX1
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; OV; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.402; TCGA COAD -0.881; TCGA ESCA -0.366; TCGA HNSC -0.19; TCGA KIRC -0.154; TCGA OV -0.306; TCGA PRAD -0.41; TCGA SARC -0.36; TCGA THCA -0.208; TCGA STAD -0.509
hsa-miR-148a-3p
KCTD2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.075; TCGA BRCA -0.119; TCGA COAD -0.119; TCGA ESCA -0.053; TCGA HNSC -0.078; TCGA KIRC -0.062; TCGA KIRP -0.143; TCGA LIHC -0.141; TCGA LUAD -0.116; TCGA LUSC -0.078; TCGA PRAD -0.061; TCGA STAD -0.095; TCGA UCEC -0.07
hsa-miR-148a-3p
MXRA7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.289; TCGA BRCA -0.228; TCGA CESC -0.166; TCGA COAD -0.47; TCGA ESCA -0.324; TCGA HNSC -0.149; TCGA LIHC -0.327; TCGA LUAD -0.199; TCGA OV -0.101; TCGA PAAD -0.126; TCGA PRAD -0.535; TCGA SARC -0.205; TCGA THCA -0.09; TCGA STAD -0.47; TCGA UCEC -0.115
hsa-miR-148a-3p
BCL9L
12 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.073; TCGA COAD -0.258; TCGA ESCA -0.107; TCGA HNSC -0.16; TCGA LGG -0.114; TCGA LIHC -0.253; TCGA LUAD -0.14; TCGA PAAD -0.163; TCGA PRAD -0.081; TCGA SARC -0.074; TCGA THCA -0.138; TCGA STAD -0.104
hsa-miR-148a-3p
TECPR2
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.119; TCGA COAD -0.083; TCGA ESCA -0.066; TCGA HNSC -0.065; TCGA KIRC -0.105; TCGA LUSC -0.067; TCGA PRAD -0.134; TCGA THCA -0.061; TCGA STAD -0.164
hsa-miR-148a-3p
MYO5A
9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.109; TCGA COAD -0.552; TCGA ESCA -0.358; TCGA HNSC -0.291; TCGA LGG -0.114; TCGA LIHC -0.345; TCGA PRAD -0.118; TCGA STAD -0.174; TCGA UCEC -0.068
hsa-miR-148a-3p
BMPR2
10 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.117; TCGA COAD -0.15; TCGA HNSC -0.095; TCGA KIRC -0.078; TCGA LUAD -0.163; TCGA LUSC -0.17; TCGA PAAD -0.129; TCGA PRAD -0.18; TCGA THCA -0.121; TCGA STAD -0.182
hsa-miR-148a-3p
MITF
10 cancers: BLCA; BRCA; COAD; KIRP; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.204; TCGA BRCA -0.085; TCGA COAD -0.785; TCGA KIRP -0.172; TCGA LIHC -0.468; TCGA PRAD -0.411; TCGA SARC -0.218; TCGA THCA -0.142; TCGA STAD -0.313; TCGA UCEC -0.1
hsa-miR-148a-3p
ITGA5
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.335; TCGA BRCA -0.096; TCGA COAD -0.726; TCGA ESCA -0.271; TCGA HNSC -0.461; TCGA LIHC -0.308; TCGA LUAD -0.191; TCGA LUSC -0.161; TCGA PAAD -0.288; TCGA PRAD -0.546; TCGA SARC -0.201; TCGA THCA -0.079; TCGA STAD -0.397
hsa-miR-148a-3p
KLF6
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.089; TCGA BRCA -0.136; TCGA CESC -0.171; TCGA COAD -0.147; TCGA ESCA -0.102; TCGA HNSC -0.109; TCGA KIRC -0.113; TCGA LUAD -0.229; TCGA LUSC -0.2; TCGA PAAD -0.191; TCGA PRAD -0.254; TCGA THCA -0.14; TCGA STAD -0.083; TCGA UCEC -0.11
hsa-miR-148a-3p
DTNA
10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.302; TCGA BRCA -0.206; TCGA COAD -0.737; TCGA ESCA -0.262; TCGA LIHC -0.419; TCGA PRAD -0.592; TCGA SARC -0.494; TCGA THCA -0.095; TCGA STAD -0.617; TCGA UCEC -0.273
hsa-miR-148a-3p
ADAMTS5
10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.212; TCGA COAD -0.352; TCGA HNSC -0.168; TCGA LGG -0.132; TCGA LIHC -0.307; TCGA PAAD -0.171; TCGA PRAD -0.798; TCGA STAD -0.215; TCGA UCEC -0.162
hsa-miR-148a-3p
SERPINE1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.194; TCGA BRCA -0.108; TCGA COAD -0.633; TCGA ESCA -0.437; TCGA HNSC -0.589; TCGA LIHC -0.209; TCGA PAAD -0.237; TCGA PRAD -0.213; TCGA THCA -0.303; TCGA STAD -0.199
hsa-miR-148a-3p
KCNQ5
10 cancers: BLCA; COAD; ESCA; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.263; TCGA COAD -0.832; TCGA ESCA -0.639; TCGA KIRP -0.256; TCGA LGG -0.316; TCGA PRAD -0.778; TCGA SARC -0.212; TCGA THCA -0.229; TCGA STAD -0.371; TCGA UCEC -0.201
hsa-miR-148a-3p
EPAS1
9 cancers: BLCA; BRCA; COAD; KIRC; LUAD; LUSC; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.159; TCGA BRCA -0.182; TCGA COAD -0.165; TCGA KIRC -0.198; TCGA LUAD -0.29; TCGA LUSC -0.167; TCGA PRAD -0.381; TCGA SARC -0.146; TCGA STAD -0.075
hsa-miR-148a-3p
NFAT5
10 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.103; TCGA HNSC -0.08; TCGA KIRC -0.125; TCGA KIRP -0.124; TCGA LUAD -0.065; TCGA LUSC -0.153; TCGA PAAD -0.079; TCGA PRAD -0.152; TCGA THCA -0.098; TCGA STAD -0.2
hsa-miR-148a-3p
AHDC1
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.159; TCGA CESC -0.117; TCGA COAD -0.259; TCGA ESCA -0.156; TCGA KIRC -0.169; TCGA KIRP -0.108; TCGA LIHC -0.118; TCGA PAAD -0.114; TCGA PRAD -0.298; TCGA SARC -0.067; TCGA THCA -0.112; TCGA STAD -0.237
hsa-miR-148a-3p
NRP1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.103; TCGA COAD -0.502; TCGA ESCA -0.16; TCGA HNSC -0.163; TCGA KIRP -0.118; TCGA LIHC -0.189; TCGA LUAD -0.14; TCGA LUSC -0.125; TCGA PRAD -0.198; TCGA THCA -0.099; TCGA STAD -0.166; TCGA UCEC -0.136
hsa-miR-148a-3p
PPP1CB
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; OV; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.095; TCGA CESC -0.109; TCGA ESCA -0.148; TCGA HNSC -0.073; TCGA KIRP -0.058; TCGA LUAD -0.076; TCGA OV -0.073; TCGA SARC -0.126; TCGA THCA -0.113; TCGA STAD -0.188
hsa-miR-148a-3p
MECP2
12 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.074; TCGA BRCA -0.09; TCGA COAD -0.075; TCGA KIRC -0.088; TCGA LIHC -0.108; TCGA LUAD -0.058; TCGA OV -0.06; TCGA PRAD -0.17; TCGA SARC -0.082; TCGA THCA -0.06; TCGA STAD -0.169; TCGA UCEC -0.072
hsa-miR-148a-3p
ARHGEF17
14 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.244; TCGA BRCA -0.099; TCGA COAD -0.556; TCGA KIRC -0.15; TCGA LGG -0.087; TCGA LIHC -0.457; TCGA LUSC -0.173; TCGA OV -0.107; TCGA PAAD -0.192; TCGA PRAD -0.46; TCGA SARC -0.232; TCGA THCA -0.11; TCGA STAD -0.384; TCGA UCEC -0.108
hsa-miR-148a-3p
AP4E1
9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.08; TCGA ESCA -0.082; TCGA HNSC -0.158; TCGA LUAD -0.097; TCGA LUSC -0.067; TCGA PRAD -0.186; TCGA SARC -0.071; TCGA THCA -0.101; TCGA STAD -0.112
hsa-miR-148a-3p
OTUD4
9 cancers: BLCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.079; TCGA HNSC -0.072; TCGA KIRP -0.078; TCGA LUAD -0.098; TCGA LUSC -0.069; TCGA OV -0.075; TCGA PRAD -0.151; TCGA THCA -0.102; TCGA STAD -0.115
hsa-miR-148a-3p
ZFPM2
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.324; TCGA BRCA -0.226; TCGA COAD -0.882; TCGA ESCA -0.194; TCGA LGG -0.159; TCGA LIHC -0.169; TCGA LUAD -0.128; TCGA PAAD -0.229; TCGA PRAD -0.683; TCGA STAD -0.548; TCGA UCEC -0.164
hsa-miR-148a-3p
CNN1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.595; TCGA BRCA -0.395; TCGA COAD -1.485; TCGA ESCA -0.409; TCGA KIRC -0.343; TCGA LIHC -0.498; TCGA PAAD -0.237; TCGA PRAD -0.807; TCGA SARC -0.992; TCGA THCA -0.166; TCGA STAD -1.04; TCGA UCEC -0.358
hsa-miR-148a-3p
CAMK2A
10 cancers: BLCA; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.449; TCGA ESCA -0.325; TCGA HNSC -0.66; TCGA KIRC -0.493; TCGA LUSC -0.291; TCGA PAAD -0.199; TCGA PRAD -0.76; TCGA SARC -0.301; TCGA STAD -0.646; TCGA UCEC -0.253
hsa-miR-148a-3p
COL4A1
11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.227; TCGA COAD -0.298; TCGA ESCA -0.187; TCGA HNSC -0.287; TCGA LIHC -0.507; TCGA LUAD -0.104; TCGA PAAD -0.144; TCGA PRAD -0.427; TCGA SARC -0.138; TCGA THCA -0.167; TCGA STAD -0.254
hsa-miR-148a-3p
ARHGAP20
9 cancers: BLCA; BRCA; COAD; ESCA; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.375; TCGA BRCA -0.298; TCGA COAD -0.615; TCGA ESCA -0.201; TCGA PAAD -0.253; TCGA PRAD -0.871; TCGA SARC -0.16; TCGA STAD -0.437; TCGA UCEC -0.2
hsa-miR-148a-3p
CDC42BPB
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.12; TCGA BRCA -0.065; TCGA CESC -0.108; TCGA COAD -0.075; TCGA HNSC -0.174; TCGA KIRC -0.111; TCGA LUAD -0.149; TCGA LUSC -0.104; TCGA PAAD -0.113; TCGA PRAD -0.076; TCGA THCA -0.107; TCGA STAD -0.086
hsa-miR-148a-3p
PICALM
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.065; TCGA CESC -0.087; TCGA COAD -0.111; TCGA ESCA -0.087; TCGA HNSC -0.094; TCGA LUAD -0.066; TCGA PAAD -0.068; TCGA THCA -0.094; TCGA STAD -0.102
hsa-miR-148a-3p
LDLR
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.173; TCGA CESC -0.132; TCGA COAD -0.123; TCGA ESCA -0.114; TCGA HNSC -0.087; TCGA KIRC -0.324; TCGA LUAD -0.227; TCGA LUSC -0.248; TCGA PRAD -0.221; TCGA SARC -0.201; TCGA THCA -0.609
hsa-miR-148a-3p
KLC2
9 cancers: BLCA; ESCA; HNSC; LGG; LIHC; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.068; TCGA ESCA -0.203; TCGA HNSC -0.129; TCGA LGG -0.07; TCGA LIHC -0.397; TCGA PAAD -0.158; TCGA SARC -0.164; TCGA THCA -0.08; TCGA STAD -0.107
hsa-miR-148a-3p
ABLIM3
10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.269; TCGA BRCA -0.298; TCGA COAD -0.724; TCGA HNSC -0.257; TCGA LGG -0.091; TCGA LUAD -0.205; TCGA PAAD -0.258; TCGA PRAD -0.107; TCGA STAD -0.363; TCGA UCEC -0.183
hsa-miR-148a-3p
CSPG4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.453; TCGA BRCA -0.192; TCGA COAD -0.429; TCGA ESCA -0.296; TCGA HNSC -0.459; TCGA LIHC -0.471; TCGA LUAD -0.148; TCGA PAAD -0.193; TCGA PRAD -0.593; TCGA SARC -0.28; TCGA THCA -0.137; TCGA STAD -0.545
hsa-miR-148a-3p
GAS1
10 cancers: BRCA; COAD; ESCA; KIRC; LIHC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.179; TCGA COAD -1.379; TCGA ESCA -0.517; TCGA KIRC -0.289; TCGA LIHC -0.447; TCGA OV -0.157; TCGA PAAD -0.248; TCGA PRAD -0.705; TCGA STAD -0.59; TCGA UCEC -0.375
hsa-miR-148a-3p
RAB34
13 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.146; TCGA COAD -0.649; TCGA ESCA -0.366; TCGA HNSC -0.074; TCGA KIRP -0.295; TCGA LIHC -0.797; TCGA LUAD -0.056; TCGA OV -0.087; TCGA PAAD -0.199; TCGA PRAD -0.446; TCGA SARC -0.137; TCGA THCA -0.261; TCGA STAD -0.282
hsa-miR-148a-3p
SLC2A3
9 cancers: BRCA; COAD; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BRCA -0.13; TCGA COAD -0.496; TCGA LIHC -0.191; TCGA LUAD -0.144; TCGA PAAD -0.326; TCGA PRAD -0.226; TCGA THCA -0.368; TCGA STAD -0.092; TCGA UCEC -0.085
hsa-miR-148a-3p
TCF4
9 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.141; TCGA COAD -0.463; TCGA ESCA -0.128; TCGA KIRC -0.141; TCGA LGG -0.141; TCGA LIHC -0.199; TCGA PRAD -0.323; TCGA STAD -0.204; TCGA UCEC -0.09
hsa-miR-148a-3p
SSBP2
11 cancers: BRCA; COAD; ESCA; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.054; TCGA COAD -0.391; TCGA ESCA -0.178; TCGA LIHC -0.63; TCGA LUAD -0.076; TCGA OV -0.095; TCGA PRAD -0.24; TCGA SARC -0.15; TCGA THCA -0.074; TCGA STAD -0.369; TCGA UCEC -0.158
hsa-miR-148a-3p
DOCK6
9 cancers: BRCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA
MirTarget
TCGA BRCA -0.19; TCGA CESC -0.096; TCGA HNSC -0.126; TCGA KIRC -0.193; TCGA LIHC -0.242; TCGA LUAD -0.12; TCGA LUSC -0.17; TCGA PAAD -0.091; TCGA THCA -0.171
hsa-miR-148a-3p
MATN3
9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.134; TCGA COAD -0.71; TCGA HNSC -0.379; TCGA LIHC -0.572; TCGA LUAD -0.195; TCGA PRAD -0.309; TCGA THCA -0.359; TCGA STAD -0.21; TCGA UCEC -0.133
hsa-miR-148a-3p
EPB41L1
10 cancers: BRCA; KIRC; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BRCA -0.084; TCGA KIRC -0.163; TCGA LIHC -0.303; TCGA LUAD -0.117; TCGA OV -0.091; TCGA PAAD -0.18; TCGA PRAD -0.198; TCGA SARC -0.069; TCGA THCA -0.179; TCGA UCEC -0.132
hsa-miR-148a-3p
CELSR1
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; OV; PAAD; PRAD; THCA
MirTarget
TCGA BRCA -0.117; TCGA CESC -0.139; TCGA ESCA -0.233; TCGA HNSC -0.138; TCGA KIRC -0.113; TCGA LIHC -0.208; TCGA OV -0.135; TCGA PAAD -0.211; TCGA PRAD -0.235; TCGA THCA -0.263
hsa-miR-148a-3p
NOG
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; OV; PAAD; PRAD; STAD
MirTarget; miRNATAP
TCGA BRCA -0.161; TCGA ESCA -0.286; TCGA HNSC -0.341; TCGA KIRC -0.338; TCGA KIRP -0.355; TCGA LGG -0.554; TCGA OV -0.291; TCGA PAAD -0.39; TCGA PRAD -0.658; TCGA STAD -0.495
hsa-miR-148a-3p
EFNB2
10 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.125; TCGA HNSC -0.255; TCGA KIRC -0.178; TCGA KIRP -0.389; TCGA LIHC -0.186; TCGA LUAD -0.133; TCGA OV -0.233; TCGA PAAD -0.13; TCGA THCA -0.14; TCGA UCEC -0.273
hsa-miR-148a-3p
USP32
11 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.145; TCGA COAD -0.068; TCGA ESCA -0.113; TCGA HNSC -0.141; TCGA LUAD -0.138; TCGA LUSC -0.08; TCGA PAAD -0.085; TCGA PRAD -0.141; TCGA SARC -0.061; TCGA THCA -0.059; TCGA STAD -0.094
hsa-miR-148a-3p
ZNF665
9 cancers: BRCA; KIRC; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.098; TCGA KIRC -0.12; TCGA LIHC -0.245; TCGA LUAD -0.128; TCGA OV -0.101; TCGA PRAD -0.189; TCGA SARC -0.164; TCGA THCA -0.079; TCGA STAD -0.289
hsa-miR-148a-3p
MPP2
9 cancers: BRCA; COAD; KIRC; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.356; TCGA COAD -0.577; TCGA KIRC -0.516; TCGA LIHC -0.577; TCGA PAAD -0.196; TCGA PRAD -0.749; TCGA SARC -0.211; TCGA STAD -0.386; TCGA UCEC -0.12
hsa-miR-148a-3p
ZBTB46
9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.135; TCGA COAD -0.415; TCGA KIRC -0.196; TCGA KIRP -0.167; TCGA LIHC -0.261; TCGA PAAD -0.128; TCGA PRAD -0.139; TCGA THCA -0.056; TCGA UCEC -0.148
hsa-miR-148a-3p
TANC2
14 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.102; TCGA COAD -0.42; TCGA ESCA -0.257; TCGA HNSC -0.18; TCGA KIRC -0.108; TCGA KIRP -0.126; TCGA LGG -0.111; TCGA LIHC -0.621; TCGA LUAD -0.097; TCGA LUSC -0.127; TCGA PAAD -0.166; TCGA THCA -0.264; TCGA STAD -0.174; TCGA UCEC -0.178
hsa-miR-148a-3p
SRRM3
9 cancers: BRCA; COAD; ESCA; LGG; LIHC; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.388; TCGA COAD -0.526; TCGA ESCA -0.404; TCGA LGG -0.409; TCGA LIHC -0.705; TCGA PAAD -0.162; TCGA PRAD -0.274; TCGA THCA -0.234; TCGA UCEC -0.194
hsa-miR-148a-3p
CNTN4
10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; OV; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -0.35; TCGA COAD -0.544; TCGA KIRC -0.285; TCGA KIRP -0.424; TCGA LGG -0.116; TCGA LIHC -0.268; TCGA OV -0.342; TCGA PRAD -0.363; TCGA THCA -0.226; TCGA STAD -0.215
hsa-miR-148a-3p
MMD
11 cancers: BRCA; COAD; ESCA; KIRP; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.332; TCGA COAD -0.085; TCGA ESCA -0.292; TCGA KIRP -0.136; TCGA LIHC -0.373; TCGA LUAD -0.125; TCGA OV -0.114; TCGA PAAD -0.244; TCGA PRAD -0.186; TCGA STAD -0.236; TCGA UCEC -0.075
hsa-miR-148a-3p
NAT14
10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LIHC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.081; TCGA COAD -0.207; TCGA ESCA -0.164; TCGA KIRC -0.193; TCGA KIRP -0.192; TCGA LIHC -0.456; TCGA OV -0.136; TCGA PAAD -0.205; TCGA STAD -0.122; TCGA UCEC -0.098
hsa-miR-148a-3p
ZFHX3
10 cancers: BRCA; COAD; HNSC; KIRC; LUAD; LUSC; OV; SARC; THCA; STAD
miRNATAP
TCGA BRCA -0.097; TCGA COAD -0.176; TCGA HNSC -0.102; TCGA KIRC -0.129; TCGA LUAD -0.087; TCGA LUSC -0.107; TCGA OV -0.089; TCGA SARC -0.087; TCGA THCA -0.099; TCGA STAD -0.25
hsa-miR-148a-3p
CDK19
10 cancers: CESC; KIRC; KIRP; LGG; LIHC; LUAD; OV; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA CESC -0.115; TCGA KIRC -0.104; TCGA KIRP -0.172; TCGA LGG -0.057; TCGA LIHC -0.236; TCGA LUAD -0.063; TCGA OV -0.135; TCGA THCA -0.142; TCGA STAD -0.067; TCGA UCEC -0.086
hsa-miR-148a-3p
GPATCH8
9 cancers: CESC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget
TCGA CESC -0.082; TCGA KIRC -0.056; TCGA KIRP -0.123; TCGA LGG -0.059; TCGA LUAD -0.083; TCGA PAAD -0.078; TCGA PRAD -0.097; TCGA THCA -0.084; TCGA STAD -0.074
hsa-miR-148a-3p
MAP3K4
9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; SARC; STAD
miRNAWalker2 validate
TCGA CESC -0.15; TCGA ESCA -0.071; TCGA HNSC -0.094; TCGA KIRC -0.135; TCGA KIRP -0.059; TCGA LGG -0.062; TCGA LUAD -0.085; TCGA SARC -0.057; TCGA STAD -0.095
hsa-miR-148a-3p
RAB12
11 cancers: CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA CESC -0.137; TCGA COAD -0.212; TCGA ESCA -0.223; TCGA HNSC -0.074; TCGA LUAD -0.091; TCGA PAAD -0.15; TCGA PRAD -0.238; TCGA SARC -0.099; TCGA THCA -0.084; TCGA STAD -0.259; TCGA UCEC -0.163
hsa-miR-148a-3p
RALBP1
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA CESC -0.095; TCGA COAD -0.094; TCGA ESCA -0.087; TCGA HNSC -0.122; TCGA KIRC -0.119; TCGA LUAD -0.119; TCGA OV -0.073; TCGA PAAD -0.099; TCGA SARC -0.081; TCGA THCA -0.111; TCGA STAD -0.082
hsa-miR-148a-3p
BACH2
9 cancers: CESC; COAD; KIRC; LGG; OV; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.198; TCGA COAD -0.638; TCGA KIRC -0.21; TCGA LGG -0.107; TCGA OV -0.239; TCGA PRAD -0.288; TCGA THCA -0.163; TCGA STAD -0.19; TCGA UCEC -0.113
hsa-miR-148a-3p
ARL8B
11 cancers: CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.084; TCGA ESCA -0.151; TCGA HNSC -0.061; TCGA LUAD -0.069; TCGA LUSC -0.081; TCGA PAAD -0.07; TCGA PRAD -0.073; TCGA SARC -0.083; TCGA THCA -0.1; TCGA STAD -0.122; TCGA UCEC -0.076
hsa-miR-148a-3p
BTBD10
9 cancers: CESC; ESCA; HNSC; LIHC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA CESC -0.105; TCGA ESCA -0.083; TCGA HNSC -0.096; TCGA LIHC -0.174; TCGA PAAD -0.11; TCGA PRAD -0.066; TCGA SARC -0.054; TCGA THCA -0.136; TCGA STAD -0.075
hsa-miR-148a-3p
STK24
9 cancers: CESC; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PRAD; THCA
mirMAP
TCGA CESC -0.098; TCGA ESCA -0.081; TCGA HNSC -0.112; TCGA KIRC -0.052; TCGA LIHC -0.172; TCGA LUAD -0.064; TCGA OV -0.082; TCGA PRAD -0.051; TCGA THCA -0.106
hsa-miR-148a-3p
PHF3
9 cancers: CESC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA CESC -0.084; TCGA LGG -0.055; TCGA LUAD -0.066; TCGA LUSC -0.084; TCGA PRAD -0.082; TCGA SARC -0.051; TCGA THCA -0.075; TCGA STAD -0.078; TCGA UCEC -0.062
hsa-miR-148a-3p
IL17RD
9 cancers: CESC; COAD; KIRC; LIHC; LUAD; OV; PRAD; THCA; STAD
miRNATAP
TCGA CESC -0.286; TCGA COAD -0.206; TCGA KIRC -0.252; TCGA LIHC -0.827; TCGA LUAD -0.14; TCGA OV -0.164; TCGA PRAD -0.412; TCGA THCA -0.698; TCGA STAD -0.523
hsa-miR-148a-3p
RAI14
9 cancers: COAD; ESCA; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA COAD -0.373; TCGA ESCA -0.231; TCGA LUAD -0.083; TCGA OV -0.131; TCGA PAAD -0.184; TCGA PRAD -0.194; TCGA THCA -0.137; TCGA STAD -0.245; TCGA UCEC -0.184
hsa-miR-148a-3p
PANX1
9 cancers: COAD; ESCA; HNSC; LGG; OV; PAAD; PRAD; SARC; STAD
MirTarget
TCGA COAD -0.142; TCGA ESCA -0.171; TCGA HNSC -0.263; TCGA LGG -0.066; TCGA OV -0.066; TCGA PAAD -0.123; TCGA PRAD -0.058; TCGA SARC -0.061; TCGA STAD -0.075
hsa-miR-148a-3p
PEA15
11 cancers: COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA COAD -0.193; TCGA ESCA -0.162; TCGA HNSC -0.063; TCGA LGG -0.151; TCGA LIHC -0.165; TCGA LUSC -0.086; TCGA PAAD -0.102; TCGA PRAD -0.098; TCGA SARC -0.073; TCGA THCA -0.195; TCGA STAD -0.173
hsa-miR-148a-3p
DOCK3
12 cancers: COAD; KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA COAD -0.246; TCGA KIRC -0.243; TCGA KIRP -0.443; TCGA LGG -0.119; TCGA LIHC -0.284; TCGA OV -0.238; TCGA PAAD -0.236; TCGA PRAD -0.433; TCGA SARC -0.652; TCGA THCA -0.218; TCGA STAD -0.733; TCGA UCEC -0.307
hsa-miR-148a-3p
SULF1
10 cancers: COAD; ESCA; HNSC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA COAD -0.941; TCGA ESCA -0.43; TCGA HNSC -0.162; TCGA KIRP -0.304; TCGA LIHC -1.088; TCGA PAAD -0.304; TCGA PRAD -0.445; TCGA SARC -0.239; TCGA THCA -0.182; TCGA STAD -0.406
hsa-miR-148a-3p
SOX11
9 cancers: COAD; ESCA; HNSC; LGG; LIHC; OV; PAAD; THCA; STAD
miRNATAP
TCGA COAD -0.702; TCGA ESCA -0.401; TCGA HNSC -0.519; TCGA LGG -0.229; TCGA LIHC -1.071; TCGA OV -0.8; TCGA PAAD -0.652; TCGA THCA -0.917; TCGA STAD -0.517
hsa-miR-148a-3p
ACSL4
9 cancers: COAD; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA COAD -0.118; TCGA KIRC -0.12; TCGA LGG -0.052; TCGA LIHC -0.646; TCGA LUAD -0.12; TCGA LUSC -0.107; TCGA PRAD -0.578; TCGA THCA -0.05; TCGA STAD -0.072





Enriched cancer pathways of putative targets