microRNA information: hsa-miR-148a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-148a-5p | miRbase |
| Accession: | MIMAT0004549 | miRbase |
| Precursor name: | hsa-mir-148a | miRbase |
| Precursor accession: | MI0000253 | miRbase |
| Symbol: | MIR148A | HGNC |
| RefSeq ID: | NR_029597 | GenBank |
| Sequence: | AAAGUUCUGAGACACUCCGACU |
Reported expression in cancers: hsa-miR-148a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-148a-5p | bladder cancer | downregulation | "MicroRNA 148a represents an independent prognostic ......" | 26700670 | qPCR |
| hsa-miR-148a-5p | breast cancer | downregulation | "MicroRNA 148a inhibits breast cancer migration and ......" | 26707142 | |
| hsa-miR-148a-5p | colorectal cancer | upregulation | "High expression of miR-27b miR-148a and miR-326 we ......" | 24119443 | |
| hsa-miR-148a-5p | colorectal cancer | upregulation | "Signature miRNAs in colorectal cancers were reveal ......" | 26646696 | RNA-Seq |
| hsa-miR-148a-5p | gastric cancer | downregulation | "Our previous studies have revealed that miR-148a a ......" | 21205300 | |
| hsa-miR-148a-5p | gastric cancer | downregulation | "Herein we identified the role of miR-148a in gastr ......" | 21552422 | |
| hsa-miR-148a-5p | gastric cancer | downregulation | "In this study we investigate the role of miR-148a ......" | 21994419 | qPCR |
| hsa-miR-148a-5p | gastric cancer | downregulation | "MicroRNA 148a is silenced by hypermethylation and ......" | 22167392 | |
| hsa-miR-148a-5p | gastric cancer | downregulation | "microRNA 148a suppresses human gastric cancer cell ......" | 23873106 | qPCR |
| hsa-miR-148a-5p | gastric cancer | downregulation | "To identify miRNAs that are associated with some c ......" | 24283384 | Microarray; qPCR |
| hsa-miR-148a-5p | gastric cancer | downregulation | "The role of miR 148a in gastric cancer. MiR-148a i ......" | 24659367 | |
| hsa-miR-148a-5p | gastric cancer | downregulation | "MiR-375 and miR-148a were found downregulated in s ......" | 24902858 | |
| hsa-miR-148a-5p | gastric cancer | downregulation | "Expression level of miR-148a was detected by qRT-P ......" | 25341915 | qPCR |
| hsa-miR-148a-5p | gastric cancer | downregulation | "In this research we demonstrated that miR-148a exp ......" | 27518872 | |
| hsa-miR-148a-5p | gastric cancer | downregulation | "Expression and prognostic value of microRNA 26a an ......" | 27529338 | Reverse transcription PCR; qPCR |
| hsa-miR-148a-5p | liver cancer | downregulation | "Decreased expression and clinical significance of ......" | 25444499 | qPCR |
| hsa-miR-148a-5p | liver cancer | downregulation | "Decrease expression and clinicopathological signif ......" | 26248880 | qPCR |
| hsa-miR-148a-5p | liver cancer | downregulation | "Differentiation therapy for hepatocellular carcino ......" | 26599259 | |
| hsa-miR-148a-5p | lung squamous cell cancer | downregulation | "We found that miR-148a is significantly downregula ......" | 23670799 | |
| hsa-miR-148a-5p | lung squamous cell cancer | downregulation | "Serum miR 152 miR 148a miR 148b and miR 21 as nove ......" | 25501703 | qPCR |
| hsa-miR-148a-5p | lung squamous cell cancer | downregulation | "MicroRNA 148a Suppresses Invasion and Metastasis o ......" | 26584284 | Reverse transcription PCR |
| hsa-miR-148a-5p | ovarian cancer | deregulation | "Suppressive Role of MicroRNA 148a in Cell Prolifer ......" | 27712592 | |
| hsa-miR-148a-5p | pancreatic cancer | downregulation | "Our previous studies have revealed that miR-148a i ......" | 23975374 | qPCR |
| hsa-miR-148a-5p | pancreatic cancer | downregulation | "miR 148a and miR 216a regulated oncolytic adenovir ......" | 24895996 | |
| hsa-miR-148a-5p | prostate cancer | downregulation | "It has been recently reported that miR-148a expres ......" | 20406806 | |
| hsa-miR-148a-5p | sarcoma | upregulation | "The expression levels of circulating miR-148a were ......" | 25185654 | qPCR |
| hsa-miR-148a-5p | sarcoma | downregulation | "MATERIAL AND METHODS According to the qRT-PCR anal ......" | 26638007 | qPCR |
Reported cancer pathway affected by hsa-miR-148a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-148a-5p | bladder cancer | Apoptosis pathway | "miR 148a dependent apoptosis of bladder cancer cel ......" | 25865490 | |
| hsa-miR-148a-5p | bladder cancer | Apoptosis pathway | "MicroRNA 148a represents an independent prognostic ......" | 26700670 | |
| hsa-miR-148a-5p | breast cancer | Apoptosis pathway | "Based on the results obtained in the last decade s ......" | 26199650 | |
| hsa-miR-148a-5p | chordoma | cell cycle pathway; Apoptosis pathway | "The mRNA level of predicted and confirmed targets ......" | 27016303 | |
| hsa-miR-148a-5p | colorectal cancer | Apoptosis pathway | "MiR 148a promotes apoptosis by targeting Bcl 2 in ......" | 21455217 | |
| hsa-miR-148a-5p | gastric cancer | cell cycle pathway | "miR 148a promoted cell proliferation by targeting ......" | 21552422 | |
| hsa-miR-148a-5p | gastric cancer | Apoptosis pathway | "MicroRNA 148a is silenced by hypermethylation and ......" | 22167392 | Western blot |
| hsa-miR-148a-5p | gastric cancer | Epithelial mesenchymal transition pathway | "microRNA 148a suppresses human gastric cancer cell ......" | 23873106 | Western blot; Luciferase |
| hsa-miR-148a-5p | gastric cancer | Apoptosis pathway | "Expression and prognostic value of microRNA 26a an ......" | 27529338 | Colony formation |
| hsa-miR-148a-5p | glioblastoma | Apoptosis pathway | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 | |
| hsa-miR-148a-5p | liver cancer | cell cycle pathway | "Role of miR 148a in hepatitis B associated hepatoc ......" | 22496917 | Colony formation |
| hsa-miR-148a-5p | liver cancer | Wnt signaling pathway | "Inhibitions of epithelial to mesenchymal transitio ......" | 23861222 | |
| hsa-miR-148a-5p | ovarian cancer | Apoptosis pathway | "MicroRNA 148a inhibits the proliferation and promo ......" | 26004124 | Western blot; Luciferase |
| hsa-miR-148a-5p | pancreatic cancer | Apoptosis pathway | "MiR 148a regulates the growth and apoptosis in pan ......" | 23975374 | Colony formation; MTT assay; Western blot; Luciferase |
| hsa-miR-148a-5p | prostate cancer | Apoptosis pathway | "Seven miRNAs miR-21 miR-32 miR-99a miR-99b miR-148 ......" | 22266859 | Western blot; Luciferase |
| hsa-miR-148a-5p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 |
Reported cancer prognosis affected by hsa-miR-148a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-148a-5p | bladder cancer | worse prognosis; poor survival; metastasis; recurrence | "MicroRNA 148a represents an independent prognostic ......" | 26700670 | |
| hsa-miR-148a-5p | breast cancer | differentiation | "In order to identify which miRNAs are involved in ......" | 22562546 | |
| hsa-miR-148a-5p | breast cancer | staging | "Global miRNA analysis was performed on prospective ......" | 25004125 | |
| hsa-miR-148a-5p | breast cancer | immune evasion | "GPER mediated estradiol reduces miR 148a to promot ......" | 25063027 | |
| hsa-miR-148a-5p | breast cancer | metastasis; worse prognosis | "Based on the results obtained in the last decade s ......" | 26199650 | |
| hsa-miR-148a-5p | breast cancer | metastasis | "MicroRNA 148a inhibits migration of breast cancer ......" | 26298724 | Western blot; Luciferase |
| hsa-miR-148a-5p | breast cancer | metastasis | "MicroRNA 148a inhibits breast cancer migration and ......" | 26707142 | |
| hsa-miR-148a-5p | breast cancer | metastasis; worse prognosis | "MiR 148a functions to suppress metastasis and serv ......" | 26967387 | |
| hsa-miR-148a-5p | chordoma | progression; differentiation | "The mRNA level of predicted and confirmed targets ......" | 27016303 | |
| hsa-miR-148a-5p | colon cancer | recurrence | "Groups of five patients with and without disease r ......" | 24400111 | |
| hsa-miR-148a-5p | colorectal cancer | poor survival; progression | "The aim of this study was to investigate the hyper ......" | 21610744 | |
| hsa-miR-148a-5p | colorectal cancer | worse prognosis | "This article evaluates a recently published study ......" | 21902530 | |
| hsa-miR-148a-5p | colorectal cancer | staging; poor survival; drug resistance | "The clinical significance of MiR 148a as a predict ......" | 23056401 | |
| hsa-miR-148a-5p | colorectal cancer | recurrence | "TaqMan® Human MicroRNA Array Set v2.0 was used to ......" | 23280316 | |
| hsa-miR-148a-5p | colorectal cancer | staging | "Clinical significance of microRNA 148a in patients ......" | 23933284 | |
| hsa-miR-148a-5p | colorectal cancer | progression; poor survival | "High expression of miR-27b miR-148a and miR-326 we ......" | 24119443 | |
| hsa-miR-148a-5p | colorectal cancer | tumorigenesis; staging; progression | "Significance of miR 148a in Colorectal Neoplasia: ......" | 26389729 | |
| hsa-miR-148a-5p | esophageal cancer | differentiation; recurrence | "The expression of miR-21 miR-106a miR-148a miR-205 ......" | 20628822 | |
| hsa-miR-148a-5p | gastric cancer | metastasis | "Differential expression of miRNAs was studied usin ......" | 20726036 | |
| hsa-miR-148a-5p | gastric cancer | progression; staging | "miR 148a promoted cell proliferation by targeting ......" | 21552422 | |
| hsa-miR-148a-5p | gastric cancer | metastasis; poor survival | "The function of a specific miRNA miR-148a was furt ......" | 21703006 | |
| hsa-miR-148a-5p | gastric cancer | metastasis; staging; cell migration; progression | "MicroRNA 148a suppresses tumor cell invasion and m ......" | 21994419 | Luciferase |
| hsa-miR-148a-5p | gastric cancer | metastasis; staging | "In a pilot study serum levels of miR-21 miR-27a mi ......" | 23806809 | |
| hsa-miR-148a-5p | gastric cancer | progression | "Quantitative proteomics reveals diverse roles of m ......" | 23869555 | |
| hsa-miR-148a-5p | gastric cancer | metastasis; staging; worse prognosis | "microRNA 148a suppresses human gastric cancer cell ......" | 23873106 | Western blot; Luciferase |
| hsa-miR-148a-5p | gastric cancer | worse prognosis; progression; staging; metastasis | "MicroRNA 148a is downregulated in gastric cancer t ......" | 24283384 | Western blot |
| hsa-miR-148a-5p | gastric cancer | tumorigenesis | "MiR 148a regulates MEG3 in gastric cancer by targe ......" | 24515776 | |
| hsa-miR-148a-5p | gastric cancer | metastasis | "The role of miR 148a in gastric cancer; MiR-148a i ......" | 24659367 | |
| hsa-miR-148a-5p | gastric cancer | staging; metastasis | "Impact of miR 148a on the proliferation of gastric ......" | 25341915 | Western blot |
| hsa-miR-148a-5p | gastric cancer | worse prognosis | "A genetic variant of miR 148a binding site in the ......" | 25399950 | Luciferase |
| hsa-miR-148a-5p | gastric cancer | staging; metastasis | "Evaluation of miR 29c miR 124 miR 135a and miR 148 ......" | 26885198 | |
| hsa-miR-148a-5p | gastric cancer | metastasis; tumorigenesis | "MiR 148a Functions as a Tumor Suppressor by Target ......" | 27518872 | Western blot; Luciferase |
| hsa-miR-148a-5p | glioblastoma | poor survival | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 | |
| hsa-miR-148a-5p | glioblastoma | poor survival | "Inhibition of two "risky" miRNAs miR-148a and miR- ......" | 25903473 | |
| hsa-miR-148a-5p | liver cancer | metastasis | "Identification of metastasis related microRNAs of ......" | 19912688 | |
| hsa-miR-148a-5p | liver cancer | progression; cell migration | "Role of miR 148a in hepatitis B associated hepatoc ......" | 22496917 | Colony formation |
| hsa-miR-148a-5p | liver cancer | metastasis; differentiation | "Inhibitions of epithelial to mesenchymal transitio ......" | 23861222 | |
| hsa-miR-148a-5p | liver cancer | worse prognosis; poor survival; recurrence; progression | "microRNA 148a dysregulation discriminates poor pro ......" | 24798342 | |
| hsa-miR-148a-5p | liver cancer | staging; metastasis; tumorigenesis; worse prognosis | "Decreased expression and clinical significance of ......" | 25444499 | |
| hsa-miR-148a-5p | liver cancer | poor survival; staging; metastasis; recurrence; tumorigenesis | "Decrease expression and clinicopathological signif ......" | 26248880 | |
| hsa-miR-148a-5p | liver cancer | metastasis | "After transfection of the HepG2 and SMMC‑7721 HC ......" | 26530325 | Western blot; MTT assay; Luciferase |
| hsa-miR-148a-5p | liver cancer | differentiation; progression | "Differentiation therapy for hepatocellular carcino ......" | 26599259 | |
| hsa-miR-148a-5p | lung squamous cell cancer | metastasis | "MicroRNA 148a suppresses epithelial to mesenchymal ......" | 23670799 | Luciferase |
| hsa-miR-148a-5p | lung squamous cell cancer | metastasis; malignant trasformation; staging | "MicroRNA 148a Suppresses Invasion and Metastasis o ......" | 26584284 | |
| hsa-miR-148a-5p | lung squamous cell cancer | staging | "The aim of this study was to determine whether cir ......" | 27461630 | |
| hsa-miR-148a-5p | ovarian cancer | poor survival; drug resistance; tumorigenesis | "Altered expression of miR 152 and miR 148a in ovar ......" | 21971665 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-miR-148a-5p | ovarian cancer | progression; poor survival | "By analyzing multidimensional datasets of ovarian ......" | 25537514 | |
| hsa-miR-148a-5p | ovarian cancer | cell migration | "MicroRNA 148a inhibits migration and invasion of o ......" | 26004261 | Western blot; Luciferase; Transwell assay |
| hsa-miR-148a-5p | ovarian cancer | metastasis; worse prognosis; progression; poor survival | "Decreased expression of microRNA 148a predicts poo ......" | 27470550 | |
| hsa-miR-148a-5p | pancreatic cancer | staging; differentiation | "Expressions of miRNAs were determined with the Taq ......" | 22851141 | |
| hsa-miR-148a-5p | pancreatic cancer | staging | "miR 148a and miR 216a regulated oncolytic adenovir ......" | 24895996 | |
| hsa-miR-148a-5p | pancreatic cancer | metastasis; tumorigenesis | "The Interplay Between miR 148a and DNMT1 Might be ......" | 25950085 | |
| hsa-miR-148a-5p | pancreatic cancer | tumorigenesis | "MicroRNA 148a Suppresses the Proliferation and Mig ......" | 27518467 | Cell migration assay |
| hsa-miR-148a-5p | prostate cancer | drug resistance; cell migration | "MiR 148a attenuates paclitaxel resistance of hormo ......" | 20406806 | Luciferase |
| hsa-miR-148a-5p | prostate cancer | drug resistance | "To screen for epigenetically silenced miRNAs in pr ......" | 22310291 | |
| hsa-miR-148a-5p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-148a-5p | prostate cancer | staging; drug resistance | "Following global miRNA profiling of cell line mode ......" | 25053345 | |
| hsa-miR-148a-5p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-148a-5p | sarcoma | worse prognosis; metastasis; tumor size; poor survival; progression | "Circulating miR 148a is a significant diagnostic a ......" | 25185654 | |
| hsa-miR-148a-5p | sarcoma | differentiation | "Bufalin Inhibits the Differentiation and Prolifera ......" | 26111756 | |
| hsa-miR-148a-5p | sarcoma | metastasis; worse prognosis; differentiation | "Down Regulation of miR 148a Promotes Metastasis by ......" | 26638007 | Luciferase |
Reported gene related to hsa-miR-148a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-148a-5p | bladder cancer | DNMT1 | "miR 148a dependent apoptosis of bladder cancer cel ......" | 25865490 |
| hsa-miR-148a-5p | gastric cancer | DNMT1 | "Studies have shown that microRNA-148a miR-148a was ......" | 22167392 |
| hsa-miR-148a-5p | pancreatic cancer | DNMT1 | "The Interplay Between miR 148a and DNMT1 Might be ......" | 25950085 |
| hsa-miR-148a-5p | sarcoma | DNMT1 | "Moreover we found that miR-148a appeared to be a t ......" | 26111756 |
| hsa-miR-148a-5p | breast cancer | SMAD2 | "By targeting of the SMAD2-3'-UTR miR-148a blocked ......" | 25980823 |
| hsa-miR-148a-5p | gastric cancer | SMAD2 | "miR 148a downregulates the expression of transform ......" | 26983401 |
| hsa-miR-148a-5p | gastric cancer | SMAD2 | "Finally the SMAD2 gene was identified as the direc ......" | 23873106 |
| hsa-miR-148a-5p | liver cancer | SMAD2 | "MiR-148a which targeted the SMAD2-3'UTR decreased ......" | 24806207 |
| hsa-miR-148a-5p | breast cancer | MMP7 | "The overexpression of miR-148a reduced the mRNA an ......" | 26707142 |
| hsa-miR-148a-5p | colorectal cancer | MMP7 | "To further confirm the direct effect of miR-148a o ......" | 26389729 |
| hsa-miR-148a-5p | gastric cancer | MMP7 | "MicroRNA 148a is downregulated in gastric cancer t ......" | 24283384 |
| hsa-miR-148a-5p | colorectal cancer | BCL2 | "MiR 148a promotes apoptosis by targeting Bcl 2 in ......" | 21455217 |
| hsa-miR-148a-5p | pancreatic cancer | BCL2 | "MiR 148a regulates the growth and apoptosis in pan ......" | 23975374 |
| hsa-miR-148a-5p | gastric cancer | CCKBR | "More importantly siRNA-induced knockdown of CCK-BR ......" | 27518872 |
| hsa-miR-148a-5p | pancreatic cancer | CCKBR | "MiR 148a regulates the growth and apoptosis in pan ......" | 23975374 |
| hsa-miR-148a-5p | breast cancer | GLA | "Here we reported that GLA attenuated the CSC-like ......" | 25980823 |
| hsa-miR-148a-5p | liver cancer | GLA | "Here we found that GLA attenuated the CSCs-like pr ......" | 24806207 |
| hsa-miR-148a-5p | breast cancer | GPER1 | "GPER mediated estradiol reduces miR 148a to promot ......" | 25063027 |
| hsa-miR-148a-5p | breast cancer | GPER1 | "Estradiol induces HOTAIR levels via GPER mediated ......" | 25928008 |
| hsa-miR-148a-5p | breast cancer | HLA-G | "GPER mediated estradiol reduces miR 148a to promot ......" | 25063027 |
| hsa-miR-148a-5p | cervical and endocervical cancer | HLA-G | "Long non coding RNA HOTAIR modulates HLA G express ......" | 27574106 |
| hsa-miR-148a-5p | breast cancer | HOTAIR | "Estradiol induces HOTAIR levels via GPER mediated ......" | 25928008 |
| hsa-miR-148a-5p | cervical and endocervical cancer | HOTAIR | "Long non coding RNA HOTAIR modulates HLA G express ......" | 27574106 |
| hsa-miR-148a-5p | gastric cancer | ROCK1 | "MicroRNA 148a suppresses tumor cell invasion and m ......" | 21994419 |
| hsa-miR-148a-5p | lung squamous cell cancer | ROCK1 | "MicroRNA 148a suppresses epithelial to mesenchymal ......" | 23670799 |
| hsa-miR-148a-5p | breast cancer | WNT1 | "Mechanistically miR-148a appears to suppress the e ......" | 26967387 |
| hsa-miR-148a-5p | liver cancer | WNT1 | "Via TargetScan and microRNA.org algorithms miR-148 ......" | 23861222 |
| hsa-miR-148a-5p | prostate cancer | AR | "We found that androgen receptor is the most freque ......" | 27292025 |
| hsa-miR-148a-5p | glioblastoma | BCL2L11 | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 |
| hsa-miR-148a-5p | liver cancer | CD44 | "In MHCC97H and MHCC97L cells over-expression of mi ......" | 23861222 |
| hsa-miR-148a-5p | gastric cancer | CDC25B | "Gene CDC25B might be the target gene of miR-148a a ......" | 25341915 |
| hsa-miR-148a-5p | gastric cancer | CDH1 | "miR-148a overexpression also downregulated vimenti ......" | 23873106 |
| hsa-miR-148a-5p | esophageal cancer | CYLD | "In EAC miR-148a expression levels were inversely a ......" | 20628822 |
| hsa-miR-148a-5p | acute myeloid leukemia | DNMT3B | "Low ERG expressers presented with down-regulation ......" | 20841507 |
| hsa-miR-148a-5p | gastric cancer | DYNLL1 | "One miRNA miR-148a was identified and its function ......" | 21703006 |
| hsa-miR-148a-5p | glioblastoma | EGFR | "microRNA 148a is a prognostic oncomiR that targets ......" | 24425048 |
| hsa-miR-148a-5p | pancreatic cancer | ERBB3 | "MicroRNA 148a Suppresses the Proliferation and Mig ......" | 27518467 |
| hsa-miR-148a-5p | acute myeloid leukemia | ERG | "Low ERG expressers presented with down-regulation ......" | 20841507 |
| hsa-miR-148a-5p | breast cancer | ESR1 | "miR-148a plays an important role in regulation of ......" | 25063027 |
| hsa-miR-148a-5p | glioblastoma | GSC | "miR-148a expression was elevated in human glioblas ......" | 24425048 |
| hsa-miR-148a-5p | gastric cancer | MEG3 | "MiR 148a regulates MEG3 in gastric cancer by targe ......" | 24515776 |
| hsa-miR-148a-5p | melanoma | MITF | "miR 148 regulates Mitf in melanoma cells; Furtherm ......" | 20644734 |
| hsa-miR-148a-5p | breast cancer | MMP13 | "MicroRNA 148a inhibits migration of breast cancer ......" | 26298724 |
| hsa-miR-148a-5p | ovarian cancer | MMP9 | "Overexpression of miR-148a caused a significant de ......" | 27712592 |
| hsa-miR-148a-5p | glioblastoma | NFASC | "NF κB induces miR 148a to sustain TGF β/Smad sig ......" | 25971746 |
| hsa-miR-148a-5p | breast cancer | NRP1 | "Mechanistically miR-148a appears to suppress the e ......" | 26967387 |
| hsa-miR-148a-5p | ovarian cancer | PDIA3 | "MicroRNA 148a inhibits the proliferation and promo ......" | 26004124 |
| hsa-miR-148a-5p | gastric cancer | PDYN | "Using bioinformatics tools we selected two SNPs SC ......" | 25399950 |
| hsa-miR-148a-5p | liver cancer | PTEN | "Introduction of anti-miR-148a increased PTEN prote ......" | 22496917 |
| hsa-miR-148a-5p | prostate cancer | RPS6KA5 | "MiR 148a attenuates paclitaxel resistance of hormo ......" | 20406806 |
| hsa-miR-148a-5p | gastric cancer | RUNX3 | "We investigated the role of microRNA-148a miR-148a ......" | 23549984 |
| hsa-miR-148a-5p | liver cancer | S1PR1 | "USP4 and S1P1 were up-regulated in mesenchymal-typ ......" | 24798342 |
| hsa-miR-148a-5p | gastric cancer | SCRN1 | "A genetic variant of miR 148a binding site in the ......" | 25399950 |
| hsa-miR-148a-5p | gastric cancer | SMAD4 | "In GC cell lines we constructed and transfected a ......" | 26983401 |
| hsa-miR-148a-5p | gastric cancer | STAT3 | "Taken together our results suggest that miR-148a s ......" | 27518872 |
| hsa-miR-148a-5p | gastric cancer | TCF3 | "MicroRNA 148a can regulate runt related transcript ......" | 23549984 |
| hsa-miR-148a-5p | breast cancer | TCF7L2 | "The overexpression of miR-148a reduced the mRNA an ......" | 26707142 |
| hsa-miR-148a-5p | sarcoma | TGIF2 | "Down Regulation of miR 148a Promotes Metastasis by ......" | 26638007 |
| hsa-miR-148a-5p | gastric cancer | THBS1 | "Using the TSP algorithm hsa-miR-196a and hsa-miR-1 ......" | 24527072 |
| hsa-miR-148a-5p | liver cancer | THY1 | "In MHCC97H and MHCC97L cells over-expression of mi ......" | 23861222 |
| hsa-miR-148a-5p | liver cancer | USP4 | "microRNA 148a dysregulation discriminates poor pro ......" | 24798342 |
| hsa-miR-148a-5p | gastric cancer | VIM | "miR-148a overexpression also downregulated vimenti ......" | 23873106 |
| hsa-miR-148a-5p | liver cancer | VWCE | "HBx and URG11 also alter the expression of multipl ......" | 22496917 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-148a-5p | RBM24 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.297; TCGA BRCA -0.606; TCGA COAD -0.597; TCGA ESCA -0.424; TCGA HNSC -0.26; TCGA PAAD -0.31; TCGA PRAD -0.312; TCGA SARC -0.717; TCGA STAD -0.702; TCGA UCEC -0.316 |
hsa-miR-148a-5p | KIFC3 | 14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.234; TCGA COAD -0.337; TCGA ESCA -0.192; TCGA HNSC -0.3; TCGA KIRC -0.152; TCGA KIRP -0.143; TCGA LIHC -0.227; TCGA LUAD -0.17; TCGA LUSC -0.133; TCGA OV -0.12; TCGA PRAD -0.511; TCGA THCA -0.07; TCGA STAD -0.145; TCGA UCEC -0.083 |
hsa-miR-148a-5p | SGIP1 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.235; TCGA BRCA -0.173; TCGA COAD -0.471; TCGA ESCA -0.209; TCGA HNSC -0.187; TCGA KIRC -0.466; TCGA LIHC -0.382; TCGA PAAD -0.267; TCGA PRAD -0.207; TCGA SARC -0.56; TCGA STAD -0.369; TCGA UCEC -0.129 |
hsa-miR-148a-5p | COL5A2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.203; TCGA BRCA -0.122; TCGA COAD -0.516; TCGA ESCA -0.442; TCGA HNSC -0.298; TCGA LIHC -0.431; TCGA OV -0.248; TCGA PAAD -0.239; TCGA PRAD -0.127; TCGA THCA -0.166; TCGA STAD -0.199 |
hsa-miR-148a-5p | TCEAL1 | 9 cancers: BLCA; BRCA; COAD; KIRC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.149; TCGA BRCA -0.199; TCGA COAD -0.095; TCGA KIRC -0.077; TCGA LUSC -0.11; TCGA PRAD -0.166; TCGA SARC -0.353; TCGA STAD -0.197; TCGA UCEC -0.078 |
hsa-miR-148a-5p | WWC2 | 9 cancers: BLCA; BRCA; COAD; KIRC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.199; TCGA BRCA -0.138; TCGA COAD -0.516; TCGA KIRC -0.185; TCGA LUAD -0.159; TCGA PRAD -0.22; TCGA THCA -0.157; TCGA STAD -0.193; TCGA UCEC -0.122 |
hsa-miR-148a-5p | PPFIBP1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; STAD | MirTarget | TCGA BLCA -0.118; TCGA BRCA -0.119; TCGA CESC -0.089; TCGA COAD -0.089; TCGA ESCA -0.194; TCGA HNSC -0.096; TCGA KIRC -0.161; TCGA LIHC -0.165; TCGA LUAD -0.13; TCGA LUSC -0.14; TCGA THCA -0.151; TCGA STAD -0.197 |
hsa-miR-148a-5p | SEPT10 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.09; TCGA BRCA -0.053; TCGA CESC -0.107; TCGA COAD -0.106; TCGA ESCA -0.174; TCGA KIRC -0.125; TCGA LUAD -0.065; TCGA LUSC -0.16; TCGA PRAD -0.143; TCGA SARC -0.175; TCGA THCA -0.106; TCGA STAD -0.245 |
hsa-miR-148a-5p | SYNM | 9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.51; TCGA COAD -1.247; TCGA ESCA -0.503; TCGA LIHC -0.126; TCGA LUAD -0.136; TCGA PRAD -0.778; TCGA SARC -0.679; TCGA STAD -1.138; TCGA UCEC -0.156 |
hsa-miR-148a-5p | RASAL2 | 12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.096; TCGA BRCA -0.054; TCGA CESC -0.156; TCGA ESCA -0.082; TCGA KIRC -0.208; TCGA LIHC -0.142; TCGA LUAD -0.18; TCGA LUSC -0.125; TCGA PAAD -0.106; TCGA PRAD -0.102; TCGA THCA -0.188; TCGA STAD -0.077 |
hsa-miR-148a-5p | PPP1R12B | 9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.341; TCGA BRCA -0.164; TCGA COAD -0.56; TCGA KIRC -0.169; TCGA LIHC -0.085; TCGA PRAD -0.527; TCGA SARC -0.804; TCGA STAD -0.749; TCGA UCEC -0.297 |
hsa-miR-148a-5p | RUNX1T1 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; OV; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.168; TCGA BRCA -0.257; TCGA COAD -0.739; TCGA ESCA -0.204; TCGA KIRC -0.449; TCGA OV -0.273; TCGA PRAD -0.377; TCGA STAD -0.511; TCGA UCEC -0.421 |
hsa-miR-148a-5p | TIMP3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.225; TCGA BRCA -0.378; TCGA CESC -0.226; TCGA COAD -0.694; TCGA ESCA -0.377; TCGA HNSC -0.147; TCGA KIRC -0.284; TCGA OV -0.171; TCGA PAAD -0.244; TCGA PRAD -0.454; TCGA STAD -0.399; TCGA UCEC -0.232 |
hsa-miR-148a-5p | KLHL4 | 10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.363; TCGA BRCA -0.315; TCGA COAD -0.878; TCGA ESCA -0.44; TCGA LIHC -0.205; TCGA OV -0.233; TCGA PRAD -0.631; TCGA SARC -0.198; TCGA STAD -0.642; TCGA UCEC -0.285 |
hsa-miR-148a-5p | KATNAL1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.141; TCGA BRCA -0.2; TCGA CESC -0.094; TCGA COAD -0.373; TCGA ESCA -0.336; TCGA LUAD -0.057; TCGA LUSC -0.091; TCGA PAAD -0.158; TCGA PRAD -0.334; TCGA SARC -0.082; TCGA STAD -0.417; TCGA UCEC -0.112 |
hsa-miR-148a-5p | SH3PXD2A | 9 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.174; TCGA BRCA -0.067; TCGA ESCA -0.2; TCGA KIRC -0.118; TCGA LIHC -0.141; TCGA PRAD -0.35; TCGA THCA -0.13; TCGA STAD -0.247; TCGA UCEC -0.116 |
hsa-miR-148a-5p | LTBP2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; OV; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.215; TCGA BRCA -0.18; TCGA CESC -0.148; TCGA COAD -0.508; TCGA ESCA -0.259; TCGA KIRC -0.183; TCGA LIHC -0.653; TCGA OV -0.188; TCGA PRAD -0.336; TCGA THCA -0.14; TCGA STAD -0.195 |
hsa-miR-148a-5p | BCL2L2 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; SARC | mirMAP | TCGA BLCA -0.141; TCGA BRCA -0.125; TCGA COAD -0.062; TCGA ESCA -0.132; TCGA KIRC -0.1; TCGA LIHC -0.059; TCGA LUAD -0.05; TCGA LUSC -0.12; TCGA SARC -0.174 |
hsa-miR-148a-5p | MAP1B | 9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; PRAD; SARC; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.296; TCGA BRCA -0.115; TCGA COAD -0.676; TCGA ESCA -0.412; TCGA LIHC -0.426; TCGA PRAD -0.619; TCGA SARC -0.283; TCGA STAD -0.609; TCGA UCEC -0.139 |
hsa-miR-148a-5p | PRKAB2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.12; TCGA BRCA -0.079; TCGA CESC -0.096; TCGA COAD -0.108; TCGA ESCA -0.113; TCGA HNSC -0.172; TCGA KIRC -0.1; TCGA LUAD -0.074; TCGA LUSC -0.12; TCGA SARC -0.201; TCGA STAD -0.205 |
hsa-miR-148a-5p | SYT11 | 10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.115; TCGA BRCA -0.065; TCGA COAD -0.591; TCGA KIRC -0.155; TCGA LIHC -0.295; TCGA PRAD -0.497; TCGA SARC -0.278; TCGA THCA -0.124; TCGA STAD -0.332; TCGA UCEC -0.16 |
hsa-miR-148a-5p | NAV1 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; THCA; STAD | mirMAP; miRNATAP | TCGA BLCA -0.082; TCGA BRCA -0.236; TCGA COAD -0.298; TCGA ESCA -0.333; TCGA HNSC -0.082; TCGA KIRC -0.131; TCGA LIHC -0.314; TCGA PAAD -0.268; TCGA THCA -0.175; TCGA STAD -0.121 |
hsa-miR-148a-5p | KIAA1614 | 11 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.124; TCGA BRCA -0.093; TCGA COAD -0.395; TCGA ESCA -0.272; TCGA LIHC -0.409; TCGA LUAD -0.129; TCGA LUSC -0.132; TCGA PRAD -0.54; TCGA SARC -0.155; TCGA STAD -0.388; TCGA UCEC -0.139 |
hsa-miR-148a-5p | SULF1 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.192; TCGA BRCA -0.093; TCGA COAD -0.84; TCGA ESCA -0.485; TCGA KIRC -0.185; TCGA KIRP -0.213; TCGA LIHC -0.925; TCGA PAAD -0.267; TCGA PRAD -0.42; TCGA SARC -0.268; TCGA STAD -0.355 |
hsa-miR-148a-5p | PDE5A | 10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.137; TCGA BRCA -0.302; TCGA COAD -0.319; TCGA KIRC -0.258; TCGA LIHC -0.51; TCGA PRAD -0.566; TCGA SARC -0.445; TCGA THCA -0.711; TCGA STAD -0.434; TCGA UCEC -0.112 |
hsa-miR-148a-5p | IGF1R | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; OV; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.153; TCGA BRCA -0.392; TCGA CESC -0.237; TCGA COAD -0.148; TCGA ESCA -0.252; TCGA KIRC -0.171; TCGA LIHC -0.626; TCGA LUAD -0.12; TCGA OV -0.245; TCGA SARC -0.159; TCGA THCA -0.167; TCGA STAD -0.221; TCGA UCEC -0.166 |
hsa-miR-148a-5p | RGS5 | 9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.244; TCGA BRCA -0.209; TCGA COAD -0.359; TCGA KIRC -0.241; TCGA LIHC -0.251; TCGA PRAD -0.195; TCGA THCA -0.142; TCGA STAD -0.206; TCGA UCEC -0.106 |
hsa-miR-148a-5p | RBMS3 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.244; TCGA BRCA -0.296; TCGA COAD -0.568; TCGA ESCA -0.235; TCGA KIRC -0.309; TCGA LIHC -0.157; TCGA OV -0.159; TCGA PRAD -0.496; TCGA STAD -0.417; TCGA UCEC -0.235 |
hsa-miR-148a-5p | DIP2C | 9 cancers: BLCA; BRCA; COAD; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.09; TCGA BRCA -0.178; TCGA COAD -0.337; TCGA OV -0.107; TCGA PAAD -0.158; TCGA PRAD -0.13; TCGA SARC -0.156; TCGA STAD -0.347; TCGA UCEC -0.108 |
hsa-miR-148a-5p | EDNRA | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.314; TCGA BRCA -0.225; TCGA COAD -0.433; TCGA ESCA -0.287; TCGA HNSC -0.113; TCGA KIRC -0.204; TCGA LIHC -0.455; TCGA PAAD -0.246; TCGA PRAD -0.525; TCGA SARC -0.21; TCGA THCA -0.13; TCGA STAD -0.417; TCGA UCEC -0.149 |
hsa-miR-148a-5p | SPOCK1 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.252; TCGA BRCA -0.252; TCGA COAD -1.24; TCGA ESCA -0.668; TCGA HNSC -0.251; TCGA LIHC -0.637; TCGA PAAD -0.231; TCGA THCA -0.348; TCGA STAD -0.737 |
hsa-miR-148a-5p | ENAH | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.073; TCGA COAD -0.135; TCGA ESCA -0.261; TCGA HNSC -0.122; TCGA LIHC -0.282; TCGA LUSC -0.08; TCGA PRAD -0.13; TCGA SARC -0.108; TCGA THCA -0.148; TCGA STAD -0.211 |
hsa-miR-148a-5p | LSM11 | 12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.166; TCGA BRCA -0.086; TCGA CESC -0.064; TCGA ESCA -0.068; TCGA KIRC -0.136; TCGA KIRP -0.123; TCGA PAAD -0.082; TCGA PRAD -0.231; TCGA SARC -0.19; TCGA THCA -0.051; TCGA STAD -0.207; TCGA UCEC -0.054 |
hsa-miR-148a-5p | CD109 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.255; TCGA CESC -0.353; TCGA COAD -0.825; TCGA ESCA -0.754; TCGA HNSC -0.105; TCGA LIHC -0.349; TCGA LUAD -0.296; TCGA PAAD -0.205; TCGA PRAD -0.265; TCGA SARC -0.114; TCGA THCA -0.613; TCGA STAD -0.504; TCGA UCEC -0.378 |
hsa-miR-148a-5p | SKI | 9 cancers: BLCA; COAD; ESCA; KIRC; OV; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.067; TCGA COAD -0.09; TCGA ESCA -0.085; TCGA KIRC -0.093; TCGA OV -0.073; TCGA PAAD -0.101; TCGA THCA -0.064; TCGA STAD -0.171; TCGA UCEC -0.072 |
hsa-miR-148a-5p | FSTL1 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; OV; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.147; TCGA BRCA -0.161; TCGA COAD -0.462; TCGA ESCA -0.24; TCGA KIRP -0.175; TCGA LIHC -0.314; TCGA OV -0.108; TCGA PRAD -0.193; TCGA THCA -0.109; TCGA STAD -0.349 |
hsa-miR-148a-5p | PRICKLE2 | 9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.201; TCGA BRCA -0.225; TCGA COAD -0.499; TCGA KIRC -0.122; TCGA LIHC -0.346; TCGA PRAD -0.554; TCGA SARC -0.118; TCGA STAD -0.597; TCGA UCEC -0.105 |
hsa-miR-148a-5p | SNTB2 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.063; TCGA BRCA -0.076; TCGA CESC -0.062; TCGA COAD -0.084; TCGA ESCA -0.152; TCGA KIRC -0.091; TCGA LUSC -0.08; TCGA STAD -0.156; TCGA UCEC -0.091 |
hsa-miR-148a-5p | FEM1B | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.061; TCGA BRCA -0.12; TCGA CESC -0.127; TCGA COAD -0.054; TCGA ESCA -0.175; TCGA PRAD -0.125; TCGA SARC -0.197; TCGA STAD -0.187; TCGA UCEC -0.058 |
hsa-miR-148a-5p | MECP2 | 9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.052; TCGA BRCA -0.074; TCGA COAD -0.106; TCGA KIRC -0.094; TCGA LIHC -0.093; TCGA PRAD -0.103; TCGA SARC -0.085; TCGA STAD -0.184; TCGA UCEC -0.061 |
hsa-miR-148a-5p | CLIC4 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.191; TCGA CESC -0.093; TCGA COAD -0.34; TCGA ESCA -0.251; TCGA HNSC -0.087; TCGA PRAD -0.319; TCGA SARC -0.214; TCGA STAD -0.388; TCGA UCEC -0.066 |
hsa-miR-148a-5p | MSRB3 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.373; TCGA BRCA -0.253; TCGA COAD -0.906; TCGA ESCA -0.421; TCGA KIRC -0.231; TCGA LIHC -0.425; TCGA OV -0.15; TCGA PRAD -0.653; TCGA SARC -0.406; TCGA STAD -0.71; TCGA UCEC -0.192 |
hsa-miR-148a-5p | KIRREL | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.223; TCGA BRCA -0.212; TCGA COAD -0.522; TCGA ESCA -0.343; TCGA KIRC -0.331; TCGA LIHC -0.493; TCGA OV -0.14; TCGA PRAD -0.408; TCGA STAD -0.235; TCGA UCEC -0.153 |
hsa-miR-148a-5p | FLRT2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; OV; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.216; TCGA BRCA -0.153; TCGA COAD -0.763; TCGA ESCA -0.559; TCGA HNSC -0.235; TCGA KIRC -0.285; TCGA LIHC -0.489; TCGA OV -0.17; TCGA PRAD -0.491; TCGA STAD -0.315; TCGA UCEC -0.132 |
hsa-miR-148a-5p | PRKG1 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.348; TCGA BRCA -0.392; TCGA COAD -0.455; TCGA ESCA -0.293; TCGA KIRC -0.43; TCGA LIHC -0.279; TCGA OV -0.177; TCGA PRAD -0.68; TCGA SARC -0.231; TCGA STAD -0.477; TCGA UCEC -0.232 |
hsa-miR-148a-5p | SERPINE1 | 9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.285; TCGA COAD -0.485; TCGA ESCA -0.527; TCGA HNSC -0.484; TCGA LIHC -0.261; TCGA LUAD -0.121; TCGA PRAD -0.237; TCGA THCA -0.228; TCGA STAD -0.19 |
hsa-miR-148a-5p | RND3 | 13 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.137; TCGA COAD -0.095; TCGA ESCA -0.222; TCGA HNSC -0.119; TCGA LIHC -0.144; TCGA LUAD -0.161; TCGA LUSC -0.122; TCGA OV -0.2; TCGA PAAD -0.15; TCGA PRAD -0.608; TCGA THCA -0.292; TCGA STAD -0.22; TCGA UCEC -0.087 |
hsa-miR-148a-5p | FRMD6 | 9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; OV; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.121; TCGA BRCA -0.132; TCGA COAD -0.661; TCGA ESCA -0.654; TCGA LIHC -0.266; TCGA OV -0.105; TCGA PRAD -0.544; TCGA SARC -0.194; TCGA STAD -0.548 |
hsa-miR-148a-5p | RIMKLB | 9 cancers: BRCA; COAD; ESCA; LIHC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.104; TCGA COAD -0.584; TCGA ESCA -0.241; TCGA LIHC -0.254; TCGA PAAD -0.249; TCGA PRAD -0.229; TCGA SARC -0.11; TCGA STAD -0.324; TCGA UCEC -0.079 |
hsa-miR-148a-5p | VGLL3 | 9 cancers: BRCA; COAD; ESCA; KIRC; LIHC; OV; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.195; TCGA COAD -0.779; TCGA ESCA -0.385; TCGA KIRC -0.272; TCGA LIHC -0.46; TCGA OV -0.242; TCGA SARC -0.251; TCGA STAD -0.461; TCGA UCEC -0.207 |
hsa-miR-148a-5p | SESTD1 | 12 cancers: BRCA; CESC; COAD; KIRC; KIRP; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.219; TCGA CESC -0.101; TCGA COAD -0.136; TCGA KIRC -0.235; TCGA KIRP -0.1; TCGA LIHC -0.161; TCGA OV -0.135; TCGA PAAD -0.144; TCGA PRAD -0.162; TCGA SARC -0.097; TCGA THCA -0.065; TCGA STAD -0.244 |
hsa-miR-148a-5p | IDS | 11 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.13; TCGA CESC -0.103; TCGA COAD -0.261; TCGA ESCA -0.183; TCGA LIHC -0.071; TCGA LUSC -0.115; TCGA PAAD -0.12; TCGA PRAD -0.138; TCGA SARC -0.065; TCGA THCA -0.135; TCGA STAD -0.229 |
hsa-miR-148a-5p | ARPP19 | 9 cancers: BRCA; CESC; ESCA; KIRC; LIHC; PRAD; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.154; TCGA CESC -0.078; TCGA ESCA -0.119; TCGA KIRC -0.07; TCGA LIHC -0.068; TCGA PRAD -0.06; TCGA SARC -0.181; TCGA THCA -0.051; TCGA STAD -0.152 |
hsa-miR-148a-5p | TMC7 | 11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.212; TCGA CESC -0.193; TCGA HNSC -0.269; TCGA KIRC -0.187; TCGA KIRP -0.219; TCGA LIHC -0.566; TCGA LUAD -0.153; TCGA LUSC -0.27; TCGA SARC -0.165; TCGA THCA -0.12; TCGA UCEC -0.077 |
hsa-miR-148a-5p | DTX3 | 9 cancers: BRCA; COAD; ESCA; KIRC; LIHC; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.056; TCGA COAD -0.532; TCGA ESCA -0.243; TCGA KIRC -0.143; TCGA LIHC -0.351; TCGA PAAD -0.228; TCGA PRAD -0.17; TCGA STAD -0.33; TCGA UCEC -0.07 |
hsa-miR-148a-5p | PBX1 | 10 cancers: BRCA; CESC; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.258; TCGA CESC -0.118; TCGA COAD -0.168; TCGA KIRC -0.298; TCGA LIHC -0.188; TCGA PRAD -0.264; TCGA SARC -0.204; TCGA THCA -0.128; TCGA STAD -0.326; TCGA UCEC -0.079 |
hsa-miR-148a-5p | BICD2 | 10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BRCA -0.063; TCGA COAD -0.132; TCGA ESCA -0.443; TCGA HNSC -0.117; TCGA KIRC -0.101; TCGA LIHC -0.094; TCGA PAAD -0.157; TCGA PRAD -0.168; TCGA THCA -0.072; TCGA STAD -0.225 |
hsa-miR-148a-5p | ABI2 | 9 cancers: BRCA; COAD; KIRC; LIHC; LUSC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BRCA -0.091; TCGA COAD -0.122; TCGA KIRC -0.168; TCGA LIHC -0.244; TCGA LUSC -0.061; TCGA PAAD -0.076; TCGA SARC -0.1; TCGA THCA -0.097; TCGA STAD -0.233 |
hsa-miR-148a-5p | BICD1 | 9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; THCA; STAD | mirMAP | TCGA CESC -0.114; TCGA COAD -0.291; TCGA ESCA -0.196; TCGA HNSC -0.108; TCGA KIRC -0.123; TCGA LIHC -0.4; TCGA PAAD -0.229; TCGA THCA -0.171; TCGA STAD -0.136 |
hsa-miR-148a-5p | CSNK1E | 10 cancers: CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD | miRNATAP | TCGA CESC -0.089; TCGA ESCA -0.06; TCGA HNSC -0.116; TCGA KIRP -0.113; TCGA LIHC -0.245; TCGA LUAD -0.09; TCGA LUSC -0.059; TCGA PAAD -0.122; TCGA THCA -0.127; TCGA STAD -0.096 |
hsa-miR-148a-5p | AGPAT4 | 9 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; STAD | mirMAP | TCGA COAD -0.213; TCGA ESCA -0.17; TCGA HNSC -0.304; TCGA KIRC -0.214; TCGA KIRP -0.183; TCGA LIHC -0.254; TCGA PAAD -0.203; TCGA PRAD -0.438; TCGA STAD -0.286 |
hsa-miR-148a-5p | ABL2 | 9 cancers: COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; STAD | miRNATAP | TCGA COAD -0.15; TCGA ESCA -0.191; TCGA HNSC -0.109; TCGA KIRC -0.077; TCGA LIHC -0.078; TCGA LUAD -0.075; TCGA LUSC -0.076; TCGA THCA -0.093; TCGA STAD -0.081 |
hsa-miR-148a-5p | CNIH4 | 9 cancers: ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA ESCA -0.137; TCGA HNSC -0.115; TCGA LIHC -0.107; TCGA LUSC -0.106; TCGA PAAD -0.082; TCGA PRAD -0.064; TCGA SARC -0.054; TCGA THCA -0.098; TCGA STAD -0.096 |
Enriched cancer pathways of putative targets