microRNA information: hsa-miR-148a-5p

SectionIDlink
Mature name: hsa-miR-148a-5pmiRbase
Accession: MIMAT0004549miRbase
Precursor name: hsa-mir-148a miRbase
Precursor accession: MI0000253miRbase
Symbol: MIR148AHGNC
RefSeq ID: NR_029597GenBank
Sequence: AAAGUUCUGAGACACUCCGACU



Reported expression in cancers: hsa-miR-148a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-148a-5p

bladder cancerdownregulation"MicroRNA 148a represents an independent prognostic ......"26700670qPCR
hsa-miR-148a-5p

breast cancerdownregulation"MicroRNA 148a inhibits breast cancer migration and ......"26707142
hsa-miR-148a-5p

colorectal cancerupregulation"High expression of miR-27b miR-148a and miR-326 we ......"24119443
hsa-miR-148a-5p

colorectal cancerupregulation"Signature miRNAs in colorectal cancers were reveal ......"26646696RNA-Seq
hsa-miR-148a-5p

gastric cancerdownregulation"Our previous studies have revealed that miR-148a a ......"21205300
hsa-miR-148a-5p

gastric cancerdownregulation"Herein we identified the role of miR-148a in gastr ......"21552422
hsa-miR-148a-5p

gastric cancerdownregulation"In this study we investigate the role of miR-148a ......"21994419qPCR
hsa-miR-148a-5p

gastric cancerdownregulation"MicroRNA 148a is silenced by hypermethylation and ......"22167392
hsa-miR-148a-5p

gastric cancerdownregulation"microRNA 148a suppresses human gastric cancer cell ......"23873106qPCR
hsa-miR-148a-5p

gastric cancerdownregulation"To identify miRNAs that are associated with some c ......"24283384Microarray; qPCR
hsa-miR-148a-5p

gastric cancerdownregulation"The role of miR 148a in gastric cancer. MiR-148a i ......"24659367
hsa-miR-148a-5p

gastric cancerdownregulation"MiR-375 and miR-148a were found downregulated in s ......"24902858
hsa-miR-148a-5p

gastric cancerdownregulation"Expression level of miR-148a was detected by qRT-P ......"25341915qPCR
hsa-miR-148a-5p

gastric cancerdownregulation"In this research we demonstrated that miR-148a exp ......"27518872
hsa-miR-148a-5p

gastric cancerdownregulation"Expression and prognostic value of microRNA 26a an ......"27529338Reverse transcription PCR; qPCR
hsa-miR-148a-5p

liver cancerdownregulation"Decreased expression and clinical significance of ......"25444499qPCR
hsa-miR-148a-5p

liver cancerdownregulation"Decrease expression and clinicopathological signif ......"26248880qPCR
hsa-miR-148a-5p

liver cancerdownregulation"Differentiation therapy for hepatocellular carcino ......"26599259
hsa-miR-148a-5p

lung squamous cell cancerdownregulation"We found that miR-148a is significantly downregula ......"23670799
hsa-miR-148a-5p

lung squamous cell cancerdownregulation"Serum miR 152 miR 148a miR 148b and miR 21 as nove ......"25501703qPCR
hsa-miR-148a-5p

lung squamous cell cancerdownregulation"MicroRNA 148a Suppresses Invasion and Metastasis o ......"26584284Reverse transcription PCR
hsa-miR-148a-5p

ovarian cancerderegulation"Suppressive Role of MicroRNA 148a in Cell Prolifer ......"27712592
hsa-miR-148a-5p

pancreatic cancerdownregulation"Our previous studies have revealed that miR-148a i ......"23975374qPCR
hsa-miR-148a-5p

pancreatic cancerdownregulation"miR 148a and miR 216a regulated oncolytic adenovir ......"24895996
hsa-miR-148a-5p

prostate cancerdownregulation"It has been recently reported that miR-148a expres ......"20406806
hsa-miR-148a-5p

sarcomaupregulation"The expression levels of circulating miR-148a were ......"25185654qPCR
hsa-miR-148a-5p

sarcomadownregulation"MATERIAL AND METHODS According to the qRT-PCR anal ......"26638007qPCR



Reported cancer pathway affected by hsa-miR-148a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-148a-5p

bladder cancerApoptosis pathway"miR 148a dependent apoptosis of bladder cancer cel ......"25865490
hsa-miR-148a-5p

bladder cancerApoptosis pathway"MicroRNA 148a represents an independent prognostic ......"26700670
hsa-miR-148a-5p

breast cancerApoptosis pathway"Based on the results obtained in the last decade s ......"26199650
hsa-miR-148a-5p

chordomacell cycle pathway; Apoptosis pathway"The mRNA level of predicted and confirmed targets ......"27016303
hsa-miR-148a-5p

colorectal cancerApoptosis pathway"MiR 148a promotes apoptosis by targeting Bcl 2 in ......"21455217
hsa-miR-148a-5p

gastric cancercell cycle pathway"miR 148a promoted cell proliferation by targeting ......"21552422
hsa-miR-148a-5p

gastric cancerApoptosis pathway"MicroRNA 148a is silenced by hypermethylation and ......"22167392Western blot
hsa-miR-148a-5p

gastric cancerEpithelial mesenchymal transition pathway"microRNA 148a suppresses human gastric cancer cell ......"23873106Western blot; Luciferase
hsa-miR-148a-5p

gastric cancerApoptosis pathway"Expression and prognostic value of microRNA 26a an ......"27529338Colony formation
hsa-miR-148a-5p

glioblastomaApoptosis pathway"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-5p

liver cancercell cycle pathway"Role of miR 148a in hepatitis B associated hepatoc ......"22496917Colony formation
hsa-miR-148a-5p

liver cancerWnt signaling pathway"Inhibitions of epithelial to mesenchymal transitio ......"23861222
hsa-miR-148a-5p

ovarian cancerApoptosis pathway"MicroRNA 148a inhibits the proliferation and promo ......"26004124Western blot; Luciferase
hsa-miR-148a-5p

pancreatic cancerApoptosis pathway"MiR 148a regulates the growth and apoptosis in pan ......"23975374Colony formation; MTT assay; Western blot; Luciferase
hsa-miR-148a-5p

prostate cancerApoptosis pathway"Seven miRNAs miR-21 miR-32 miR-99a miR-99b miR-148 ......"22266859Western blot; Luciferase
hsa-miR-148a-5p

prostate cancerApoptosis pathway"Nevertheless decreased expressions of tumor suppre ......"26843836



Reported cancer prognosis affected by hsa-miR-148a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-148a-5p

bladder cancerworse prognosis; poor survival; metastasis; recurrence"MicroRNA 148a represents an independent prognostic ......"26700670
hsa-miR-148a-5p

breast cancerdifferentiation"In order to identify which miRNAs are involved in ......"22562546
hsa-miR-148a-5p

breast cancerstaging"Global miRNA analysis was performed on prospective ......"25004125
hsa-miR-148a-5p

breast cancerimmune evasion"GPER mediated estradiol reduces miR 148a to promot ......"25063027
hsa-miR-148a-5p

breast cancermetastasis; worse prognosis"Based on the results obtained in the last decade s ......"26199650
hsa-miR-148a-5p

breast cancermetastasis"MicroRNA 148a inhibits migration of breast cancer ......"26298724Western blot; Luciferase
hsa-miR-148a-5p

breast cancermetastasis"MicroRNA 148a inhibits breast cancer migration and ......"26707142
hsa-miR-148a-5p

breast cancermetastasis; worse prognosis"MiR 148a functions to suppress metastasis and serv ......"26967387
hsa-miR-148a-5p

chordomaprogression; differentiation"The mRNA level of predicted and confirmed targets ......"27016303
hsa-miR-148a-5p

colon cancerrecurrence"Groups of five patients with and without disease r ......"24400111
hsa-miR-148a-5p

colorectal cancerpoor survival; progression"The aim of this study was to investigate the hyper ......"21610744
hsa-miR-148a-5p

colorectal cancerworse prognosis"This article evaluates a recently published study ......"21902530
hsa-miR-148a-5p

colorectal cancerstaging; poor survival; drug resistance"The clinical significance of MiR 148a as a predict ......"23056401
hsa-miR-148a-5p

colorectal cancerrecurrence"TaqMan® Human MicroRNA Array Set v2.0 was used to ......"23280316
hsa-miR-148a-5p

colorectal cancerstaging"Clinical significance of microRNA 148a in patients ......"23933284
hsa-miR-148a-5p

colorectal cancerprogression; poor survival"High expression of miR-27b miR-148a and miR-326 we ......"24119443
hsa-miR-148a-5p

colorectal cancertumorigenesis; staging; progression"Significance of miR 148a in Colorectal Neoplasia: ......"26389729
hsa-miR-148a-5p

esophageal cancerdifferentiation; recurrence"The expression of miR-21 miR-106a miR-148a miR-205 ......"20628822
hsa-miR-148a-5p

gastric cancermetastasis"Differential expression of miRNAs was studied usin ......"20726036
hsa-miR-148a-5p

gastric cancerprogression; staging"miR 148a promoted cell proliferation by targeting ......"21552422
hsa-miR-148a-5p

gastric cancermetastasis; poor survival"The function of a specific miRNA miR-148a was furt ......"21703006
hsa-miR-148a-5p

gastric cancermetastasis; staging; cell migration; progression"MicroRNA 148a suppresses tumor cell invasion and m ......"21994419Luciferase
hsa-miR-148a-5p

gastric cancermetastasis; staging"In a pilot study serum levels of miR-21 miR-27a mi ......"23806809
hsa-miR-148a-5p

gastric cancerprogression"Quantitative proteomics reveals diverse roles of m ......"23869555
hsa-miR-148a-5p

gastric cancermetastasis; staging; worse prognosis"microRNA 148a suppresses human gastric cancer cell ......"23873106Western blot; Luciferase
hsa-miR-148a-5p

gastric cancerworse prognosis; progression; staging; metastasis"MicroRNA 148a is downregulated in gastric cancer t ......"24283384Western blot
hsa-miR-148a-5p

gastric cancertumorigenesis"MiR 148a regulates MEG3 in gastric cancer by targe ......"24515776
hsa-miR-148a-5p

gastric cancermetastasis"The role of miR 148a in gastric cancer; MiR-148a i ......"24659367
hsa-miR-148a-5p

gastric cancerstaging; metastasis"Impact of miR 148a on the proliferation of gastric ......"25341915Western blot
hsa-miR-148a-5p

gastric cancerworse prognosis"A genetic variant of miR 148a binding site in the ......"25399950Luciferase
hsa-miR-148a-5p

gastric cancerstaging; metastasis"Evaluation of miR 29c miR 124 miR 135a and miR 148 ......"26885198
hsa-miR-148a-5p

gastric cancermetastasis; tumorigenesis"MiR 148a Functions as a Tumor Suppressor by Target ......"27518872Western blot; Luciferase
hsa-miR-148a-5p

glioblastomapoor survival"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-5p

glioblastomapoor survival"Inhibition of two "risky" miRNAs miR-148a and miR- ......"25903473
hsa-miR-148a-5p

liver cancermetastasis"Identification of metastasis related microRNAs of ......"19912688
hsa-miR-148a-5p

liver cancerprogression; cell migration"Role of miR 148a in hepatitis B associated hepatoc ......"22496917Colony formation
hsa-miR-148a-5p

liver cancermetastasis; differentiation"Inhibitions of epithelial to mesenchymal transitio ......"23861222
hsa-miR-148a-5p

liver cancerworse prognosis; poor survival; recurrence; progression"microRNA 148a dysregulation discriminates poor pro ......"24798342
hsa-miR-148a-5p

liver cancerstaging; metastasis; tumorigenesis; worse prognosis"Decreased expression and clinical significance of ......"25444499
hsa-miR-148a-5p

liver cancerpoor survival; staging; metastasis; recurrence; tumorigenesis"Decrease expression and clinicopathological signif ......"26248880
hsa-miR-148a-5p

liver cancermetastasis"After transfection of the HepG2 and SMMC‑7721 HC ......"26530325Western blot; MTT assay; Luciferase
hsa-miR-148a-5p

liver cancerdifferentiation; progression"Differentiation therapy for hepatocellular carcino ......"26599259
hsa-miR-148a-5p

lung squamous cell cancermetastasis"MicroRNA 148a suppresses epithelial to mesenchymal ......"23670799Luciferase
hsa-miR-148a-5p

lung squamous cell cancermetastasis; malignant trasformation; staging"MicroRNA 148a Suppresses Invasion and Metastasis o ......"26584284
hsa-miR-148a-5p

lung squamous cell cancerstaging"The aim of this study was to determine whether cir ......"27461630
hsa-miR-148a-5p

ovarian cancerpoor survival; drug resistance; tumorigenesis"Altered expression of miR 152 and miR 148a in ovar ......"21971665Cell proliferation assay; Cell Proliferation Assay
hsa-miR-148a-5p

ovarian cancerprogression; poor survival"By analyzing multidimensional datasets of ovarian ......"25537514
hsa-miR-148a-5p

ovarian cancercell migration"MicroRNA 148a inhibits migration and invasion of o ......"26004261Western blot; Luciferase; Transwell assay
hsa-miR-148a-5p

ovarian cancermetastasis; worse prognosis; progression; poor survival"Decreased expression of microRNA 148a predicts poo ......"27470550
hsa-miR-148a-5p

pancreatic cancerstaging; differentiation"Expressions of miRNAs were determined with the Taq ......"22851141
hsa-miR-148a-5p

pancreatic cancerstaging"miR 148a and miR 216a regulated oncolytic adenovir ......"24895996
hsa-miR-148a-5p

pancreatic cancermetastasis; tumorigenesis"The Interplay Between miR 148a and DNMT1 Might be ......"25950085
hsa-miR-148a-5p

pancreatic cancertumorigenesis"MicroRNA 148a Suppresses the Proliferation and Mig ......"27518467Cell migration assay
hsa-miR-148a-5p

prostate cancerdrug resistance; cell migration"MiR 148a attenuates paclitaxel resistance of hormo ......"20406806Luciferase
hsa-miR-148a-5p

prostate cancerdrug resistance"To screen for epigenetically silenced miRNAs in pr ......"22310291
hsa-miR-148a-5p

prostate cancerstaging; malignant trasformation"Comparative microRNA profiling of prostate carcino ......"24337069
hsa-miR-148a-5p

prostate cancerstaging; drug resistance"Following global miRNA profiling of cell line mode ......"25053345
hsa-miR-148a-5p

prostate cancerdrug resistance"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-148a-5p

sarcomaworse prognosis; metastasis; tumor size; poor survival; progression"Circulating miR 148a is a significant diagnostic a ......"25185654
hsa-miR-148a-5p

sarcomadifferentiation"Bufalin Inhibits the Differentiation and Prolifera ......"26111756
hsa-miR-148a-5p

sarcomametastasis; worse prognosis; differentiation"Down Regulation of miR 148a Promotes Metastasis by ......"26638007Luciferase



Reported gene related to hsa-miR-148a-5p

miRNAcancergenereportingPUBMED
hsa-miR-148a-5p

bladder cancerDNMT1"miR 148a dependent apoptosis of bladder cancer cel ......"25865490
hsa-miR-148a-5p

gastric cancerDNMT1"Studies have shown that microRNA-148a miR-148a was ......"22167392
hsa-miR-148a-5p

pancreatic cancerDNMT1"The Interplay Between miR 148a and DNMT1 Might be ......"25950085
hsa-miR-148a-5p

sarcomaDNMT1"Moreover we found that miR-148a appeared to be a t ......"26111756
hsa-miR-148a-5p

breast cancerSMAD2"By targeting of the SMAD2-3'-UTR miR-148a blocked ......"25980823
hsa-miR-148a-5p

gastric cancerSMAD2"miR 148a downregulates the expression of transform ......"26983401
hsa-miR-148a-5p

gastric cancerSMAD2"Finally the SMAD2 gene was identified as the direc ......"23873106
hsa-miR-148a-5p

liver cancerSMAD2"MiR-148a which targeted the SMAD2-3'UTR decreased ......"24806207
hsa-miR-148a-5p

breast cancerMMP7"The overexpression of miR-148a reduced the mRNA an ......"26707142
hsa-miR-148a-5p

colorectal cancerMMP7"To further confirm the direct effect of miR-148a o ......"26389729
hsa-miR-148a-5p

gastric cancerMMP7"MicroRNA 148a is downregulated in gastric cancer t ......"24283384
hsa-miR-148a-5p

colorectal cancerBCL2"MiR 148a promotes apoptosis by targeting Bcl 2 in ......"21455217
hsa-miR-148a-5p

pancreatic cancerBCL2"MiR 148a regulates the growth and apoptosis in pan ......"23975374
hsa-miR-148a-5p

gastric cancerCCKBR"More importantly siRNA-induced knockdown of CCK-BR ......"27518872
hsa-miR-148a-5p

pancreatic cancerCCKBR"MiR 148a regulates the growth and apoptosis in pan ......"23975374
hsa-miR-148a-5p

breast cancerGLA"Here we reported that GLA attenuated the CSC-like ......"25980823
hsa-miR-148a-5p

liver cancerGLA"Here we found that GLA attenuated the CSCs-like pr ......"24806207
hsa-miR-148a-5p

breast cancerGPER1"GPER mediated estradiol reduces miR 148a to promot ......"25063027
hsa-miR-148a-5p

breast cancerGPER1"Estradiol induces HOTAIR levels via GPER mediated ......"25928008
hsa-miR-148a-5p

breast cancerHLA-G"GPER mediated estradiol reduces miR 148a to promot ......"25063027
hsa-miR-148a-5p

cervical and endocervical cancerHLA-G"Long non coding RNA HOTAIR modulates HLA G express ......"27574106
hsa-miR-148a-5p

breast cancerHOTAIR"Estradiol induces HOTAIR levels via GPER mediated ......"25928008
hsa-miR-148a-5p

cervical and endocervical cancerHOTAIR"Long non coding RNA HOTAIR modulates HLA G express ......"27574106
hsa-miR-148a-5p

gastric cancerROCK1"MicroRNA 148a suppresses tumor cell invasion and m ......"21994419
hsa-miR-148a-5p

lung squamous cell cancerROCK1"MicroRNA 148a suppresses epithelial to mesenchymal ......"23670799
hsa-miR-148a-5p

breast cancerWNT1"Mechanistically miR-148a appears to suppress the e ......"26967387
hsa-miR-148a-5p

liver cancerWNT1"Via TargetScan and microRNA.org algorithms miR-148 ......"23861222
hsa-miR-148a-5p

prostate cancerAR"We found that androgen receptor is the most freque ......"27292025
hsa-miR-148a-5p

glioblastomaBCL2L11"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-5p

liver cancerCD44"In MHCC97H and MHCC97L cells over-expression of mi ......"23861222
hsa-miR-148a-5p

gastric cancerCDC25B"Gene CDC25B might be the target gene of miR-148a a ......"25341915
hsa-miR-148a-5p

gastric cancerCDH1"miR-148a overexpression also downregulated vimenti ......"23873106
hsa-miR-148a-5p

esophageal cancerCYLD"In EAC miR-148a expression levels were inversely a ......"20628822
hsa-miR-148a-5p

acute myeloid leukemiaDNMT3B"Low ERG expressers presented with down-regulation ......"20841507
hsa-miR-148a-5p

gastric cancerDYNLL1"One miRNA miR-148a was identified and its function ......"21703006
hsa-miR-148a-5p

glioblastomaEGFR"microRNA 148a is a prognostic oncomiR that targets ......"24425048
hsa-miR-148a-5p

pancreatic cancerERBB3"MicroRNA 148a Suppresses the Proliferation and Mig ......"27518467
hsa-miR-148a-5p

acute myeloid leukemiaERG"Low ERG expressers presented with down-regulation ......"20841507
hsa-miR-148a-5p

breast cancerESR1"miR-148a plays an important role in regulation of ......"25063027
hsa-miR-148a-5p

glioblastomaGSC"miR-148a expression was elevated in human glioblas ......"24425048
hsa-miR-148a-5p

gastric cancerMEG3"MiR 148a regulates MEG3 in gastric cancer by targe ......"24515776
hsa-miR-148a-5p

melanomaMITF"miR 148 regulates Mitf in melanoma cells; Furtherm ......"20644734
hsa-miR-148a-5p

breast cancerMMP13"MicroRNA 148a inhibits migration of breast cancer ......"26298724
hsa-miR-148a-5p

ovarian cancerMMP9"Overexpression of miR-148a caused a significant de ......"27712592
hsa-miR-148a-5p

glioblastomaNFASC"NF κB induces miR 148a to sustain TGF β/Smad sig ......"25971746
hsa-miR-148a-5p

breast cancerNRP1"Mechanistically miR-148a appears to suppress the e ......"26967387
hsa-miR-148a-5p

ovarian cancerPDIA3"MicroRNA 148a inhibits the proliferation and promo ......"26004124
hsa-miR-148a-5p

gastric cancerPDYN"Using bioinformatics tools we selected two SNPs SC ......"25399950
hsa-miR-148a-5p

liver cancerPTEN"Introduction of anti-miR-148a increased PTEN prote ......"22496917
hsa-miR-148a-5p

prostate cancerRPS6KA5"MiR 148a attenuates paclitaxel resistance of hormo ......"20406806
hsa-miR-148a-5p

gastric cancerRUNX3"We investigated the role of microRNA-148a miR-148a ......"23549984
hsa-miR-148a-5p

liver cancerS1PR1"USP4 and S1P1 were up-regulated in mesenchymal-typ ......"24798342
hsa-miR-148a-5p

gastric cancerSCRN1"A genetic variant of miR 148a binding site in the ......"25399950
hsa-miR-148a-5p

gastric cancerSMAD4"In GC cell lines we constructed and transfected a ......"26983401
hsa-miR-148a-5p

gastric cancerSTAT3"Taken together our results suggest that miR-148a s ......"27518872
hsa-miR-148a-5p

gastric cancerTCF3"MicroRNA 148a can regulate runt related transcript ......"23549984
hsa-miR-148a-5p

breast cancerTCF7L2"The overexpression of miR-148a reduced the mRNA an ......"26707142
hsa-miR-148a-5p

sarcomaTGIF2"Down Regulation of miR 148a Promotes Metastasis by ......"26638007
hsa-miR-148a-5p

gastric cancerTHBS1"Using the TSP algorithm hsa-miR-196a and hsa-miR-1 ......"24527072
hsa-miR-148a-5p

liver cancerTHY1"In MHCC97H and MHCC97L cells over-expression of mi ......"23861222
hsa-miR-148a-5p

liver cancerUSP4"microRNA 148a dysregulation discriminates poor pro ......"24798342
hsa-miR-148a-5p

gastric cancerVIM"miR-148a overexpression also downregulated vimenti ......"23873106
hsa-miR-148a-5p

liver cancerVWCE"HBx and URG11 also alter the expression of multipl ......"22496917



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-148a-5p
RBM24
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.297; TCGA BRCA -0.606; TCGA COAD -0.597; TCGA ESCA -0.424; TCGA HNSC -0.26; TCGA PAAD -0.31; TCGA PRAD -0.312; TCGA SARC -0.717; TCGA STAD -0.702; TCGA UCEC -0.316
hsa-miR-148a-5p
KIFC3
14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.234; TCGA COAD -0.337; TCGA ESCA -0.192; TCGA HNSC -0.3; TCGA KIRC -0.152; TCGA KIRP -0.143; TCGA LIHC -0.227; TCGA LUAD -0.17; TCGA LUSC -0.133; TCGA OV -0.12; TCGA PRAD -0.511; TCGA THCA -0.07; TCGA STAD -0.145; TCGA UCEC -0.083
hsa-miR-148a-5p
SGIP1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.235; TCGA BRCA -0.173; TCGA COAD -0.471; TCGA ESCA -0.209; TCGA HNSC -0.187; TCGA KIRC -0.466; TCGA LIHC -0.382; TCGA PAAD -0.267; TCGA PRAD -0.207; TCGA SARC -0.56; TCGA STAD -0.369; TCGA UCEC -0.129
hsa-miR-148a-5p
COL5A2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.203; TCGA BRCA -0.122; TCGA COAD -0.516; TCGA ESCA -0.442; TCGA HNSC -0.298; TCGA LIHC -0.431; TCGA OV -0.248; TCGA PAAD -0.239; TCGA PRAD -0.127; TCGA THCA -0.166; TCGA STAD -0.199
hsa-miR-148a-5p
TCEAL1
9 cancers: BLCA; BRCA; COAD; KIRC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.149; TCGA BRCA -0.199; TCGA COAD -0.095; TCGA KIRC -0.077; TCGA LUSC -0.11; TCGA PRAD -0.166; TCGA SARC -0.353; TCGA STAD -0.197; TCGA UCEC -0.078
hsa-miR-148a-5p
WWC2
9 cancers: BLCA; BRCA; COAD; KIRC; LUAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.199; TCGA BRCA -0.138; TCGA COAD -0.516; TCGA KIRC -0.185; TCGA LUAD -0.159; TCGA PRAD -0.22; TCGA THCA -0.157; TCGA STAD -0.193; TCGA UCEC -0.122
hsa-miR-148a-5p
PPFIBP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BLCA -0.118; TCGA BRCA -0.119; TCGA CESC -0.089; TCGA COAD -0.089; TCGA ESCA -0.194; TCGA HNSC -0.096; TCGA KIRC -0.161; TCGA LIHC -0.165; TCGA LUAD -0.13; TCGA LUSC -0.14; TCGA THCA -0.151; TCGA STAD -0.197
hsa-miR-148a-5p
SEPT10
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.09; TCGA BRCA -0.053; TCGA CESC -0.107; TCGA COAD -0.106; TCGA ESCA -0.174; TCGA KIRC -0.125; TCGA LUAD -0.065; TCGA LUSC -0.16; TCGA PRAD -0.143; TCGA SARC -0.175; TCGA THCA -0.106; TCGA STAD -0.245
hsa-miR-148a-5p
SYNM
9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.51; TCGA COAD -1.247; TCGA ESCA -0.503; TCGA LIHC -0.126; TCGA LUAD -0.136; TCGA PRAD -0.778; TCGA SARC -0.679; TCGA STAD -1.138; TCGA UCEC -0.156
hsa-miR-148a-5p
RASAL2
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.096; TCGA BRCA -0.054; TCGA CESC -0.156; TCGA ESCA -0.082; TCGA KIRC -0.208; TCGA LIHC -0.142; TCGA LUAD -0.18; TCGA LUSC -0.125; TCGA PAAD -0.106; TCGA PRAD -0.102; TCGA THCA -0.188; TCGA STAD -0.077
hsa-miR-148a-5p
PPP1R12B
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.341; TCGA BRCA -0.164; TCGA COAD -0.56; TCGA KIRC -0.169; TCGA LIHC -0.085; TCGA PRAD -0.527; TCGA SARC -0.804; TCGA STAD -0.749; TCGA UCEC -0.297
hsa-miR-148a-5p
RUNX1T1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.168; TCGA BRCA -0.257; TCGA COAD -0.739; TCGA ESCA -0.204; TCGA KIRC -0.449; TCGA OV -0.273; TCGA PRAD -0.377; TCGA STAD -0.511; TCGA UCEC -0.421
hsa-miR-148a-5p
TIMP3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.225; TCGA BRCA -0.378; TCGA CESC -0.226; TCGA COAD -0.694; TCGA ESCA -0.377; TCGA HNSC -0.147; TCGA KIRC -0.284; TCGA OV -0.171; TCGA PAAD -0.244; TCGA PRAD -0.454; TCGA STAD -0.399; TCGA UCEC -0.232
hsa-miR-148a-5p
KLHL4
10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.363; TCGA BRCA -0.315; TCGA COAD -0.878; TCGA ESCA -0.44; TCGA LIHC -0.205; TCGA OV -0.233; TCGA PRAD -0.631; TCGA SARC -0.198; TCGA STAD -0.642; TCGA UCEC -0.285
hsa-miR-148a-5p
KATNAL1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.2; TCGA CESC -0.094; TCGA COAD -0.373; TCGA ESCA -0.336; TCGA LUAD -0.057; TCGA LUSC -0.091; TCGA PAAD -0.158; TCGA PRAD -0.334; TCGA SARC -0.082; TCGA STAD -0.417; TCGA UCEC -0.112
hsa-miR-148a-5p
SH3PXD2A
9 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.174; TCGA BRCA -0.067; TCGA ESCA -0.2; TCGA KIRC -0.118; TCGA LIHC -0.141; TCGA PRAD -0.35; TCGA THCA -0.13; TCGA STAD -0.247; TCGA UCEC -0.116
hsa-miR-148a-5p
LTBP2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; OV; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.215; TCGA BRCA -0.18; TCGA CESC -0.148; TCGA COAD -0.508; TCGA ESCA -0.259; TCGA KIRC -0.183; TCGA LIHC -0.653; TCGA OV -0.188; TCGA PRAD -0.336; TCGA THCA -0.14; TCGA STAD -0.195
hsa-miR-148a-5p
BCL2L2
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; SARC
mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.125; TCGA COAD -0.062; TCGA ESCA -0.132; TCGA KIRC -0.1; TCGA LIHC -0.059; TCGA LUAD -0.05; TCGA LUSC -0.12; TCGA SARC -0.174
hsa-miR-148a-5p
MAP1B
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.296; TCGA BRCA -0.115; TCGA COAD -0.676; TCGA ESCA -0.412; TCGA LIHC -0.426; TCGA PRAD -0.619; TCGA SARC -0.283; TCGA STAD -0.609; TCGA UCEC -0.139
hsa-miR-148a-5p
PRKAB2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; STAD
mirMAP
TCGA BLCA -0.12; TCGA BRCA -0.079; TCGA CESC -0.096; TCGA COAD -0.108; TCGA ESCA -0.113; TCGA HNSC -0.172; TCGA KIRC -0.1; TCGA LUAD -0.074; TCGA LUSC -0.12; TCGA SARC -0.201; TCGA STAD -0.205
hsa-miR-148a-5p
SYT11
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.115; TCGA BRCA -0.065; TCGA COAD -0.591; TCGA KIRC -0.155; TCGA LIHC -0.295; TCGA PRAD -0.497; TCGA SARC -0.278; TCGA THCA -0.124; TCGA STAD -0.332; TCGA UCEC -0.16
hsa-miR-148a-5p
NAV1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.082; TCGA BRCA -0.236; TCGA COAD -0.298; TCGA ESCA -0.333; TCGA HNSC -0.082; TCGA KIRC -0.131; TCGA LIHC -0.314; TCGA PAAD -0.268; TCGA THCA -0.175; TCGA STAD -0.121
hsa-miR-148a-5p
KIAA1614
11 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.124; TCGA BRCA -0.093; TCGA COAD -0.395; TCGA ESCA -0.272; TCGA LIHC -0.409; TCGA LUAD -0.129; TCGA LUSC -0.132; TCGA PRAD -0.54; TCGA SARC -0.155; TCGA STAD -0.388; TCGA UCEC -0.139
hsa-miR-148a-5p
SULF1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.192; TCGA BRCA -0.093; TCGA COAD -0.84; TCGA ESCA -0.485; TCGA KIRC -0.185; TCGA KIRP -0.213; TCGA LIHC -0.925; TCGA PAAD -0.267; TCGA PRAD -0.42; TCGA SARC -0.268; TCGA STAD -0.355
hsa-miR-148a-5p
PDE5A
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.137; TCGA BRCA -0.302; TCGA COAD -0.319; TCGA KIRC -0.258; TCGA LIHC -0.51; TCGA PRAD -0.566; TCGA SARC -0.445; TCGA THCA -0.711; TCGA STAD -0.434; TCGA UCEC -0.112
hsa-miR-148a-5p
IGF1R
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.392; TCGA CESC -0.237; TCGA COAD -0.148; TCGA ESCA -0.252; TCGA KIRC -0.171; TCGA LIHC -0.626; TCGA LUAD -0.12; TCGA OV -0.245; TCGA SARC -0.159; TCGA THCA -0.167; TCGA STAD -0.221; TCGA UCEC -0.166
hsa-miR-148a-5p
RGS5
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.244; TCGA BRCA -0.209; TCGA COAD -0.359; TCGA KIRC -0.241; TCGA LIHC -0.251; TCGA PRAD -0.195; TCGA THCA -0.142; TCGA STAD -0.206; TCGA UCEC -0.106
hsa-miR-148a-5p
RBMS3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.244; TCGA BRCA -0.296; TCGA COAD -0.568; TCGA ESCA -0.235; TCGA KIRC -0.309; TCGA LIHC -0.157; TCGA OV -0.159; TCGA PRAD -0.496; TCGA STAD -0.417; TCGA UCEC -0.235
hsa-miR-148a-5p
DIP2C
9 cancers: BLCA; BRCA; COAD; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.09; TCGA BRCA -0.178; TCGA COAD -0.337; TCGA OV -0.107; TCGA PAAD -0.158; TCGA PRAD -0.13; TCGA SARC -0.156; TCGA STAD -0.347; TCGA UCEC -0.108
hsa-miR-148a-5p
EDNRA
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.314; TCGA BRCA -0.225; TCGA COAD -0.433; TCGA ESCA -0.287; TCGA HNSC -0.113; TCGA KIRC -0.204; TCGA LIHC -0.455; TCGA PAAD -0.246; TCGA PRAD -0.525; TCGA SARC -0.21; TCGA THCA -0.13; TCGA STAD -0.417; TCGA UCEC -0.149
hsa-miR-148a-5p
SPOCK1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.252; TCGA BRCA -0.252; TCGA COAD -1.24; TCGA ESCA -0.668; TCGA HNSC -0.251; TCGA LIHC -0.637; TCGA PAAD -0.231; TCGA THCA -0.348; TCGA STAD -0.737
hsa-miR-148a-5p
ENAH
10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.073; TCGA COAD -0.135; TCGA ESCA -0.261; TCGA HNSC -0.122; TCGA LIHC -0.282; TCGA LUSC -0.08; TCGA PRAD -0.13; TCGA SARC -0.108; TCGA THCA -0.148; TCGA STAD -0.211
hsa-miR-148a-5p
LSM11
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.166; TCGA BRCA -0.086; TCGA CESC -0.064; TCGA ESCA -0.068; TCGA KIRC -0.136; TCGA KIRP -0.123; TCGA PAAD -0.082; TCGA PRAD -0.231; TCGA SARC -0.19; TCGA THCA -0.051; TCGA STAD -0.207; TCGA UCEC -0.054
hsa-miR-148a-5p
CD109
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.255; TCGA CESC -0.353; TCGA COAD -0.825; TCGA ESCA -0.754; TCGA HNSC -0.105; TCGA LIHC -0.349; TCGA LUAD -0.296; TCGA PAAD -0.205; TCGA PRAD -0.265; TCGA SARC -0.114; TCGA THCA -0.613; TCGA STAD -0.504; TCGA UCEC -0.378
hsa-miR-148a-5p
SKI
9 cancers: BLCA; COAD; ESCA; KIRC; OV; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.067; TCGA COAD -0.09; TCGA ESCA -0.085; TCGA KIRC -0.093; TCGA OV -0.073; TCGA PAAD -0.101; TCGA THCA -0.064; TCGA STAD -0.171; TCGA UCEC -0.072
hsa-miR-148a-5p
FSTL1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; OV; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.147; TCGA BRCA -0.161; TCGA COAD -0.462; TCGA ESCA -0.24; TCGA KIRP -0.175; TCGA LIHC -0.314; TCGA OV -0.108; TCGA PRAD -0.193; TCGA THCA -0.109; TCGA STAD -0.349
hsa-miR-148a-5p
PRICKLE2
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.201; TCGA BRCA -0.225; TCGA COAD -0.499; TCGA KIRC -0.122; TCGA LIHC -0.346; TCGA PRAD -0.554; TCGA SARC -0.118; TCGA STAD -0.597; TCGA UCEC -0.105
hsa-miR-148a-5p
SNTB2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.063; TCGA BRCA -0.076; TCGA CESC -0.062; TCGA COAD -0.084; TCGA ESCA -0.152; TCGA KIRC -0.091; TCGA LUSC -0.08; TCGA STAD -0.156; TCGA UCEC -0.091
hsa-miR-148a-5p
FEM1B
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.061; TCGA BRCA -0.12; TCGA CESC -0.127; TCGA COAD -0.054; TCGA ESCA -0.175; TCGA PRAD -0.125; TCGA SARC -0.197; TCGA STAD -0.187; TCGA UCEC -0.058
hsa-miR-148a-5p
MECP2
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.052; TCGA BRCA -0.074; TCGA COAD -0.106; TCGA KIRC -0.094; TCGA LIHC -0.093; TCGA PRAD -0.103; TCGA SARC -0.085; TCGA STAD -0.184; TCGA UCEC -0.061
hsa-miR-148a-5p
CLIC4
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.191; TCGA CESC -0.093; TCGA COAD -0.34; TCGA ESCA -0.251; TCGA HNSC -0.087; TCGA PRAD -0.319; TCGA SARC -0.214; TCGA STAD -0.388; TCGA UCEC -0.066
hsa-miR-148a-5p
MSRB3
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.373; TCGA BRCA -0.253; TCGA COAD -0.906; TCGA ESCA -0.421; TCGA KIRC -0.231; TCGA LIHC -0.425; TCGA OV -0.15; TCGA PRAD -0.653; TCGA SARC -0.406; TCGA STAD -0.71; TCGA UCEC -0.192
hsa-miR-148a-5p
KIRREL
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.223; TCGA BRCA -0.212; TCGA COAD -0.522; TCGA ESCA -0.343; TCGA KIRC -0.331; TCGA LIHC -0.493; TCGA OV -0.14; TCGA PRAD -0.408; TCGA STAD -0.235; TCGA UCEC -0.153
hsa-miR-148a-5p
FLRT2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.216; TCGA BRCA -0.153; TCGA COAD -0.763; TCGA ESCA -0.559; TCGA HNSC -0.235; TCGA KIRC -0.285; TCGA LIHC -0.489; TCGA OV -0.17; TCGA PRAD -0.491; TCGA STAD -0.315; TCGA UCEC -0.132
hsa-miR-148a-5p
PRKG1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.348; TCGA BRCA -0.392; TCGA COAD -0.455; TCGA ESCA -0.293; TCGA KIRC -0.43; TCGA LIHC -0.279; TCGA OV -0.177; TCGA PRAD -0.68; TCGA SARC -0.231; TCGA STAD -0.477; TCGA UCEC -0.232
hsa-miR-148a-5p
SERPINE1
9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.285; TCGA COAD -0.485; TCGA ESCA -0.527; TCGA HNSC -0.484; TCGA LIHC -0.261; TCGA LUAD -0.121; TCGA PRAD -0.237; TCGA THCA -0.228; TCGA STAD -0.19
hsa-miR-148a-5p
RND3
13 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.137; TCGA COAD -0.095; TCGA ESCA -0.222; TCGA HNSC -0.119; TCGA LIHC -0.144; TCGA LUAD -0.161; TCGA LUSC -0.122; TCGA OV -0.2; TCGA PAAD -0.15; TCGA PRAD -0.608; TCGA THCA -0.292; TCGA STAD -0.22; TCGA UCEC -0.087
hsa-miR-148a-5p
FRMD6
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; OV; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.132; TCGA COAD -0.661; TCGA ESCA -0.654; TCGA LIHC -0.266; TCGA OV -0.105; TCGA PRAD -0.544; TCGA SARC -0.194; TCGA STAD -0.548
hsa-miR-148a-5p
RIMKLB
9 cancers: BRCA; COAD; ESCA; LIHC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.104; TCGA COAD -0.584; TCGA ESCA -0.241; TCGA LIHC -0.254; TCGA PAAD -0.249; TCGA PRAD -0.229; TCGA SARC -0.11; TCGA STAD -0.324; TCGA UCEC -0.079
hsa-miR-148a-5p
VGLL3
9 cancers: BRCA; COAD; ESCA; KIRC; LIHC; OV; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.195; TCGA COAD -0.779; TCGA ESCA -0.385; TCGA KIRC -0.272; TCGA LIHC -0.46; TCGA OV -0.242; TCGA SARC -0.251; TCGA STAD -0.461; TCGA UCEC -0.207
hsa-miR-148a-5p
SESTD1
12 cancers: BRCA; CESC; COAD; KIRC; KIRP; LIHC; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.219; TCGA CESC -0.101; TCGA COAD -0.136; TCGA KIRC -0.235; TCGA KIRP -0.1; TCGA LIHC -0.161; TCGA OV -0.135; TCGA PAAD -0.144; TCGA PRAD -0.162; TCGA SARC -0.097; TCGA THCA -0.065; TCGA STAD -0.244
hsa-miR-148a-5p
IDS
11 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.13; TCGA CESC -0.103; TCGA COAD -0.261; TCGA ESCA -0.183; TCGA LIHC -0.071; TCGA LUSC -0.115; TCGA PAAD -0.12; TCGA PRAD -0.138; TCGA SARC -0.065; TCGA THCA -0.135; TCGA STAD -0.229
hsa-miR-148a-5p
ARPP19
9 cancers: BRCA; CESC; ESCA; KIRC; LIHC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.154; TCGA CESC -0.078; TCGA ESCA -0.119; TCGA KIRC -0.07; TCGA LIHC -0.068; TCGA PRAD -0.06; TCGA SARC -0.181; TCGA THCA -0.051; TCGA STAD -0.152
hsa-miR-148a-5p
TMC7
11 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; UCEC
mirMAP
TCGA BRCA -0.212; TCGA CESC -0.193; TCGA HNSC -0.269; TCGA KIRC -0.187; TCGA KIRP -0.219; TCGA LIHC -0.566; TCGA LUAD -0.153; TCGA LUSC -0.27; TCGA SARC -0.165; TCGA THCA -0.12; TCGA UCEC -0.077
hsa-miR-148a-5p
DTX3
9 cancers: BRCA; COAD; ESCA; KIRC; LIHC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.056; TCGA COAD -0.532; TCGA ESCA -0.243; TCGA KIRC -0.143; TCGA LIHC -0.351; TCGA PAAD -0.228; TCGA PRAD -0.17; TCGA STAD -0.33; TCGA UCEC -0.07
hsa-miR-148a-5p
PBX1
10 cancers: BRCA; CESC; COAD; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.258; TCGA CESC -0.118; TCGA COAD -0.168; TCGA KIRC -0.298; TCGA LIHC -0.188; TCGA PRAD -0.264; TCGA SARC -0.204; TCGA THCA -0.128; TCGA STAD -0.326; TCGA UCEC -0.079
hsa-miR-148a-5p
BICD2
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.063; TCGA COAD -0.132; TCGA ESCA -0.443; TCGA HNSC -0.117; TCGA KIRC -0.101; TCGA LIHC -0.094; TCGA PAAD -0.157; TCGA PRAD -0.168; TCGA THCA -0.072; TCGA STAD -0.225
hsa-miR-148a-5p
ABI2
9 cancers: BRCA; COAD; KIRC; LIHC; LUSC; PAAD; SARC; THCA; STAD
miRNATAP
TCGA BRCA -0.091; TCGA COAD -0.122; TCGA KIRC -0.168; TCGA LIHC -0.244; TCGA LUSC -0.061; TCGA PAAD -0.076; TCGA SARC -0.1; TCGA THCA -0.097; TCGA STAD -0.233
hsa-miR-148a-5p
BICD1
9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; THCA; STAD
mirMAP
TCGA CESC -0.114; TCGA COAD -0.291; TCGA ESCA -0.196; TCGA HNSC -0.108; TCGA KIRC -0.123; TCGA LIHC -0.4; TCGA PAAD -0.229; TCGA THCA -0.171; TCGA STAD -0.136
hsa-miR-148a-5p
CSNK1E
10 cancers: CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA CESC -0.089; TCGA ESCA -0.06; TCGA HNSC -0.116; TCGA KIRP -0.113; TCGA LIHC -0.245; TCGA LUAD -0.09; TCGA LUSC -0.059; TCGA PAAD -0.122; TCGA THCA -0.127; TCGA STAD -0.096
hsa-miR-148a-5p
AGPAT4
9 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; STAD
mirMAP
TCGA COAD -0.213; TCGA ESCA -0.17; TCGA HNSC -0.304; TCGA KIRC -0.214; TCGA KIRP -0.183; TCGA LIHC -0.254; TCGA PAAD -0.203; TCGA PRAD -0.438; TCGA STAD -0.286
hsa-miR-148a-5p
ABL2
9 cancers: COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; STAD
miRNATAP
TCGA COAD -0.15; TCGA ESCA -0.191; TCGA HNSC -0.109; TCGA KIRC -0.077; TCGA LIHC -0.078; TCGA LUAD -0.075; TCGA LUSC -0.076; TCGA THCA -0.093; TCGA STAD -0.081
hsa-miR-148a-5p
CNIH4
9 cancers: ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA ESCA -0.137; TCGA HNSC -0.115; TCGA LIHC -0.107; TCGA LUSC -0.106; TCGA PAAD -0.082; TCGA PRAD -0.064; TCGA SARC -0.054; TCGA THCA -0.098; TCGA STAD -0.096





Enriched cancer pathways of putative targets