microRNA information: hsa-miR-151a-5p

SectionIDlink
Mature name: hsa-miR-151a-5pmiRbase
Accession: MIMAT0004697miRbase
Precursor name: hsa-mir-151a miRbase
Precursor accession: MI0000809miRbase
Symbol: NAHGNC
RefSeq ID: NAGenBank
Sequence: UCGAGGAGCUCACAGUCUAGU



Reported expression in cancers: hsa-miR-151a-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-151a-5p

prostate cancerupregulation"In this study we investigated whether genistein co ......"22928040



Reported cancer pathway affected by hsa-miR-151a-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-151a-5p

NANA"NA ......"NANA
hsa-miR-151a-5p

" ......"



Reported cancer prognosis affected by hsa-miR-151a-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-151a-5p

breast cancermetastasis"The clinico pathologic role of microRNAs miR 9 and ......"22489664
hsa-miR-151a-5p

gastric cancerprogression"This study identified an intronic microRNA-151 miR ......"27191259Colony formation
hsa-miR-151a-5p

kidney renal cell cancermetastasis; malignant trasformation"To obtain accurate results in miRNA expression cha ......"21741950
hsa-miR-151a-5p

liver cancermetastasis; motility"MiR-151 is aberrantly overexpressed in HCC cells a ......"25023326
hsa-miR-151a-5p

pancreatic cancermetastasis; drug resistance"We report a case of notably increased plasma level ......"23205084
hsa-miR-151a-5p

prostate cancermetastasis; progression; cell migration; poor survival"However the effects of genistein on the regulation ......"22928040Luciferase



Reported gene related to hsa-miR-151a-5p

miRNAcancergenereportingPUBMED
hsa-miR-151a-5p

gastric cancerNOTCH1"This study identified an intronic microRNA-151 miR ......"27191259
hsa-miR-151a-5p

gastric cancerPTK2"Activation of Notch1 pathway enhanced expressions ......"27191259
hsa-miR-151a-5p

breast cancerSMARCA5"miR 151 5p targeting chromatin remodeler SMARCA5 a ......"27385001



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-151a-5p
FAM160B1
10 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.084; TCGA COAD -0.09; TCGA ESCA -0.105; TCGA KIRP -0.1; TCGA LGG -0.063; TCGA LIHC -0.122; TCGA LUAD -0.133; TCGA LUSC -0.129; TCGA STAD -0.154; TCGA UCEC -0.211
hsa-miR-151a-5p
MPL
11 cancers: BLCA; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.323; TCGA ESCA -0.274; TCGA HNSC -0.121; TCGA LIHC -0.178; TCGA LUAD -0.197; TCGA LUSC -0.124; TCGA OV -0.193; TCGA PRAD -0.407; TCGA SARC -0.908; TCGA STAD -0.452; TCGA UCEC -0.287
hsa-miR-151a-5p
N4BP1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.069; TCGA CESC -0.267; TCGA COAD -0.09; TCGA ESCA -0.196; TCGA HNSC -0.165; TCGA LIHC -0.104; TCGA LUAD -0.175; TCGA LUSC -0.246; TCGA PRAD -0.081; TCGA THCA -0.061; TCGA STAD -0.12; TCGA UCEC -0.148
hsa-miR-151a-5p
PELI2
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.517; TCGA BRCA -0.507; TCGA COAD -0.237; TCGA KIRC -0.317; TCGA KIRP -0.228; TCGA LGG -0.234; TCGA LIHC -0.716; TCGA PAAD -0.415; TCGA PRAD -0.307; TCGA SARC -0.397; TCGA THCA -0.243; TCGA STAD -0.215
hsa-miR-151a-5p
SPIRE1
9 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; SARC; STAD
miRNAWalker2 validate
TCGA BLCA -0.189; TCGA COAD -0.266; TCGA ESCA -0.419; TCGA KIRP -0.33; TCGA LGG -0.168; TCGA LIHC -0.605; TCGA LUAD -0.12; TCGA SARC -0.142; TCGA STAD -0.43
hsa-miR-151a-5p
TGFB3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.826; TCGA BRCA -0.46; TCGA CESC -0.501; TCGA COAD -0.809; TCGA ESCA -0.661; TCGA KIRP -0.248; TCGA LIHC -0.494; TCGA LUAD -0.161; TCGA LUSC -0.315; TCGA PAAD -0.977; TCGA PRAD -0.503; TCGA THCA -0.484; TCGA STAD -0.429; TCGA UCEC -0.427
hsa-miR-151a-5p
SIGLEC1
10 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.573; TCGA CESC -0.774; TCGA COAD -0.724; TCGA ESCA -0.447; TCGA LIHC -0.343; TCGA LUAD -0.235; TCGA LUSC -0.942; TCGA PAAD -0.92; TCGA THCA -0.42; TCGA STAD -0.183
hsa-miR-151a-5p
HAS1
11 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.061; TCGA BRCA -0.473; TCGA COAD -0.839; TCGA ESCA -1.041; TCGA LIHC -0.586; TCGA LUAD -0.413; TCGA LUSC -0.842; TCGA PAAD -1.15; TCGA THCA -1.68; TCGA STAD -0.475; TCGA UCEC -0.57
hsa-miR-151a-5p
IQGAP1
10 cancers: BLCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.181; TCGA HNSC -0.223; TCGA KIRP -0.301; TCGA LIHC -0.488; TCGA LUAD -0.246; TCGA LUSC -0.1; TCGA PRAD -0.282; TCGA SARC -0.228; TCGA THCA -0.124; TCGA UCEC -0.142
hsa-miR-151a-5p
PPP1R3B
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.305; TCGA BRCA -0.333; TCGA ESCA -0.372; TCGA HNSC -0.297; TCGA KIRP -0.397; TCGA LIHC -0.661; TCGA PRAD -0.346; TCGA SARC -0.895; TCGA UCEC -0.409
hsa-miR-151a-5p
PDZD4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.679; TCGA BRCA -0.548; TCGA CESC -0.515; TCGA COAD -0.925; TCGA ESCA -1.172; TCGA KIRP -0.637; TCGA LGG -0.152; TCGA LIHC -0.508; TCGA LUSC -0.492; TCGA SARC -0.593; TCGA THCA -0.317; TCGA STAD -1.303; TCGA UCEC -0.796
hsa-miR-151a-5p
GAS7
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.906; TCGA BRCA -0.443; TCGA CESC -0.858; TCGA COAD -0.703; TCGA ESCA -1.037; TCGA HNSC -0.805; TCGA LIHC -0.293; TCGA LUAD -0.423; TCGA LUSC -0.979; TCGA PAAD -0.711; TCGA PRAD -0.543; TCGA THCA -0.521; TCGA STAD -0.663; TCGA UCEC -0.415
hsa-miR-151a-5p
NFIX
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.56; TCGA BRCA -0.101; TCGA COAD -0.088; TCGA ESCA -0.298; TCGA HNSC -0.419; TCGA KIRP -0.44; TCGA LGG -0.214; TCGA LIHC -0.155; TCGA LUAD -0.341; TCGA LUSC -0.316; TCGA PAAD -0.543; TCGA SARC -0.158; TCGA STAD -0.336; TCGA UCEC -0.188
hsa-miR-151a-5p
CDON
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.581; TCGA BRCA -0.215; TCGA COAD -0.323; TCGA ESCA -0.343; TCGA HNSC -0.167; TCGA LGG -0.339; TCGA OV -0.227; TCGA PAAD -0.349; TCGA STAD -0.754; TCGA UCEC -0.319
hsa-miR-151a-5p
CBX6
9 cancers: BLCA; BRCA; COAD; KIRP; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.241; TCGA BRCA -0.23; TCGA COAD -0.416; TCGA KIRP -0.247; TCGA OV -0.159; TCGA PRAD -0.457; TCGA SARC -0.286; TCGA STAD -0.526; TCGA UCEC -0.227
hsa-miR-151a-5p
PIP5K1C
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.12; TCGA BRCA -0.084; TCGA CESC -0.092; TCGA COAD -0.234; TCGA ESCA -0.321; TCGA KIRP -0.096; TCGA LIHC -0.105; TCGA PRAD -0.132; TCGA SARC -0.164; TCGA STAD -0.312; TCGA UCEC -0.136
hsa-miR-151a-5p
MFRP
9 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUAD; LUSC; PAAD; UCEC
mirMAP
TCGA BLCA -0.366; TCGA BRCA -0.359; TCGA COAD -0.522; TCGA LGG -0.271; TCGA LIHC -0.202; TCGA LUAD -0.148; TCGA LUSC -0.648; TCGA PAAD -0.71; TCGA UCEC -0.302
hsa-miR-151a-5p
NTRK2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.871; TCGA BRCA -0.781; TCGA CESC -0.711; TCGA COAD -0.798; TCGA HNSC -0.353; TCGA LIHC -1.333; TCGA LUAD -0.404; TCGA PRAD -0.934; TCGA SARC -0.778; TCGA STAD -0.765; TCGA UCEC -0.641
hsa-miR-151a-5p
NOS1
11 cancers: COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.965; TCGA ESCA -0.997; TCGA HNSC -0.99; TCGA KIRC -0.732; TCGA LUAD -0.792; TCGA OV -0.729; TCGA PAAD -1.057; TCGA PRAD -1.502; TCGA THCA -0.417; TCGA STAD -1.747; TCGA UCEC -0.435





Enriched cancer pathways of putative targets