microRNA information: hsa-miR-152-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-152-3p | miRbase |
Accession: | MIMAT0000438 | miRbase |
Precursor name: | hsa-mir-152 | miRbase |
Precursor accession: | MI0000462 | miRbase |
Symbol: | MIR152 | HGNC |
RefSeq ID: | NR_029687 | GenBank |
Sequence: | UCAGUGCAUGACAGAACUUGG |
Reported expression in cancers: hsa-miR-152-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-152-3p | cervical and endocervical cancer | upregulation | "MiR-152 was upregulated to the greatest extent and ......" | 26515145 | |
hsa-miR-152-3p | colorectal cancer | downregulation | "Accumulating evidence showed that microRNA-152 miR ......" | 26820128 | |
hsa-miR-152-3p | gastric cancer | downregulation | "Our previous studies have revealed that miR-148a a ......" | 21205300 | |
hsa-miR-152-3p | gastric cancer | downregulation | "Our results showed decreased expression of miR-152 ......" | 25119599 | |
hsa-miR-152-3p | glioblastoma | downregulation | "Our results proved that miR-152 was down-regulated ......" | 25218589 | |
hsa-miR-152-3p | liver cancer | downregulation | "miR-152 expression was detected using real-time qu ......" | 24998573 | qPCR |
hsa-miR-152-3p | lung squamous cell cancer | downregulation | "Serum miR 152 miR 148a miR 148b and miR 21 as nove ......" | 25501703 | qPCR |
hsa-miR-152-3p | lung squamous cell cancer | downregulation | "Decreased plasma let 7c and miR 152 as noninvasive ......" | 26309587 | Reverse transcription PCR |
hsa-miR-152-3p | thyroid cancer | downregulation | "We found that miR-146-5p miR-221-5p miR-222-3p miR ......" | 27586203 |
Reported cancer pathway affected by hsa-miR-152-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-152-3p | colorectal cancer | Apoptosis pathway | "miR 152 functions as a tumor suppressor in colorec ......" | 26820128 | |
hsa-miR-152-3p | glioblastoma | Apoptosis pathway | "MiR 152 functions as a tumor suppressor in gliobla ......" | 25218589 | |
hsa-miR-152-3p | liver cancer | Apoptosis pathway | "Effects of miR 152 on cell growth inhibition motil ......" | 24998573 | Western blot |
hsa-miR-152-3p | ovarian cancer | Apoptosis pathway | "MiR 152 and miR 185 co contribute to ovarian cance ......" | 23318422 |
Reported cancer prognosis affected by hsa-miR-152-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-152-3p | bladder cancer | malignant trasformation | "Analyses in human urothelial cells identify methyl ......" | 23867826 | |
hsa-miR-152-3p | bladder cancer | poor survival; recurrence | "We performed genome-wide serum miRNA analysis by M ......" | 24961907 | |
hsa-miR-152-3p | breast cancer | tumorigenesis | "Microarray technology was used to evaluate miRNA p ......" | 25393370 | |
hsa-miR-152-3p | breast cancer | metastasis | "DNA methylation and not H3K4 trimethylation dictat ......" | 27475839 | |
hsa-miR-152-3p | cervical and endocervical cancer | drug resistance | "Hypoxia inducible miR 152 suppresses the expressio ......" | 26515145 | Western blot; Luciferase |
hsa-miR-152-3p | colorectal cancer | staging; metastasis; cell migration; progression | "miR 152 functions as a tumor suppressor in colorec ......" | 26820128 | |
hsa-miR-152-3p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
hsa-miR-152-3p | endometrial cancer | tumorigenesis | "miR 152 is a tumor suppressor microRNA that is sil ......" | 21868754 | Cell proliferation assay; Cell Proliferation Assay |
hsa-miR-152-3p | esophageal cancer | drug resistance | "Differentially expressed miRNAs between ESCC patho ......" | 26445467 | |
hsa-miR-152-3p | gastric cancer | motility | "miR 152 suppresses gastric cancer cell proliferati ......" | 25119599 | |
hsa-miR-152-3p | glioblastoma | cell migration; poor survival; progression | "MiR 152 functions as a tumor suppressor in gliobla ......" | 25218589 | |
hsa-miR-152-3p | liver cancer | motility; malignant trasformation; staging; tumor size; progression; tumorigenesis; worse prognosis | "Effects of miR 152 on cell growth inhibition motil ......" | 24998573 | Western blot |
hsa-miR-152-3p | lung squamous cell cancer | staging; metastasis; differentiation | "Decreased plasma let 7c and miR 152 as noninvasive ......" | 26309587 | |
hsa-miR-152-3p | lung squamous cell cancer | metastasis | "MiR 152 regulates metastases of non small cell lun ......" | 26823738 | Luciferase |
hsa-miR-152-3p | lung squamous cell cancer | staging | "The aim of this study was to determine whether cir ......" | 27461630 | |
hsa-miR-152-3p | ovarian cancer | poor survival; drug resistance; tumorigenesis | "Altered expression of miR 152 and miR 148a in ovar ......" | 21971665 | Cell proliferation assay; Cell Proliferation Assay |
hsa-miR-152-3p | ovarian cancer | motility | "Regulation of colony stimulating factor 1 expressi ......" | 22909061 | |
hsa-miR-152-3p | ovarian cancer | drug resistance | "MiR 152 and miR 185 co contribute to ovarian cance ......" | 23318422 | |
hsa-miR-152-3p | ovarian cancer | drug resistance | "Hybridization was carried out on miRNA microarray ......" | 24805828 | |
hsa-miR-152-3p | prostate cancer | malignant trasformation; cell migration; staging | "miR 152 controls migration and invasive potential ......" | 23460133 | Western blot; Luciferase |
hsa-miR-152-3p | prostate cancer | metastasis; poor survival; recurrence | "MicroRNA profiling of novel African American and C ......" | 25004396 | |
hsa-miR-152-3p | sarcoma | poor survival; worse prognosis | "Potential values of microRNA152 miR-152 as a serum ......" | 26464682 | |
hsa-miR-152-3p | thyroid cancer | malignant trasformation | "We found that miR-146-5p miR-221-5p miR-222-3p miR ......" | 27586203 |
Reported gene related to hsa-miR-152-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-152-3p | breast cancer | DNMT1 | "mRNA and protein expression profile of DNMT1 impli ......" | 27475839 |
hsa-miR-152-3p | endometrial cancer | DNMT1 | "Epigenetic silencing documented in miR-152 was con ......" | 21868754 |
hsa-miR-152-3p | liver cancer | DNMT1 | "Our results showed that the expression of microRNA ......" | 20578129 |
hsa-miR-152-3p | liver cancer | DNMT1 | "Furthermore Western blotting showed that the miR-1 ......" | 24998573 |
hsa-miR-152-3p | ovarian cancer | DNMT1 | "MiR 152 and miR 185 co contribute to ovarian cance ......" | 23318422 |
hsa-miR-152-3p | prostate cancer | DNMT1 | "There appeared to be a reciprocal regulatory relat ......" | 25004396 |
hsa-miR-152-3p | gastric cancer | HLA-G | "Long non coding RNA HOTAIR promotes HLA G expressi ......" | 26187665 |
hsa-miR-152-3p | gastric cancer | HLA-G | "TGF β induces HLA G expression through inhibiting ......" | 26627200 |
hsa-miR-152-3p | colorectal cancer | CASP3 | "Function assays demonstrated that restoring the ex ......" | 26820128 |
hsa-miR-152-3p | gastric cancer | CD151 | "miR 152 suppresses gastric cancer cell proliferati ......" | 25119599 |
hsa-miR-152-3p | prostate cancer | CDC37 | "Predicted interaction between miR-152 and mRNAERBB ......" | 23958847 |
hsa-miR-152-3p | breast cancer | CDH1 | "In this investigation we attempt to elucidate the ......" | 27475839 |
hsa-miR-152-3p | endometrial cancer | COPZ2 | "Epigenetic silencing documented in miR-152 was con ......" | 21868754 |
hsa-miR-152-3p | ovarian cancer | CSF1 | "By mutations in putative miRNA targets in CSF-1 mR ......" | 22909061 |
hsa-miR-152-3p | ovarian cancer | CSF2 | "Regulation of colony stimulating factor 1 expressi ......" | 22909061 |
hsa-miR-152-3p | endometrial cancer | E2F3 | "We identified E2F3 MET and Rictor as novel candida ......" | 21868754 |
hsa-miR-152-3p | cervical and endocervical cancer | ERBB3 | "Hypoxia inducible miR 152 suppresses the expressio ......" | 26515145 |
hsa-miR-152-3p | gastric cancer | HOTAIR | "Long non coding RNA HOTAIR promotes HLA G expressi ......" | 26187665 |
hsa-miR-152-3p | glioblastoma | KLF4 | "Mechanistic investigations defined Krüppel-like f ......" | 25218589 |
hsa-miR-152-3p | lung squamous cell cancer | NRP1 | "MiR 152 regulates metastases of non small cell lun ......" | 26823738 |
hsa-miR-152-3p | colorectal cancer | PIK3R1 | "Mechanistic investigations defined phosphoinositid ......" | 26820128 |
hsa-miR-152-3p | colorectal cancer | PIK3R3 | "miR 152 functions as a tumor suppressor in colorec ......" | 26820128 |
hsa-miR-152-3p | breast cancer | RASSF1 | "Male miR-152 and miR-497 upregulation and RASSF1A ......" | 25393370 |
hsa-miR-152-3p | breast cancer | RASSF5 | "Male miR-152 and miR-497 upregulation and RASSF1A ......" | 25393370 |
hsa-miR-152-3p | endometrial cancer | RICTOR | "We identified E2F3 MET and Rictor as novel candida ......" | 21868754 |
hsa-miR-152-3p | glioblastoma | SCPEP1 | "In addition XIST and miR-152 are probably in the s ......" | 25578780 |
hsa-miR-152-3p | liver cancer | TNFRSF6B | "miR-152 may act as a tumor suppressor miRNA by als ......" | 24998573 |
hsa-miR-152-3p | cervical and endocervical cancer | WNT1 | "Hypoxia inducible miR 152 suppresses the expressio ......" | 26515145 |
hsa-miR-152-3p | glioblastoma | XIST | "Knockdown of long non coding RNA XIST exerts tumor ......" | 25578780 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-152-3p | ECHS1 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; OV; PAAD; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.138; TCGA BRCA -0.06; TCGA CESC -0.133; TCGA ESCA -0.204; TCGA HNSC -0.136; TCGA OV -0.114; TCGA PAAD -0.19; TCGA PRAD -0.38; TCGA UCEC -0.134 |
hsa-miR-152-3p | SETDB1 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LIHC; LUAD; OV; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.084; TCGA BRCA -0.091; TCGA CESC -0.077; TCGA ESCA -0.112; TCGA KIRP -0.084; TCGA LGG -0.12; TCGA LIHC -0.087; TCGA LUAD -0.101; TCGA OV -0.091; TCGA STAD -0.082; TCGA UCEC -0.072 |
hsa-miR-152-3p | UCP3 | 12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.248; TCGA BRCA -0.122; TCGA CESC -0.191; TCGA ESCA -0.287; TCGA KIRC -0.159; TCGA KIRP -0.192; TCGA LGG -0.068; TCGA LIHC -0.222; TCGA LUAD -0.306; TCGA LUSC -0.254; TCGA PRAD -0.386; TCGA STAD -0.207 |
hsa-miR-152-3p | SKP1 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUSC; OV; PRAD; SARC | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.064; TCGA CESC -0.083; TCGA COAD -0.15; TCGA HNSC -0.114; TCGA LIHC -0.068; TCGA LUSC -0.058; TCGA OV -0.11; TCGA PRAD -0.099; TCGA SARC -0.099 |
hsa-miR-152-3p | MAGIX | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC | MirTarget | TCGA BLCA -0.487; TCGA BRCA -0.279; TCGA CESC -0.197; TCGA ESCA -0.661; TCGA HNSC -0.142; TCGA LGG -0.069; TCGA LUSC -0.217; TCGA PAAD -0.564; TCGA PRAD -0.568; TCGA SARC -0.202 |
hsa-miR-152-3p | NR2C2AP | 11 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; OV; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.118; TCGA BRCA -0.224; TCGA HNSC -0.193; TCGA KIRP -0.176; TCGA LGG -0.113; TCGA LIHC -0.185; TCGA OV -0.088; TCGA PAAD -0.132; TCGA PRAD -0.418; TCGA SARC -0.121; TCGA THCA -0.247 |
hsa-miR-152-3p | ABCD3 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.175; TCGA BRCA -0.152; TCGA CESC -0.136; TCGA COAD -0.209; TCGA ESCA -0.457; TCGA LUSC -0.184; TCGA SARC -0.064; TCGA STAD -0.333; TCGA UCEC -0.113 |
hsa-miR-152-3p | RIBC1 | 11 cancers: BLCA; BRCA; CESC; KIRP; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.165; TCGA BRCA -0.189; TCGA CESC -0.267; TCGA KIRP -0.104; TCGA LUSC -0.28; TCGA OV -0.145; TCGA PAAD -0.431; TCGA PRAD -0.358; TCGA SARC -0.191; TCGA STAD -0.159; TCGA UCEC -0.216 |
hsa-miR-152-3p | MAF1 | 9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.058; TCGA BRCA -0.121; TCGA CESC -0.056; TCGA HNSC -0.066; TCGA LIHC -0.174; TCGA PAAD -0.175; TCGA PRAD -0.289; TCGA SARC -0.073; TCGA THCA -0.069 |
hsa-miR-152-3p | NEURL4 | 12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD | MirTarget | TCGA BLCA -0.13; TCGA BRCA -0.17; TCGA CESC -0.106; TCGA HNSC -0.136; TCGA KIRC -0.211; TCGA KIRP -0.076; TCGA LGG -0.123; TCGA LIHC -0.103; TCGA LUAD -0.241; TCGA LUSC -0.091; TCGA PAAD -0.389; TCGA PRAD -0.212 |
hsa-miR-152-3p | PRR15 | 9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LIHC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.79; TCGA BRCA -0.416; TCGA CESC -0.552; TCGA ESCA -1.392; TCGA KIRP -0.253; TCGA LIHC -0.332; TCGA THCA -2.173; TCGA STAD -0.345; TCGA UCEC -0.355 |
hsa-miR-152-3p | MDM4 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.199; TCGA BRCA -0.126; TCGA CESC -0.131; TCGA ESCA -0.198; TCGA HNSC -0.091; TCGA KIRC -0.208; TCGA KIRP -0.24; TCGA LGG -0.097; TCGA LIHC -0.12; TCGA LUAD -0.249; TCGA LUSC -0.144; TCGA PAAD -0.171; TCGA PRAD -0.167; TCGA SARC -0.138; TCGA STAD -0.314 |
hsa-miR-152-3p | SIRT7 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA | MirTarget | TCGA BLCA -0.182; TCGA BRCA -0.245; TCGA COAD -0.17; TCGA ESCA -0.127; TCGA HNSC -0.229; TCGA KIRP -0.153; TCGA LGG -0.095; TCGA LIHC -0.162; TCGA LUAD -0.143; TCGA PAAD -0.273; TCGA PRAD -0.419; TCGA THCA -0.128 |
hsa-miR-152-3p | KLHL17 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.133; TCGA BRCA -0.298; TCGA CESC -0.106; TCGA HNSC -0.494; TCGA KIRP -0.262; TCGA LGG -0.148; TCGA LIHC -0.231; TCGA LUAD -0.303; TCGA LUSC -0.261; TCGA PAAD -0.539; TCGA PRAD -0.72; TCGA THCA -0.421; TCGA STAD -0.246 |
hsa-miR-152-3p | NPEPL1 | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC | MirTarget | TCGA BLCA -0.209; TCGA BRCA -0.24; TCGA CESC -0.081; TCGA HNSC -0.174; TCGA LGG -0.109; TCGA LIHC -0.153; TCGA LUAD -0.271; TCGA PAAD -0.311; TCGA PRAD -0.518; TCGA SARC -0.113 |
hsa-miR-152-3p | CLCN6 | 9 cancers: BLCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; SARC | MirTarget | TCGA BLCA -0.093; TCGA CESC -0.1; TCGA ESCA -0.205; TCGA KIRC -0.272; TCGA LIHC -0.098; TCGA LUAD -0.264; TCGA LUSC -0.307; TCGA PRAD -0.065; TCGA SARC -0.128 |
hsa-miR-152-3p | PRKCZ | 12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.19; TCGA BRCA -0.228; TCGA ESCA -0.187; TCGA HNSC -0.148; TCGA KIRC -0.17; TCGA LUAD -0.168; TCGA LUSC -0.266; TCGA OV -0.092; TCGA PAAD -0.434; TCGA PRAD -0.32; TCGA STAD -0.16; TCGA UCEC -0.171 |
hsa-miR-152-3p | ORMDL1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.08; TCGA BRCA -0.082; TCGA CESC -0.058; TCGA COAD -0.142; TCGA ESCA -0.12; TCGA HNSC -0.129; TCGA KIRP -0.15; TCGA LGG -0.067; TCGA LIHC -0.099; TCGA LUAD -0.104; TCGA PAAD -0.133; TCGA PRAD -0.253; TCGA THCA -0.089; TCGA STAD -0.239 |
hsa-miR-152-3p | NCKIPSD | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.11; TCGA BRCA -0.079; TCGA CESC -0.143; TCGA COAD -0.136; TCGA ESCA -0.176; TCGA HNSC -0.083; TCGA LUAD -0.105; TCGA PAAD -0.231; TCGA PRAD -0.058; TCGA SARC -0.269; TCGA THCA -0.172 |
hsa-miR-152-3p | PPP1R9A | 11 cancers: BLCA; CESC; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.746; TCGA CESC -1.25; TCGA ESCA -1.064; TCGA LGG -0.077; TCGA LIHC -0.197; TCGA LUAD -0.194; TCGA LUSC -0.827; TCGA PAAD -0.35; TCGA PRAD -0.161; TCGA THCA -0.171; TCGA UCEC -0.17 |
hsa-miR-152-3p | USP48 | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUSC; SARC; STAD | MirTarget | TCGA BLCA -0.062; TCGA CESC -0.061; TCGA ESCA -0.129; TCGA HNSC -0.078; TCGA KIRC -0.101; TCGA LIHC -0.054; TCGA LUSC -0.122; TCGA SARC -0.054; TCGA STAD -0.148 |
hsa-miR-152-3p | NLK | 9 cancers: BLCA; BRCA; CESC; ESCA; LUAD; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.132; TCGA BRCA -0.122; TCGA CESC -0.1; TCGA ESCA -0.24; TCGA LUAD -0.058; TCGA PAAD -0.244; TCGA PRAD -0.094; TCGA STAD -0.127; TCGA UCEC -0.094 |
hsa-miR-152-3p | ZDHHC23 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.214; TCGA BRCA -0.128; TCGA CESC -0.125; TCGA COAD -0.214; TCGA ESCA -0.53; TCGA KIRC -0.231; TCGA LUAD -0.256; TCGA LUSC -0.133; TCGA PAAD -0.192; TCGA PRAD -0.202; TCGA SARC -0.643; TCGA STAD -0.422; TCGA UCEC -0.149 |
hsa-miR-152-3p | MAGI1 | 9 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.354; TCGA CESC -0.316; TCGA ESCA -0.569; TCGA KIRC -0.356; TCGA LGG -0.075; TCGA LUAD -0.124; TCGA SARC -0.29; TCGA STAD -0.341; TCGA UCEC -0.136 |
hsa-miR-152-3p | ZNF3 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; UCEC | MirTarget | TCGA BLCA -0.141; TCGA BRCA -0.128; TCGA COAD -0.134; TCGA ESCA -0.128; TCGA KIRC -0.08; TCGA KIRP -0.091; TCGA LGG -0.07; TCGA LIHC -0.07; TCGA OV -0.079; TCGA PAAD -0.128; TCGA PRAD -0.279; TCGA UCEC -0.08 |
hsa-miR-152-3p | DMPK | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC | MirTarget | TCGA BLCA -0.172; TCGA BRCA -0.163; TCGA CESC -0.105; TCGA HNSC -0.131; TCGA KIRP -0.185; TCGA LIHC -0.102; TCGA LUAD -0.239; TCGA LUSC -0.314; TCGA PAAD -0.394; TCGA SARC -0.4 |
hsa-miR-152-3p | PNPLA6 | 11 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.127; TCGA BRCA -0.157; TCGA CESC -0.076; TCGA HNSC -0.091; TCGA LIHC -0.101; TCGA LUAD -0.156; TCGA LUSC -0.159; TCGA PAAD -0.292; TCGA PRAD -0.195; TCGA SARC -0.2; TCGA THCA -0.222 |
hsa-miR-152-3p | ZNF784 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA | MirTarget | TCGA BLCA -0.217; TCGA BRCA -0.148; TCGA ESCA -0.117; TCGA HNSC -0.191; TCGA KIRP -0.116; TCGA LUAD -0.138; TCGA LUSC -0.105; TCGA PAAD -0.421; TCGA PRAD -0.426; TCGA THCA -0.128 |
hsa-miR-152-3p | DENND4C | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; SARC; STAD | MirTarget | TCGA BLCA -0.115; TCGA CESC -0.101; TCGA COAD -0.148; TCGA ESCA -0.319; TCGA KIRC -0.154; TCGA LUAD -0.063; TCGA LUSC -0.206; TCGA SARC -0.13; TCGA STAD -0.273 |
hsa-miR-152-3p | DGCR8 | 10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC | RAID | TCGA BLCA -0.127; TCGA BRCA -0.077; TCGA KIRC -0.11; TCGA KIRP -0.118; TCGA LGG -0.082; TCGA LIHC -0.07; TCGA LUAD -0.128; TCGA PAAD -0.206; TCGA PRAD -0.154; TCGA SARC -0.076 |
hsa-miR-152-3p | SNRPD1 | 10 cancers: BRCA; COAD; HNSC; KIRP; LGG; LIHC; OV; PRAD; THCA; STAD | MirTarget | TCGA BRCA -0.115; TCGA COAD -0.148; TCGA HNSC -0.281; TCGA KIRP -0.107; TCGA LGG -0.123; TCGA LIHC -0.177; TCGA OV -0.17; TCGA PRAD -0.347; TCGA THCA -0.115; TCGA STAD -0.236 |
hsa-miR-152-3p | CHD1 | 9 cancers: CESC; COAD; ESCA; KIRC; LGG; LUSC; SARC; THCA; STAD | MirTarget | TCGA CESC -0.071; TCGA COAD -0.17; TCGA ESCA -0.132; TCGA KIRC -0.135; TCGA LGG -0.055; TCGA LUSC -0.092; TCGA SARC -0.059; TCGA THCA -0.059; TCGA STAD -0.252 |
hsa-miR-152-3p | ATP8A1 | 9 cancers: CESC; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA CESC -0.35; TCGA ESCA -1.242; TCGA KIRC -0.221; TCGA LUAD -0.381; TCGA LUSC -0.54; TCGA PRAD -0.2; TCGA SARC -0.263; TCGA STAD -0.451; TCGA UCEC -0.148 |
hsa-miR-152-3p | GPCPD1 | 9 cancers: HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA HNSC -0.086; TCGA KIRC -0.131; TCGA KIRP -0.101; TCGA LUAD -0.157; TCGA LUSC -0.163; TCGA SARC -0.081; TCGA THCA -0.172; TCGA STAD -0.229; TCGA UCEC -0.206 |
Enriched cancer pathways of putative targets