microRNA information: hsa-miR-153-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-153-3p | miRbase |
| Accession: | MIMAT0000439 | miRbase |
| Precursor name: | hsa-mir-153-1 | miRbase |
| Precursor accession: | MI0000463 | miRbase |
| Symbol: | MIR153-1 | HGNC |
| RefSeq ID: | NR_029688 | GenBank |
| Sequence: | UUGCAUAGUCACAAAAGUGAUC |
Reported expression in cancers: hsa-miR-153-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-153-3p | colorectal cancer | upregulation | "miR 153 supports colorectal cancer progression via ......" | 23950211 | |
| hsa-miR-153-3p | esophageal cancer | downregulation | "Our study showed that the expression of miR-153 wa ......" | 27739030 | |
| hsa-miR-153-3p | gastric cancer | downregulation | "MicroRNA miRNA-153 miR-153 has been considered as ......" | 25678802 | |
| hsa-miR-153-3p | gastric cancer | upregulation | "Recently miR-153 was reported as a tumor suppresso ......" | 26232914 | |
| hsa-miR-153-3p | glioblastoma | upregulation | "Specifically miR-181b miR-153 miR-145 miR-137 and ......" | 22722712 | |
| hsa-miR-153-3p | glioblastoma | downregulation | "MiR 153 as a Tumor Suppressor in Glioblastoma Mult ......" | 27215075 | qPCR |
| hsa-miR-153-3p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-153-3p | liver cancer | downregulation | "Our study showed that the expression of miR-153 wa ......" | 26035427 | |
| hsa-miR-153-3p | lung cancer | upregulation | "Suppression of AKT expression by miR 153 produced ......" | 25066607 | |
| hsa-miR-153-3p | lung squamous cell cancer | downregulation | "MiR-153 was reported to be dysregulated in some hu ......" | 25475731 | qPCR |
| hsa-miR-153-3p | lung squamous cell cancer | downregulation | "miR-153 has been found to be significantly decreas ......" | 26339455 | qPCR |
| hsa-miR-153-3p | ovarian cancer | upregulation | "Furthermore we demonstrate that the high expressio ......" | 25954928 | |
| hsa-miR-153-3p | prostate cancer | upregulation | "The present study was aimed at clarifying the biol ......" | 23060044 | qPCR |
| hsa-miR-153-3p | prostate cancer | downregulation | "Among them 10 paired HGPIN and PCa were prepared t ......" | 27017949 | qPCR; Microarray |
Reported cancer pathway affected by hsa-miR-153-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-153-3p | B cell lymphoma | Apoptosis pathway | "MicroRNA-153 miR-153 is a brain-specific miRNA tha ......" | 19676043 | Western blot; Luciferase |
| hsa-miR-153-3p | breast cancer | Apoptosis pathway | "miR 153 silencing induces apoptosis in the MDA MB ......" | 23803066 | Flow cytometry |
| hsa-miR-153-3p | breast cancer | Epithelial mesenchymal transition pathway | "MiR 153 inhibits epithelial mesenchymal transition ......" | 25794773 | Luciferase |
| hsa-miR-153-3p | breast cancer | Apoptosis pathway | "MiR 153 promotes breast cancer cell apoptosis by t ......" | 27508098 | Luciferase |
| hsa-miR-153-3p | gastric cancer | Epithelial mesenchymal transition pathway | "MicroRNA miRNA-153 miR-153 has been considered as ......" | 25678802 | |
| hsa-miR-153-3p | glioblastoma | Apoptosis pathway | "Previously we established that microRNA-153 miR-15 ......" | 21213215 | |
| hsa-miR-153-3p | glioblastoma | Apoptosis pathway | "Here we investigated the critical role of miR-153 ......" | 23397238 | |
| hsa-miR-153-3p | liver cancer | cell cycle pathway | "Here we performed a MicroRNA-based genetic screen ......" | 25708809 | Colony formation |
| hsa-miR-153-3p | lung cancer | Apoptosis pathway | "Suppression of AKT expression by miR 153 produced ......" | 25066607 | Luciferase |
| hsa-miR-153-3p | prostate cancer | cell cycle pathway; PI3K/Akt signaling pathway | "Upregulation of miR 153 promotes cell proliferatio ......" | 23060044 | Colony formation; Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-153-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-153-3p | breast cancer | cell migration | "MiR 153 inhibits epithelial mesenchymal transition ......" | 25794773 | Luciferase |
| hsa-miR-153-3p | breast cancer | poor survival | "MiR 153 promotes breast cancer cell apoptosis by t ......" | 27508098 | Luciferase |
| hsa-miR-153-3p | colorectal cancer | progression; drug resistance; staging | "miR 153 supports colorectal cancer progression via ......" | 23950211 | |
| hsa-miR-153-3p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
| hsa-miR-153-3p | esophageal cancer | metastasis; progression | "Recently miR-153 has been shown to regulate SNAI1 ......" | 27739030 | |
| hsa-miR-153-3p | gastric cancer | poor survival; cell migration | "MicroRNA miRNA-153 miR-153 has been considered as ......" | 25678802 | |
| hsa-miR-153-3p | gastric cancer | metastasis; cell migration | "MiR 153 regulates metastases of gastric cancer thr ......" | 26232914 | Luciferase; Cell migration assay; Wound Healing Assay |
| hsa-miR-153-3p | glioblastoma | poor survival | "Previously we established that microRNA-153 miR-15 ......" | 21213215 | |
| hsa-miR-153-3p | glioblastoma | differentiation | "Here we investigated the critical role of miR-153 ......" | 23397238 | |
| hsa-miR-153-3p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-153-3p | head and neck cancer | progression | "Several miRNAs miRLet-7A miR-1 miR-206 miR-153 miR ......" | 26239836 | |
| hsa-miR-153-3p | liver cancer | progression; tumorigenesis | "Here we performed a MicroRNA-based genetic screen ......" | 25708809 | Colony formation |
| hsa-miR-153-3p | liver cancer | progression | "miR 153 inhibits epithelial to mesenchymal transit ......" | 26035427 | |
| hsa-miR-153-3p | lung squamous cell cancer | progression | "MiR 153 inhibits migration and invasion of human n ......" | 25475731 | Luciferase |
| hsa-miR-153-3p | lung squamous cell cancer | staging; metastasis; poor survival | "miR-153 has been found to be significantly decreas ......" | 26339455 | |
| hsa-miR-153-3p | ovarian cancer | poor survival | "Furthermore we demonstrate that the high expressio ......" | 25954928 | Transwell assay; Wound Healing Assay |
Reported gene related to hsa-miR-153-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-153-3p | esophageal cancer | SNAI1 | "Recently miR-153 has been shown to regulate SNAI1 ......" | 27739030 |
| hsa-miR-153-3p | gastric cancer | SNAI1 | "MiR 153 regulates metastases of gastric cancer thr ......" | 26232914 |
| hsa-miR-153-3p | gastric cancer | SNAI1 | "An inverse correlation between miR-153 and SNAI1 e ......" | 25678802 |
| hsa-miR-153-3p | liver cancer | SNAI1 | "miR 153 inhibits epithelial to mesenchymal transit ......" | 26035427 |
| hsa-miR-153-3p | B cell lymphoma | BCL2 | "Bioinformatics analysis revealed that anti-apoptos ......" | 19676043 |
| hsa-miR-153-3p | glioblastoma | BCL2 | "Previously we established that microRNA-153 miR-15 ......" | 21213215 |
| hsa-miR-153-3p | B cell lymphoma | MCL1 | "Bioinformatics analysis revealed that anti-apoptos ......" | 19676043 |
| hsa-miR-153-3p | glioblastoma | MCL1 | "Previously we established that microRNA-153 miR-15 ......" | 21213215 |
| hsa-miR-153-3p | lung squamous cell cancer | ADAM19 | "MiR 153 inhibits migration and invasion of human n ......" | 25475731 |
| hsa-miR-153-3p | lung cancer | AKT1 | "Luciferase assay showed that transfection of miR-1 ......" | 25066607 |
| hsa-miR-153-3p | breast cancer | CDH1 | "Overexpression of miR-153 simultaneously increased ......" | 25794773 |
| hsa-miR-153-3p | prostate cancer | FOXO1 | "Luciferase assays were used to determined the FOXO ......" | 23060044 |
| hsa-miR-153-3p | colorectal cancer | FOXO3 | "Mechanistic investigations indicated that miR-153 ......" | 23950211 |
| hsa-miR-153-3p | sarcoma | GABRB2 | "Our results further revealed that transforming gro ......" | 25793604 |
| hsa-miR-153-3p | breast cancer | HECTD3 | "MiR 153 promotes breast cancer cell apoptosis by t ......" | 27508098 |
| hsa-miR-153-3p | breast cancer | MTDH | "MiR 153 inhibits epithelial mesenchymal transition ......" | 25794773 |
| hsa-miR-153-3p | glioblastoma | PROM1 | "Then qRT-PCR analysis showed that miR-153 expressi ......" | 23397238 |
| hsa-miR-153-3p | prostate cancer | PTEN | "Upregulation of miR 153 promotes cell proliferatio ......" | 23060044 |
| hsa-miR-153-3p | B cell lymphoma | TUBA1A | "MicroRNA-153 miR-153 is a brain-specific miRNA tha ......" | 19676043 |
| hsa-miR-153-3p | breast cancer | VIM | "Overexpression of miR-153 simultaneously increased ......" | 25794773 |
| hsa-miR-153-3p | liver cancer | WWOX | "At the molecular level we found that miR-153 inhib ......" | 25708809 |
| hsa-miR-153-3p | ovarian cancer | ZEB2 | "In the present study we report that miR-153 are ne ......" | 25954928 |
Expression profile in cancer corhorts:
