microRNA information: hsa-miR-154-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-154-3p | miRbase |
Accession: | MIMAT0000453 | miRbase |
Precursor name: | hsa-mir-154 | miRbase |
Precursor accession: | MI0000480 | miRbase |
Symbol: | MIR154 | HGNC |
RefSeq ID: | NR_029704 | GenBank |
Sequence: | AAUCAUACACGGUUGACCUAUU |
Reported expression in cancers: hsa-miR-154-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-154-3p | breast cancer | downregulation | "Accumulating evidence suggested that microRNA-154 ......" | 27398145 | qPCR |
hsa-miR-154-3p | colorectal cancer | downregulation | "Decreased miR 154 expression and its clinical sign ......" | 26048406 | qPCR |
hsa-miR-154-3p | lung squamous cell cancer | downregulation | "miR-154 has been proven to act as a tumor suppress ......" | 25846246 | qPCR |
hsa-miR-154-3p | lung squamous cell cancer | downregulation | "MicroRNA-154 miR-154 is dysregulated in some human ......" | 27173339 | Reverse transcription PCR |
hsa-miR-154-3p | prostate cancer | downregulation | "Research has shown reduced expression levels of mi ......" | 23428540 |
Reported cancer pathway affected by hsa-miR-154-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-154-3p | liver cancer | Apoptosis pathway | "miR 154 targeting ZEB2 in hepatocellular carcinoma ......" | 26503460 | Luciferase; Western blot |
hsa-miR-154-3p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "miR 154 suppresses non small cell lung cancer grow ......" | 25846246 | Colony formation |
hsa-miR-154-3p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 154 functions as a tumor suppressor and d ......" | 27173339 | Luciferase |
hsa-miR-154-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "miR 154 inhibits migration and invasion of human n ......" | 27347142 | |
hsa-miR-154-3p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 |
Reported cancer prognosis affected by hsa-miR-154-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-154-3p | breast cancer | progression; staging | "MicroRNA 154 inhibits growth and invasion of breas ......" | 27398145 | Wound Healing Assay; Western blot; Luciferase |
hsa-miR-154-3p | colorectal cancer | motility; progression | "miR 154 suppresses colorectal cancer cell growth a ......" | 24242044 | Colony formation |
hsa-miR-154-3p | colorectal cancer | worse prognosis; poor survival; staging; metastasis; tumor size; progression | "Decreased miR 154 expression and its clinical sign ......" | 26048406 | |
hsa-miR-154-3p | liver cancer | staging; metastasis; differentiation | "miR 154 targeting ZEB2 in hepatocellular carcinoma ......" | 26503460 | Luciferase; Western blot |
hsa-miR-154-3p | lung squamous cell cancer | tumorigenesis; staging; metastasis; tumor size | "miR 154 suppresses non small cell lung cancer grow ......" | 25846246 | Colony formation |
hsa-miR-154-3p | lung squamous cell cancer | progression; tumorigenesis; staging; metastasis; poor survival | "MicroRNA 154 functions as a tumor suppressor and d ......" | 27173339 | Luciferase |
hsa-miR-154-3p | lung squamous cell cancer | cell migration | "miR 154 inhibits migration and invasion of human n ......" | 27347142 | |
hsa-miR-154-3p | prostate cancer | malignant trasformation | "miR 154 inhibits prostate cancer cell proliferatio ......" | 23428540 | Flow cytometry; Colony formation; Luciferase |
hsa-miR-154-3p | prostate cancer | cell migration | "miR 154 inhibits EMT by targeting HMGA2 in prostat ......" | 23591597 | Western blot; Luciferase |
Reported gene related to hsa-miR-154-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-154-3p | lung squamous cell cancer | HMGA2 | "MicroRNA 154 functions as a tumor suppressor and d ......" | 27173339 |
hsa-miR-154-3p | prostate cancer | HMGA2 | "miR 154 inhibits EMT by targeting HMGA2 in prostat ......" | 23591597 |
hsa-miR-154-3p | liver cancer | ZEB2 | "miR 154 targeting ZEB2 in hepatocellular carcinoma ......" | 26503460 |
hsa-miR-154-3p | lung squamous cell cancer | ZEB2 | "miR 154 inhibits migration and invasion of human n ......" | 27347142 |
hsa-miR-154-3p | prostate cancer | CCND2 | "miR 154 inhibits prostate cancer cell proliferatio ......" | 23428540 |
hsa-miR-154-3p | lung squamous cell cancer | CDH1 | "Ectopic expression of miR-154 also increased the l ......" | 27347142 |
hsa-miR-154-3p | breast cancer | CEBPB | "Luciferase reporter assay and Western blot was use ......" | 27398145 |
hsa-miR-154-3p | breast cancer | E2F5 | "MicroRNA 154 inhibits growth and invasion of breas ......" | 27398145 |
hsa-miR-154-3p | glioblastoma | PRPS1 | "Further study found that PRPS1 was a direct target ......" | 27338789 |
hsa-miR-154-3p | colorectal cancer | TLR2 | "miR 154 suppresses colorectal cancer cell growth a ......" | 24242044 |
hsa-miR-154-3p | lung squamous cell cancer | VIM | "Ectopic expression of miR-154 also increased the l ......" | 27347142 |
Expression profile in cancer corhorts: