microRNA information: hsa-miR-154-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-154-5p | miRbase |
| Accession: | MIMAT0000452 | miRbase |
| Precursor name: | hsa-mir-154 | miRbase |
| Precursor accession: | MI0000480 | miRbase |
| Symbol: | MIR154 | HGNC |
| RefSeq ID: | NR_029704 | GenBank |
| Sequence: | UAGGUUAUCCGUGUUGCCUUCG |
Reported expression in cancers: hsa-miR-154-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-154-5p | breast cancer | downregulation | "Accumulating evidence suggested that microRNA-154 ......" | 27398145 | qPCR |
| hsa-miR-154-5p | colorectal cancer | downregulation | "Decreased miR 154 expression and its clinical sign ......" | 26048406 | qPCR |
| hsa-miR-154-5p | lung cancer | downregulation | "In this study we determined the serum miRNA profil ......" | 25386559 | Microarray |
| hsa-miR-154-5p | lung squamous cell cancer | downregulation | "miR-154 has been proven to act as a tumor suppress ......" | 25846246 | qPCR |
| hsa-miR-154-5p | lung squamous cell cancer | downregulation | "MicroRNA-154 miR-154 is dysregulated in some human ......" | 27173339 | Reverse transcription PCR |
| hsa-miR-154-5p | prostate cancer | downregulation | "Research has shown reduced expression levels of mi ......" | 23428540 |
Reported cancer pathway affected by hsa-miR-154-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-154-5p | liver cancer | Apoptosis pathway | "miR 154 targeting ZEB2 in hepatocellular carcinoma ......" | 26503460 | Luciferase; Western blot |
| hsa-miR-154-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "miR 154 suppresses non small cell lung cancer grow ......" | 25846246 | Colony formation |
| hsa-miR-154-5p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 154 functions as a tumor suppressor and d ......" | 27173339 | Luciferase |
| hsa-miR-154-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "miR 154 inhibits migration and invasion of human n ......" | 27347142 | |
| hsa-miR-154-5p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 |
Reported cancer prognosis affected by hsa-miR-154-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-154-5p | breast cancer | progression; staging | "MicroRNA 154 inhibits growth and invasion of breas ......" | 27398145 | Wound Healing Assay; Western blot; Luciferase |
| hsa-miR-154-5p | colorectal cancer | motility; progression | "miR 154 suppresses colorectal cancer cell growth a ......" | 24242044 | Colony formation |
| hsa-miR-154-5p | colorectal cancer | worse prognosis; poor survival; staging; metastasis; tumor size; progression | "Decreased miR 154 expression and its clinical sign ......" | 26048406 | |
| hsa-miR-154-5p | liver cancer | staging; metastasis; differentiation | "miR 154 targeting ZEB2 in hepatocellular carcinoma ......" | 26503460 | Luciferase; Western blot |
| hsa-miR-154-5p | lung squamous cell cancer | tumorigenesis; staging; metastasis; tumor size | "miR 154 suppresses non small cell lung cancer grow ......" | 25846246 | Colony formation |
| hsa-miR-154-5p | lung squamous cell cancer | progression; tumorigenesis; staging; metastasis; poor survival | "MicroRNA 154 functions as a tumor suppressor and d ......" | 27173339 | Luciferase |
| hsa-miR-154-5p | lung squamous cell cancer | cell migration | "miR 154 inhibits migration and invasion of human n ......" | 27347142 | |
| hsa-miR-154-5p | prostate cancer | malignant trasformation | "miR 154 inhibits prostate cancer cell proliferatio ......" | 23428540 | Flow cytometry; Colony formation; Luciferase |
| hsa-miR-154-5p | prostate cancer | cell migration | "miR 154 inhibits EMT by targeting HMGA2 in prostat ......" | 23591597 | Western blot; Luciferase |
| hsa-miR-154-5p | prostate cancer | cell migration | "This study aimed to determine the function of miR- ......" | 27074041 | Western blot; Flow cytometry; Luciferase |
Reported gene related to hsa-miR-154-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-154-5p | breast cancer | CEBPB | "Luciferase reporter assay and Western blot was use ......" | 27398145 |
| hsa-miR-154-5p | prostate cancer | CEBPB | "The effects of forced miR-154-5p expression or E2F ......" | 27074041 |
| hsa-miR-154-5p | breast cancer | E2F5 | "MicroRNA 154 inhibits growth and invasion of breas ......" | 27398145 |
| hsa-miR-154-5p | prostate cancer | E2F5 | "The effects of forced miR-154-5p expression or E2F ......" | 27074041 |
| hsa-miR-154-5p | lung squamous cell cancer | HMGA2 | "MicroRNA 154 functions as a tumor suppressor and d ......" | 27173339 |
| hsa-miR-154-5p | prostate cancer | HMGA2 | "miR 154 inhibits EMT by targeting HMGA2 in prostat ......" | 23591597 |
| hsa-miR-154-5p | liver cancer | ZEB2 | "miR 154 targeting ZEB2 in hepatocellular carcinoma ......" | 26503460 |
| hsa-miR-154-5p | lung squamous cell cancer | ZEB2 | "miR 154 inhibits migration and invasion of human n ......" | 27347142 |
| hsa-miR-154-5p | prostate cancer | CCND2 | "miR 154 inhibits prostate cancer cell proliferatio ......" | 23428540 |
| hsa-miR-154-5p | lung squamous cell cancer | CDH1 | "Ectopic expression of miR-154 also increased the l ......" | 27347142 |
| hsa-miR-154-5p | glioblastoma | PRPS1 | "Further study found that PRPS1 was a direct target ......" | 27338789 |
| hsa-miR-154-5p | colorectal cancer | TLR2 | "miR 154 suppresses colorectal cancer cell growth a ......" | 24242044 |
| hsa-miR-154-5p | lung squamous cell cancer | VIM | "Ectopic expression of miR-154 also increased the l ......" | 27347142 |
Expression profile in cancer corhorts:
