microRNA information: hsa-miR-181d-5p

SectionIDlink
Mature name: hsa-miR-181d-5pmiRbase
Accession: MIMAT0002821miRbase
Precursor name: hsa-mir-181d miRbase
Precursor accession: MI0003139miRbase
Symbol: MIR181DHGNC
RefSeq ID: NR_030179GenBank
Sequence: AACAUUCAUUGUUGUCGGUGGGU



Reported expression in cancers: hsa-miR-181d-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-181d-5p

breast cancerderegulation"In line with our quantitative PCR analysis data in ......"26697527qPCR
hsa-miR-181d-5p

gastric cancerupregulation"By integrating CNV and miRNA profiles in the same ......"23553990qPCR
hsa-miR-181d-5p

gastric cancerupregulation"MicroRNA arrays identified differences in the miRN ......"26939869Microarray
hsa-miR-181d-5p

head and neck cancerderegulation"Real-time polymerase chain reaction PCR analysis c ......"21560177qPCR
hsa-miR-181d-5p

liver cancerupregulation"Up-regulation of miR-15a miR-16 miR-27b miR-30b mi ......"24314246qPCR



Reported cancer pathway affected by hsa-miR-181d-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-181d-5p

endometrial cancerApoptosis pathway"Moreover hsa-miR-181d was upregulated to control e ......"27006767
hsa-miR-181d-5p

esophageal cancercell cycle pathway"MicroRNA 181d is a tumor suppressor in human esoph ......"27572270Luciferase
hsa-miR-181d-5p

pancreatic cancerMAPK signaling pathway"In our previous studies we identified four microRN ......"27380024



Reported cancer prognosis affected by hsa-miR-181d-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-181d-5p

breast cancerpoor survival"To investigate the global expression profile of mi ......"18812439
hsa-miR-181d-5p

gastric cancercell migration; drug resistance"MicroRNA arrays identified differences in the miRN ......"26939869
hsa-miR-181d-5p

glioblastomapoor survival; drug resistance"Genome-wide microRNA miRNA profiling of 82 gliobla ......"22570426Luciferase
hsa-miR-181d-5p

liver cancerdrug resistance"The cell viability MTT assay was used to detect dr ......"23229111MTT assay
hsa-miR-181d-5p

ovarian cancerpoor survival"We measured the expression of nine miRNAs miR-181d ......"22925189
hsa-miR-181d-5p

pancreatic cancermetastasis"In our previous studies we identified four microRN ......"27380024



Reported gene related to hsa-miR-181d-5p

miRNAcancergenereportingPUBMED
hsa-miR-181d-5p

glioblastomaMGMT"In silico analyses of The Cancer Genome Atlas TCGA ......"27057640
hsa-miR-181d-5p

glioblastomaMGMT"Bioinformatic analysis of potential genes regulate ......"22570426
hsa-miR-181d-5p

glioblastomaMGMT"We previously demonstrated that MGMT expression is ......"24994119
hsa-miR-181d-5p

esophageal cancerDERL1"MicroRNA 181d is a tumor suppressor in human esoph ......"27572270
hsa-miR-181d-5p

endometrial cancerPTEN"Moreover hsa-miR-181d was upregulated to control e ......"27006767



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-181d-5p
PGAM1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.127; TCGA CESC -0.139; TCGA COAD -0.214; TCGA ESCA -0.214; TCGA HNSC -0.254; TCGA LGG -0.098; TCGA LIHC -0.063; TCGA LUAD -0.12; TCGA LUSC -0.264; TCGA SARC -0.051; TCGA THCA -0.228; TCGA STAD -0.119; TCGA UCEC -0.11
hsa-miR-181d-5p
SAMHD1
9 cancers: BLCA; BRCA; CESC; KIRP; LUAD; OV; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.303; TCGA BRCA -0.268; TCGA CESC -0.151; TCGA KIRP -0.223; TCGA LUAD -0.345; TCGA OV -0.086; TCGA PAAD -0.257; TCGA SARC -0.19; TCGA THCA -0.31
hsa-miR-181d-5p
SOAT1
9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; OV; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.136; TCGA BRCA -0.097; TCGA KIRC -0.085; TCGA KIRP -0.131; TCGA LUAD -0.141; TCGA OV -0.076; TCGA SARC -0.202; TCGA THCA -0.229; TCGA UCEC -0.095
hsa-miR-181d-5p
CCL8
9 cancers: BLCA; BRCA; COAD; KIRP; LUAD; LUSC; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.5; TCGA BRCA -0.329; TCGA COAD -0.36; TCGA KIRP -0.782; TCGA LUAD -0.4; TCGA LUSC -0.218; TCGA PAAD -0.557; TCGA SARC -0.566; TCGA THCA -0.462
hsa-miR-181d-5p
PAFAH1B2
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; THCA
MirTarget
TCGA BLCA -0.117; TCGA BRCA -0.128; TCGA ESCA -0.118; TCGA HNSC -0.126; TCGA KIRC -0.216; TCGA KIRP -0.184; TCGA LUAD -0.144; TCGA LUSC -0.074; TCGA THCA -0.192
hsa-miR-181d-5p
FAM135A
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; THCA
MirTarget
TCGA BLCA -0.112; TCGA BRCA -0.083; TCGA CESC -0.405; TCGA ESCA -0.266; TCGA HNSC -0.279; TCGA KIRC -0.116; TCGA LUAD -0.136; TCGA LUSC -0.123; TCGA THCA -0.055
hsa-miR-181d-5p
SUCLG2
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.093; TCGA BRCA -0.08; TCGA HNSC -0.102; TCGA KIRC -0.354; TCGA KIRP -0.217; TCGA LIHC -0.147; TCGA LUSC -0.061; TCGA OV -0.103; TCGA PRAD -0.072; TCGA SARC -0.079; TCGA THCA -0.208; TCGA STAD -0.315
hsa-miR-181d-5p
MINK1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.069; TCGA CESC -0.243; TCGA COAD -0.122; TCGA ESCA -0.249; TCGA HNSC -0.218; TCGA LUAD -0.106; TCGA LUSC -0.112; TCGA SARC -0.061; TCGA THCA -0.092; TCGA STAD -0.221; TCGA UCEC -0.095
hsa-miR-181d-5p
PSAP
9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; OV; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.08; TCGA BRCA -0.074; TCGA KIRC -0.073; TCGA KIRP -0.18; TCGA LUAD -0.15; TCGA OV -0.068; TCGA SARC -0.236; TCGA THCA -0.109; TCGA STAD -0.126
hsa-miR-181d-5p
LRRFIP1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.195; TCGA BRCA -0.133; TCGA COAD -0.083; TCGA ESCA -0.194; TCGA HNSC -0.268; TCGA LUAD -0.111; TCGA LUSC -0.097; TCGA SARC -0.099; TCGA THCA -0.119; TCGA UCEC -0.065
hsa-miR-181d-5p
ADM
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUSC; SARC; STAD
MirTarget
TCGA BLCA -0.247; TCGA BRCA -0.174; TCGA CESC -0.188; TCGA COAD -0.168; TCGA ESCA -0.346; TCGA HNSC -0.187; TCGA KIRP -0.535; TCGA LGG -0.297; TCGA LUSC -0.353; TCGA SARC -0.304; TCGA STAD -0.298
hsa-miR-181d-5p
DGKH
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; THCA; UCEC
MirTarget
TCGA BLCA -0.147; TCGA BRCA -0.118; TCGA CESC -0.279; TCGA HNSC -0.14; TCGA LUAD -0.179; TCGA LUSC -0.142; TCGA OV -0.125; TCGA THCA -0.152; TCGA UCEC -0.109
hsa-miR-181d-5p
KANK1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA
MirTarget
TCGA BLCA -0.167; TCGA CESC -0.209; TCGA ESCA -0.279; TCGA HNSC -0.411; TCGA KIRC -0.134; TCGA KIRP -0.091; TCGA LIHC -0.155; TCGA LUSC -0.124; TCGA THCA -0.151
hsa-miR-181d-5p
EPB41L3
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; OV; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.173; TCGA BRCA -0.292; TCGA HNSC -0.158; TCGA KIRC -0.352; TCGA KIRP -0.221; TCGA LUAD -0.201; TCGA OV -0.137; TCGA SARC -0.337; TCGA THCA -0.452; TCGA UCEC -0.131
hsa-miR-181d-5p
TSC22D2
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; THCA
MirTarget
TCGA BLCA -0.081; TCGA BRCA -0.08; TCGA ESCA -0.203; TCGA HNSC -0.319; TCGA KIRC -0.131; TCGA KIRP -0.231; TCGA LIHC -0.084; TCGA LUAD -0.285; TCGA THCA -0.091
hsa-miR-181d-5p
CLIP1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.179; TCGA BRCA -0.106; TCGA CESC -0.178; TCGA ESCA -0.166; TCGA HNSC -0.279; TCGA KIRC -0.105; TCGA LIHC -0.071; TCGA LUAD -0.118; TCGA LUSC -0.079; TCGA SARC -0.091; TCGA THCA -0.164; TCGA UCEC -0.088
hsa-miR-181d-5p
GHITM
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.136; TCGA BRCA -0.081; TCGA CESC -0.094; TCGA ESCA -0.113; TCGA HNSC -0.137; TCGA KIRC -0.288; TCGA KIRP -0.257; TCGA LIHC -0.134; TCGA LUSC -0.121; TCGA OV -0.101; TCGA PRAD -0.052; TCGA THCA -0.226; TCGA STAD -0.225
hsa-miR-181d-5p
PI4K2B
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; OV; SARC; THCA
MirTarget
TCGA BLCA -0.054; TCGA BRCA -0.052; TCGA CESC -0.121; TCGA ESCA -0.111; TCGA HNSC -0.111; TCGA KIRC -0.13; TCGA KIRP -0.079; TCGA LIHC -0.235; TCGA OV -0.089; TCGA SARC -0.076; TCGA THCA -0.23
hsa-miR-181d-5p
RAD23B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC
MirTarget
TCGA BLCA -0.065; TCGA BRCA -0.068; TCGA CESC -0.1; TCGA COAD -0.073; TCGA ESCA -0.094; TCGA HNSC -0.133; TCGA KIRC -0.091; TCGA KIRP -0.091; TCGA LIHC -0.108; TCGA LUAD -0.065; TCGA OV -0.055; TCGA PRAD -0.093; TCGA SARC -0.091
hsa-miR-181d-5p
UBE3C
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; THCA
MirTarget
TCGA BLCA -0.073; TCGA BRCA -0.057; TCGA CESC -0.094; TCGA ESCA -0.127; TCGA HNSC -0.138; TCGA KIRC -0.083; TCGA LUAD -0.102; TCGA LUSC -0.103; TCGA THCA -0.118
hsa-miR-181d-5p
PPP2R5E
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; THCA
MirTarget
TCGA BLCA -0.086; TCGA BRCA -0.094; TCGA CESC -0.081; TCGA COAD -0.058; TCGA ESCA -0.092; TCGA HNSC -0.181; TCGA KIRC -0.099; TCGA LUAD -0.063; TCGA LUSC -0.103; TCGA THCA -0.139
hsa-miR-181d-5p
HEATR3
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.068; TCGA BRCA -0.063; TCGA HNSC -0.171; TCGA KIRC -0.078; TCGA KIRP -0.106; TCGA LUSC -0.147; TCGA PAAD -0.148; TCGA PRAD -0.106; TCGA SARC -0.136; TCGA THCA -0.17
hsa-miR-181d-5p
NPTN
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; UCEC
MirTarget
TCGA BLCA -0.129; TCGA BRCA -0.094; TCGA COAD -0.121; TCGA HNSC -0.065; TCGA KIRC -0.081; TCGA KIRP -0.128; TCGA LUAD -0.072; TCGA LUSC -0.126; TCGA UCEC -0.096
hsa-miR-181d-5p
ACER3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.073; TCGA BRCA -0.243; TCGA COAD -0.102; TCGA ESCA -0.121; TCGA HNSC -0.144; TCGA KIRC -0.139; TCGA KIRP -0.103; TCGA LUAD -0.183; TCGA OV -0.136; TCGA PAAD -0.169; TCGA SARC -0.153; TCGA THCA -0.22
hsa-miR-181d-5p
BMP2K
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.173; TCGA BRCA -0.145; TCGA CESC -0.134; TCGA ESCA -0.222; TCGA HNSC -0.266; TCGA KIRP -0.162; TCGA LUAD -0.168; TCGA PAAD -0.231; TCGA SARC -0.215; TCGA THCA -0.32
hsa-miR-181d-5p
CSF2RB
9 cancers: BLCA; BRCA; KIRP; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.305; TCGA BRCA -0.175; TCGA KIRP -0.267; TCGA LUAD -0.225; TCGA PAAD -0.421; TCGA SARC -0.396; TCGA THCA -0.312; TCGA STAD -0.338; TCGA UCEC -0.169
hsa-miR-181d-5p
CD48
11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; OV; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.429; TCGA BRCA -0.116; TCGA CESC -0.194; TCGA KIRP -0.251; TCGA LUAD -0.13; TCGA OV -0.198; TCGA PAAD -0.468; TCGA SARC -0.331; TCGA THCA -0.493; TCGA STAD -0.4; TCGA UCEC -0.121
hsa-miR-181d-5p
ARHGEF3
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PAAD; SARC; THCA
MirTarget
TCGA BLCA -0.093; TCGA BRCA -0.069; TCGA CESC -0.138; TCGA HNSC -0.161; TCGA KIRC -0.193; TCGA KIRP -0.135; TCGA LUAD -0.119; TCGA PAAD -0.157; TCGA SARC -0.073; TCGA THCA -0.178
hsa-miR-181d-5p
TEX2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; THCA
MirTarget
TCGA BLCA -0.105; TCGA BRCA -0.093; TCGA CESC -0.085; TCGA ESCA -0.12; TCGA HNSC -0.107; TCGA KIRP -0.164; TCGA LIHC -0.09; TCGA LUAD -0.087; TCGA LUSC -0.108; TCGA THCA -0.305
hsa-miR-181d-5p
MAGI3
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; THCA; STAD
MirTarget
TCGA BLCA -0.075; TCGA CESC -0.108; TCGA ESCA -0.199; TCGA HNSC -0.14; TCGA KIRC -0.252; TCGA KIRP -0.116; TCGA LIHC -0.092; TCGA LUAD -0.164; TCGA THCA -0.161; TCGA STAD -0.121
hsa-miR-181d-5p
GPRIN3
10 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.246; TCGA BRCA -0.161; TCGA KIRC -0.167; TCGA KIRP -0.304; TCGA LUAD -0.15; TCGA PAAD -0.262; TCGA SARC -0.121; TCGA THCA -0.563; TCGA STAD -0.239; TCGA UCEC -0.171
hsa-miR-181d-5p
SLC25A25
10 cancers: BLCA; COAD; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.153; TCGA COAD -0.09; TCGA KIRC -0.251; TCGA KIRP -0.448; TCGA LIHC -0.224; TCGA LUAD -0.076; TCGA OV -0.1; TCGA PRAD -0.08; TCGA THCA -0.285; TCGA UCEC -0.101
hsa-miR-181d-5p
SLK
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; THCA; UCEC
MirTarget
TCGA BLCA -0.094; TCGA BRCA -0.119; TCGA CESC -0.224; TCGA COAD -0.098; TCGA ESCA -0.16; TCGA HNSC -0.3; TCGA KIRC -0.083; TCGA LUAD -0.093; TCGA THCA -0.184; TCGA UCEC -0.073
hsa-miR-181d-5p
UBE2D3
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; SARC; STAD
MirTarget
TCGA BLCA -0.057; TCGA CESC -0.104; TCGA HNSC -0.155; TCGA KIRC -0.079; TCGA KIRP -0.051; TCGA LIHC -0.073; TCGA LUAD -0.063; TCGA SARC -0.068; TCGA STAD -0.11
hsa-miR-181d-5p
TTC39B
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.331; TCGA BRCA -0.118; TCGA CESC -0.319; TCGA ESCA -0.377; TCGA HNSC -0.325; TCGA KIRC -0.344; TCGA KIRP -0.391; TCGA LUAD -0.182; TCGA LUSC -0.242; TCGA OV -0.127; TCGA PAAD -0.165; TCGA THCA -0.151; TCGA STAD -0.187
hsa-miR-181d-5p
LEPROT
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; OV; THCA
MirTarget
TCGA BLCA -0.267; TCGA BRCA -0.238; TCGA ESCA -0.191; TCGA HNSC -0.209; TCGA KIRC -0.165; TCGA KIRP -0.215; TCGA LUAD -0.135; TCGA OV -0.062; TCGA THCA -0.149
hsa-miR-181d-5p
WNK1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; THCA; UCEC
MirTarget
TCGA BLCA -0.093; TCGA BRCA -0.058; TCGA CESC -0.137; TCGA HNSC -0.12; TCGA KIRC -0.328; TCGA KIRP -0.333; TCGA LUAD -0.123; TCGA THCA -0.146; TCGA UCEC -0.054
hsa-miR-181d-5p
STARD4
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; THCA; STAD
MirTarget
TCGA BLCA -0.329; TCGA BRCA -0.103; TCGA COAD -0.102; TCGA HNSC -0.162; TCGA KIRP -0.146; TCGA LIHC -0.204; TCGA LUAD -0.137; TCGA THCA -0.352; TCGA STAD -0.242
hsa-miR-181d-5p
SEC24A
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.071; TCGA BRCA -0.177; TCGA COAD -0.12; TCGA ESCA -0.239; TCGA HNSC -0.158; TCGA KIRC -0.078; TCGA KIRP -0.166; TCGA LIHC -0.121; TCGA THCA -0.155; TCGA STAD -0.219; TCGA UCEC -0.058
hsa-miR-181d-5p
HIPK3
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; THCA; UCEC
MirTarget
TCGA BLCA -0.329; TCGA BRCA -0.266; TCGA ESCA -0.257; TCGA HNSC -0.242; TCGA KIRC -0.238; TCGA KIRP -0.257; TCGA LUAD -0.146; TCGA THCA -0.231; TCGA UCEC -0.121
hsa-miR-181d-5p
ENDOD1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; UCEC
MirTarget
TCGA BLCA -0.152; TCGA BRCA -0.065; TCGA COAD -0.1; TCGA ESCA -0.214; TCGA HNSC -0.209; TCGA LUAD -0.122; TCGA LUSC -0.205; TCGA OV -0.11; TCGA PRAD -0.113; TCGA UCEC -0.134
hsa-miR-181d-5p
KAT2B
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; THCA; STAD
MirTarget
TCGA BRCA -0.284; TCGA CESC -0.17; TCGA ESCA -0.25; TCGA HNSC -0.291; TCGA KIRC -0.112; TCGA KIRP -0.296; TCGA LIHC -0.281; TCGA LUAD -0.13; TCGA THCA -0.153; TCGA STAD -0.194
hsa-miR-181d-5p
ZNRF2
10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUSC; OV; PRAD; STAD
MirTarget
TCGA BRCA -0.078; TCGA CESC -0.09; TCGA ESCA -0.113; TCGA HNSC -0.124; TCGA KIRC -0.231; TCGA LIHC -0.118; TCGA LUSC -0.105; TCGA OV -0.092; TCGA PRAD -0.134; TCGA STAD -0.092
hsa-miR-181d-5p
ATP11B
9 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; THCA; STAD
MirTarget
TCGA BRCA -0.102; TCGA CESC -0.198; TCGA ESCA -0.228; TCGA HNSC -0.136; TCGA LUAD -0.088; TCGA LUSC -0.112; TCGA OV -0.1; TCGA THCA -0.056; TCGA STAD -0.091
hsa-miR-181d-5p
TMEM184C
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.105; TCGA HNSC -0.076; TCGA KIRC -0.188; TCGA KIRP -0.145; TCGA LIHC -0.055; TCGA LUAD -0.074; TCGA PRAD -0.067; TCGA THCA -0.097; TCGA STAD -0.088
hsa-miR-181d-5p
SCD
9 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD
MirTarget
TCGA BRCA -0.395; TCGA CESC -0.219; TCGA HNSC -0.235; TCGA KIRP -0.167; TCGA LIHC -0.292; TCGA LUAD -0.204; TCGA LUSC -0.158; TCGA OV -0.23; TCGA PRAD -0.262
hsa-miR-181d-5p
CHMP2B
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; OV; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.051; TCGA CESC -0.073; TCGA HNSC -0.166; TCGA KIRC -0.128; TCGA KIRP -0.091; TCGA LUAD -0.118; TCGA OV -0.061; TCGA SARC -0.089; TCGA THCA -0.139; TCGA STAD -0.076
hsa-miR-181d-5p
PRDX3
10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.056; TCGA KIRC -0.263; TCGA KIRP -0.197; TCGA LGG -0.064; TCGA LIHC -0.155; TCGA LUSC -0.063; TCGA OV -0.088; TCGA PRAD -0.114; TCGA THCA -0.099; TCGA STAD -0.128
hsa-miR-181d-5p
TMEM144
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.158; TCGA HNSC -0.142; TCGA KIRC -0.081; TCGA KIRP -0.179; TCGA LUAD -0.074; TCGA LUSC -0.09; TCGA SARC -0.236; TCGA THCA -0.066; TCGA STAD -0.325
hsa-miR-181d-5p
GOLGA1
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; PRAD; THCA; UCEC
MirTarget
TCGA BRCA -0.07; TCGA CESC -0.08; TCGA COAD -0.067; TCGA ESCA -0.153; TCGA HNSC -0.052; TCGA LIHC -0.081; TCGA PRAD -0.056; TCGA THCA -0.081; TCGA UCEC -0.053
hsa-miR-181d-5p
RNF6
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; THCA
MirTarget
TCGA BRCA -0.09; TCGA CESC -0.108; TCGA HNSC -0.111; TCGA KIRC -0.062; TCGA KIRP -0.102; TCGA LUAD -0.075; TCGA LUSC -0.078; TCGA OV -0.068; TCGA PRAD -0.054; TCGA THCA -0.146
hsa-miR-181d-5p
ACSL1
12 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; OV; SARC; THCA; UCEC
MirTarget
TCGA BRCA -0.433; TCGA CESC -0.141; TCGA COAD -0.155; TCGA HNSC -0.205; TCGA KIRC -0.337; TCGA KIRP -0.583; TCGA LIHC -0.467; TCGA LUSC -0.095; TCGA OV -0.155; TCGA SARC -0.208; TCGA THCA -0.337; TCGA UCEC -0.17
hsa-miR-181d-5p
TAB3
9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; OV; PRAD; THCA
MirTarget
TCGA BRCA -0.077; TCGA CESC -0.082; TCGA HNSC -0.134; TCGA KIRC -0.185; TCGA KIRP -0.121; TCGA LIHC -0.116; TCGA OV -0.053; TCGA PRAD -0.1; TCGA THCA -0.103
hsa-miR-181d-5p
HK2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD
MirTarget
TCGA BRCA -0.135; TCGA CESC -0.244; TCGA COAD -0.148; TCGA ESCA -0.209; TCGA HNSC -0.268; TCGA LUAD -0.258; TCGA LUSC -0.12; TCGA PRAD -0.185; TCGA STAD -0.21
hsa-miR-181d-5p
CSNK1G1
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; THCA
MirTarget
TCGA BRCA -0.074; TCGA CESC -0.082; TCGA COAD -0.092; TCGA ESCA -0.145; TCGA HNSC -0.083; TCGA KIRC -0.051; TCGA LUAD -0.069; TCGA PRAD -0.079; TCGA THCA -0.104
hsa-miR-181d-5p
DHRS4
12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; SARC; THCA; STAD
miRNAWalker2 validate
TCGA CESC -0.083; TCGA COAD -0.164; TCGA ESCA -0.22; TCGA HNSC -0.131; TCGA KIRC -0.27; TCGA KIRP -0.307; TCGA LIHC -0.331; TCGA LUSC -0.1; TCGA OV -0.222; TCGA SARC -0.068; TCGA THCA -0.102; TCGA STAD -0.341
hsa-miR-181d-5p
ARF6
9 cancers: CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.143; TCGA COAD -0.133; TCGA ESCA -0.161; TCGA HNSC -0.222; TCGA LUAD -0.068; TCGA LUSC -0.128; TCGA PRAD -0.071; TCGA SARC -0.087; TCGA STAD -0.131
hsa-miR-181d-5p
NUS1
9 cancers: HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA
MirTarget
TCGA HNSC -0.104; TCGA KIRC -0.089; TCGA KIRP -0.102; TCGA LIHC -0.082; TCGA LUAD -0.097; TCGA LUSC -0.071; TCGA OV -0.063; TCGA PAAD -0.095; TCGA THCA -0.106





Enriched cancer pathways of putative targets