microRNA information: hsa-miR-182-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-182-3p | miRbase |
| Accession: | MIMAT0000260 | miRbase |
| Precursor name: | hsa-mir-182 | miRbase |
| Precursor accession: | MI0000272 | miRbase |
| Symbol: | MIR182 | HGNC |
| RefSeq ID: | NR_029614 | GenBank |
| Sequence: | UGGUUCUAGACUUGCCAACUA |
Reported expression in cancers: hsa-miR-182-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-182-3p | bladder cancer | upregulation | "miR-182 is an important molecule in the regulation ......" | 24445397 | |
| hsa-miR-182-3p | breast cancer | upregulation | "MiR-182 is a member of the miR-183 cluster located ......" | 23333633 | Reverse transcription PCR; qPCR |
| hsa-miR-182-3p | breast cancer | upregulation | "Quantitative real-time PCR qRT-PCR was utilized to ......" | 23430586 | qPCR |
| hsa-miR-182-3p | breast cancer | upregulation | "In this study up-regulation of miR-182 was validat ......" | 27476169 | |
| hsa-miR-182-3p | cervical and endocervical cancer | upregulation | "MicroRNA 182 plays an onco miRNA role in cervical ......" | 23313739 | |
| hsa-miR-182-3p | cervical and endocervical cancer | downregulation | "In present study we not only determine the miR-182 ......" | 26191165 | |
| hsa-miR-182-3p | colon cancer | upregulation | "Louis Medical Center miRNA profiles were determine ......" | 24865442 | Microarray; qPCR |
| hsa-miR-182-3p | colorectal cancer | upregulation | "Up regulation of miR 182 expression in colorectal ......" | 23474644 | qPCR |
| hsa-miR-182-3p | colorectal cancer | upregulation | "Enhanced miR 182 transcription is a predictor of p ......" | 24615484 | qPCR |
| hsa-miR-182-3p | colorectal cancer | upregulation | "microRNA 182 targets special AT rich sequence bind ......" | 24884732 | qPCR |
| hsa-miR-182-3p | colorectal cancer | upregulation | "In this study we investigated the status of miR-18 ......" | 25031782 | in situ hybridization |
| hsa-miR-182-3p | colorectal cancer | upregulation | "The oncogenetic properties of miR-182 have been de ......" | 25738520 | |
| hsa-miR-182-3p | gastric cancer | downregulation | "MicroRNA-182 miR-182 is significantly downregulate ......" | 25682742 | |
| hsa-miR-182-3p | head and neck cancer | upregulation | "To investigate the functional mechanism of microRN ......" | 27744260 | |
| hsa-miR-182-3p | kidney renal cell cancer | downregulation | "The purpose of our study was aimed to determine th ......" | 27468875 | qPCR |
| hsa-miR-182-3p | liver cancer | upregulation | "miR-182 is one of the most significantly up-regula ......" | 22681717 | qPCR |
| hsa-miR-182-3p | liver cancer | upregulation | "OncomiR miR 96 and miR 182 promote cell proliferat ......" | 25663355 | qPCR |
| hsa-miR-182-3p | liver cancer | upregulation | "Serum miR 182 and miR 331 3p as diagnostic and pro ......" | 25903466 | qPCR |
| hsa-miR-182-3p | liver cancer | upregulation | "The microRNA microarray was employed to search for ......" | 26126858 | Microarray |
| hsa-miR-182-3p | lung cancer | deregulation | "Four up-regulated microRNAs miR-210 miR-21 miR-31 ......" | 22672859 | |
| hsa-miR-182-3p | lung cancer | deregulation | "Using a recently published robust rank aggregation ......" | 23225545 | |
| hsa-miR-182-3p | lung squamous cell cancer | upregulation | "Microarray of expression of specific miRNAs in lun ......" | 24600991 | qPCR; Microarray |
| hsa-miR-182-3p | lung squamous cell cancer | upregulation | "Overexpression of microRNA-182 miR-182 is found in ......" | 25012722 | |
| hsa-miR-182-3p | melanoma | upregulation | "We find that miR-182 member of a miRNA cluster in ......" | 19188590 | |
| hsa-miR-182-3p | ovarian cancer | upregulation | "To identify the micro-ribonucleic acids miRNAs exp ......" | 24816756 | qPCR |
| hsa-miR-182-3p | prostate cancer | deregulation | "This study aimed to investigate the microRNA miRNA ......" | 19676045 | qPCR; Microarray |
| hsa-miR-182-3p | prostate cancer | downregulation | "We investigated the expression profiles of 6 micro ......" | 20873592 | Microarray; in situ hybridization |
| hsa-miR-182-3p | prostate cancer | upregulation | "In the current study we report that miR-182 expres ......" | 23874837 | |
| hsa-miR-182-3p | prostate cancer | deregulation | "RESULTS A total of 162 miRNAs were differentially ......" | 26628405 | |
| hsa-miR-182-3p | sarcoma | upregulation | "MiRNA mimics or inhibitor were transfected for up- ......" | 25973950 |
Reported cancer pathway affected by hsa-miR-182-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-182-3p | B cell lymphoma | Apoptosis pathway | "Mangiferin inhibition of proliferation and inducti ......" | 26870290 | MTT assay; Flow cytometry; Western blot |
| hsa-miR-182-3p | breast cancer | Apoptosis pathway | "We aimed to evaluate the expression of microRNA-18 ......" | 23430586 | Flow cytometry; Cell migration assay; Luciferase; Western blot; MTT assay |
| hsa-miR-182-3p | breast cancer | cell cycle pathway | "The miRNA level was detected by LNA-based northern ......" | 25394902 | Luciferase; Flow cytometry; Colony formation; MTT assay; Wound Healing Assay; Western blot |
| hsa-miR-182-3p | breast cancer | Apoptosis pathway | "Knockdown of miR 182 promotes apoptosis via regula ......" | 27476169 | Western blot |
| hsa-miR-182-3p | breast cancer | cell cycle pathway | "MiR 182 promotes proliferation and invasion and el ......" | 27648365 | |
| hsa-miR-182-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 182 plays an onco miRNA role in cervical ......" | 23313739 | Western blot; Flow cytometry |
| hsa-miR-182-3p | cervical and endocervical cancer | Apoptosis pathway | "miR 182 induces cervical cancer cell apoptosis thr ......" | 26191165 | |
| hsa-miR-182-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "microRNA 182 targets special AT rich sequence bind ......" | 24884732 | Colony formation; Luciferase; Western blot |
| hsa-miR-182-3p | glioblastoma | Apoptosis pathway | "miR 182 integrates apoptosis growth and differenti ......" | 25838542 | |
| hsa-miR-182-3p | glioblastoma | Apoptosis pathway | "Our group has been studying the role of miR-182 in ......" | 26506113 | |
| hsa-miR-182-3p | kidney renal cell cancer | Apoptosis pathway | "Herein we sought to investigate the impact of gemc ......" | 25833690 | Western blot; MTT assay |
| hsa-miR-182-3p | lung cancer | cell cycle pathway | "microRNA 182 inhibits the proliferation and invasi ......" | 21503569 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-miR-182-3p | lung squamous cell cancer | Apoptosis pathway | "Quantitative real-time PCR assay was employed to c ......" | 27073334 | Flow cytometry; Wound Healing Assay |
| hsa-miR-182-3p | melanoma | Apoptosis pathway | "Aberrant miR 182 expression promotes melanoma meta ......" | 19188590 | |
| hsa-miR-182-3p | melanoma | cell cycle pathway | "Role of microRNA 182 in posterior uveal melanoma: ......" | 22848417 | Western blot |
| hsa-miR-182-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 182 promotes cell growth invasion and che ......" | 23296900 | Colony formation |
| hsa-miR-182-3p | ovarian cancer | Apoptosis pathway | "Downregulation of DNMT3a expression increases miR ......" | 27748882 | |
| hsa-miR-182-3p | prostate cancer | cell cycle pathway | "Overexpressed microRNA 182 promotes proliferation ......" | 23874837 | |
| hsa-miR-182-3p | sarcoma | Apoptosis pathway | "Expression and regulatory effects of microRNA 182 ......" | 27123060 | Flow cytometry; Cell migration assay |
Reported cancer prognosis affected by hsa-miR-182-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-182-3p | acute myeloid leukemia | poor survival; drug resistance | "HDAC Inhibition Induces MicroRNA 182 which Targets ......" | 26858310 | Luciferase |
| hsa-miR-182-3p | bladder cancer | staging; poor survival; recurrence | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
| hsa-miR-182-3p | bladder cancer | metastasis; progression; cell migration | "TGF β upregulates miR 182 expression to promote g ......" | 24445397 | |
| hsa-miR-182-3p | breast cancer | staging | "These five miRNAs were measured in an independent ......" | 20490652 | |
| hsa-miR-182-3p | breast cancer | drug resistance | "miR 182 mediated downregulation of BRCA1 impacts D ......" | 21195000 | |
| hsa-miR-182-3p | breast cancer | progression | "Expression profiling of 365 miRNA by real-time qua ......" | 21375733 | |
| hsa-miR-182-3p | breast cancer | malignant trasformation | "Through immunohistochemistry analyses of tissue mi ......" | 22086602 | |
| hsa-miR-182-3p | breast cancer | tumorigenesis | "Up regulation of miR 182 by β catenin in breast c ......" | 23333633 | Western blot; Colony formation |
| hsa-miR-182-3p | breast cancer | metastasis; malignant trasformation; motility; worse prognosis | "Suppression of MIM by microRNA 182 activates RhoA ......" | 23474751 | |
| hsa-miR-182-3p | breast cancer | poor survival | "An independent dataset validated our findings for ......" | 24398324 | |
| hsa-miR-182-3p | breast cancer | metastasis | "The objective of the present study is to evaluate ......" | 25369070 | |
| hsa-miR-182-3p | breast cancer | poor survival | "The miRNA level was detected by LNA-based northern ......" | 25394902 | Luciferase; Flow cytometry; Colony formation; MTT assay; Wound Healing Assay; Western blot |
| hsa-miR-182-3p | breast cancer | metastasis | "Here we show that breast cancer metastasis can be ......" | 27641360 | |
| hsa-miR-182-3p | breast cancer | progression | "MiR 182 promotes proliferation and invasion and el ......" | 27648365 | |
| hsa-miR-182-3p | cervical and endocervical cancer | staging | "MicroRNA 182 plays an onco miRNA role in cervical ......" | 23313739 | Western blot; Flow cytometry |
| hsa-miR-182-3p | colon cancer | tumorigenesis; poor survival | "The differential expressions of miR-9 miR-31 and m ......" | 23019418 | |
| hsa-miR-182-3p | colon cancer | metastasis | "Effects of anti miR 182 on TSP 1 expression in hum ......" | 24053448 | |
| hsa-miR-182-3p | colon cancer | poor survival | "Louis Medical Center miRNA profiles were determine ......" | 24865442 | |
| hsa-miR-182-3p | colorectal cancer | worse prognosis; staging; metastasis; tumor size; poor survival; progression | "Up regulation of miR 182 expression in colorectal ......" | 23474644 | |
| hsa-miR-182-3p | colorectal cancer | poor survival; staging; metastasis; progression | "Enhanced miR 182 transcription is a predictor of p ......" | 24615484 | |
| hsa-miR-182-3p | colorectal cancer | metastasis; cell migration; tumorigenesis | "microRNA 182 targets special AT rich sequence bind ......" | 24884732 | Colony formation; Luciferase; Western blot |
| hsa-miR-182-3p | colorectal cancer | staging; metastasis; poor survival; worse prognosis | "In this study we investigated the status of miR-18 ......" | 25031782 | |
| hsa-miR-182-3p | colorectal cancer | progression; metastasis; tumorigenesis | "Circulating miR 182 is a biomarker of colorectal a ......" | 25115394 | |
| hsa-miR-182-3p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
| hsa-miR-182-3p | gastric cancer | staging | "miR-32 miR-182 and miR-143 dysregulated expression ......" | 21874264 | |
| hsa-miR-182-3p | gastric cancer | progression | "MicroRNA 182 inhibits proliferation through target ......" | 25682742 | Colony formation |
| hsa-miR-182-3p | glioblastoma | differentiation; poor survival | "miR 182 integrates apoptosis growth and differenti ......" | 25838542 | |
| hsa-miR-182-3p | glioblastoma | progression; drug resistance; worse prognosis; differentiation | "Our group has been studying the role of miR-182 in ......" | 26506113 | |
| hsa-miR-182-3p | head and neck cancer | recurrence | "Overexpression of TP53 mutation associated microRN ......" | 27744260 | Luciferase |
| hsa-miR-182-3p | kidney renal cell cancer | cell migration | "MicroRNA 182 suppresses clear cell renal cell carc ......" | 27468875 | Colony formation; Western blot; Luciferase |
| hsa-miR-182-3p | liver cancer | metastasis; worse prognosis | "MicroRNA 182 downregulates metastasis suppressor 1 ......" | 22681717 | Western blot; Luciferase |
| hsa-miR-182-3p | liver cancer | tumorigenesis | "OncomiR miR 96 and miR 182 promote cell proliferat ......" | 25663355 | Western blot; Luciferase |
| hsa-miR-182-3p | liver cancer | malignant trasformation; staging; tumor size; poor survival | "Serum miR 182 and miR 331 3p as diagnostic and pro ......" | 25903466 | |
| hsa-miR-182-3p | lung cancer | tumorigenesis | "Hsa mir 182 suppresses lung tumorigenesis through ......" | 20420807 | |
| hsa-miR-182-3p | lung cancer | staging | "We searched the published literature for the miRNA ......" | 21904633 | |
| hsa-miR-182-3p | lung cancer | worse prognosis | "Gene expression of members of the miR-183 family m ......" | 21920043 | |
| hsa-miR-182-3p | lung cancer | progression; metastasis; staging | "Sp1 mediated microRNA 182 expression regulates lun ......" | 24519909 | |
| hsa-miR-182-3p | lung cancer | tumorigenesis | "The microRNA 182 PDK4 axis regulates lung tumorige ......" | 27641336 | |
| hsa-miR-182-3p | lung squamous cell cancer | metastasis | "The miRs were quantified by microarray hybridizati ......" | 22295063 | |
| hsa-miR-182-3p | lung squamous cell cancer | drug resistance | "MicroRNA 182 modulates chemosensitivity of human n ......" | 25012722 | Western blot; MTT assay |
| hsa-miR-182-3p | lung squamous cell cancer | staging | "Diagnostic Value of Serum miR 182 miR 183 miR 210 ......" | 27093275 | |
| hsa-miR-182-3p | melanoma | metastasis; poor survival; progression | "Aberrant miR 182 expression promotes melanoma meta ......" | 19188590 | |
| hsa-miR-182-3p | melanoma | drug resistance | "To improve uveal melanoma specificity of adenoviru ......" | 24001901 | Luciferase |
| hsa-miR-182-3p | ovarian cancer | metastasis; malignant trasformation | "MiR 182 overexpression in tumourigenesis of high g ......" | 22322863 | |
| hsa-miR-182-3p | ovarian cancer | drug resistance | "MicroRNA 182 promotes cell growth invasion and che ......" | 23296900 | Colony formation |
| hsa-miR-182-3p | ovarian cancer | poor survival | "Molecular bases of aberrant miR 182 expression in ......" | 27295517 | |
| hsa-miR-182-3p | ovarian cancer | drug resistance | "Downregulation of DNMT3a expression increases miR ......" | 27748882 | |
| hsa-miR-182-3p | pancreatic cancer | staging; metastasis; poor survival; worse prognosis | "Circulating microRNA 182 in plasma and its potenti ......" | 25326859 | |
| hsa-miR-182-3p | prostate cancer | staging | "We investigated the expression profiles of 6 micro ......" | 20873592 | |
| hsa-miR-182-3p | prostate cancer | drug resistance | "Inhibition of proliferation and induction of autop ......" | 23936432 | |
| hsa-miR-182-3p | prostate cancer | worse prognosis; progression; poor survival | "Identification of miR 187 and miR 182 as biomarker ......" | 24518785 | |
| hsa-miR-182-3p | prostate cancer | tumor size; progression | "Hypoxia inducible miR 182 enhances HIF1α signalin ......" | 26205124 | |
| hsa-miR-182-3p | prostate cancer | metastasis; progression; recurrence | "MiR 182 Is Associated with Growth Migration and In ......" | 26640590 | Western blot |
| hsa-miR-182-3p | prostate cancer | progression | "Androgen receptor regulated microRNA miR 182 5p pr ......" | 27109471 | |
| hsa-miR-182-3p | prostate cancer | poor survival | "In this regulatory network 10 genes BCL2 BNC2 CCND ......" | 27179774 | |
| hsa-miR-182-3p | sarcoma | metastasis | "MicroRNA 182 drives metastasis of primary sarcomas ......" | 25180607 | |
| hsa-miR-182-3p | sarcoma | metastasis; progression | "The Downregulation of MiR 182 Is Associated with t ......" | 25973950 | Cell migration assay |
Reported gene related to hsa-miR-182-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-182-3p | breast cancer | PDCD4 | "The effects were accompanied by up-regulation of t ......" | 22086602 |
| hsa-miR-182-3p | lung cancer | PDCD4 | "In our study we found that microRNA-182 miR-182 wa ......" | 23877371 |
| hsa-miR-182-3p | lung squamous cell cancer | PDCD4 | "MicroRNA 182 modulates chemosensitivity of human n ......" | 25012722 |
| hsa-miR-182-3p | ovarian cancer | PDCD4 | "MicroRNA 182 promotes cell growth invasion and che ......" | 23296900 |
| hsa-miR-182-3p | cervical and endocervical cancer | FOXO1 | "Western blot flow cytometry and pathway analysis f ......" | 23313739 |
| hsa-miR-182-3p | colon cancer | FOXO1 | "Immunohistochemical analysis revealed that the lev ......" | 24865442 |
| hsa-miR-182-3p | prostate cancer | FOXO1 | "MiR 182 Is Associated with Growth Migration and In ......" | 26640590 |
| hsa-miR-182-3p | colon cancer | FOXO3 | "Immunohistochemical analysis revealed that the lev ......" | 24865442 |
| hsa-miR-182-3p | lung cancer | FOXO3 | "Sp1 increased expression of miR-182 which was then ......" | 24519909 |
| hsa-miR-182-3p | melanoma | FOXO3 | "Aberrant miR 182 expression promotes melanoma meta ......" | 19188590 |
| hsa-miR-182-3p | B cell lymphoma | BCL2 | "The expression levels of B-cell lymphoma-2 Bcl-2 a ......" | 26870290 |
| hsa-miR-182-3p | prostate cancer | BCL2 | "Inhibition of proliferation and induction of autop ......" | 23936432 |
| hsa-miR-182-3p | cervical and endocervical cancer | DNMT3A | "miR 182 induces cervical cancer cell apoptosis thr ......" | 26191165 |
| hsa-miR-182-3p | ovarian cancer | DNMT3A | "Downregulation of DNMT3a expression increases miR ......" | 27748882 |
| hsa-miR-182-3p | breast cancer | MTSS1 | "Suppression of MIM by microRNA 182 activates RhoA ......" | 23474751 |
| hsa-miR-182-3p | liver cancer | MTSS1 | "MicroRNA 182 downregulates metastasis suppressor 1 ......" | 22681717 |
| hsa-miR-182-3p | liver cancer | RASA1 | "Hypoxia inducible MiR 182 promotes angiogenesis by ......" | 26126858 |
| hsa-miR-182-3p | lung squamous cell cancer | RASA1 | "Hsa mir 182 downregulates RASA1 and suppresses lun ......" | 24600991 |
| hsa-miR-182-3p | breast cancer | RECK | "In our previous results we demonstrated that miR-1 ......" | 27648365 |
| hsa-miR-182-3p | breast cancer | RECK | "Up regulation of miR 182 by β catenin in breast c ......" | 23333633 |
| hsa-miR-182-3p | head and neck cancer | TP53 | "Overexpression of TP53 mutation associated microRN ......" | 27744260 |
| hsa-miR-182-3p | melanoma | TP53 | "Initially we demonstrated that miR-182 expression ......" | 22848417 |
| hsa-miR-182-3p | liver cancer | AFP | "Serum miR-182 was positively correlated with serum ......" | 25903466 |
| hsa-miR-182-3p | prostate cancer | AR | "Androgen receptor regulated microRNA miR 182 5p pr ......" | 27109471 |
| hsa-miR-182-3p | breast cancer | BRCA1 | "miR 182 mediated downregulation of BRCA1 impacts D ......" | 21195000 |
| hsa-miR-182-3p | bladder cancer | CADM1 | "TGF β upregulates miR 182 expression to promote g ......" | 24445397 |
| hsa-miR-182-3p | breast cancer | CASP8 | "We then demonstrated that knockdown of miR-182 up- ......" | 27476169 |
| hsa-miR-182-3p | breast cancer | CBX7 | "Augmentation of CBX7 by knockdown of miR-182 expre ......" | 21375733 |
| hsa-miR-182-3p | thyroid cancer | CDC37 | "Bioinformatics analysis revealed close homolog of ......" | 24971532 |
| hsa-miR-182-3p | breast cancer | CDH1 | "Augmentation of CBX7 by knockdown of miR-182 expre ......" | 21375733 |
| hsa-miR-182-3p | lung cancer | CDH2 | "Knockdown of miR-182 inhibited lung cancer cells g ......" | 24519909 |
| hsa-miR-182-3p | liver cancer | CEBPA | "MiR 182 is up regulated and targeting Cebpa in hep ......" | 24653623 |
| hsa-miR-182-3p | thyroid cancer | CHL1 | "miR 182 targets CHL1 and controls tumor growth and ......" | 24971532 |
| hsa-miR-182-3p | lung cancer | CTTN | "A microRNA miR-182 was cloned and used to study th ......" | 21503569 |
| hsa-miR-182-3p | breast cancer | CYLD | "We then demonstrated that knockdown of miR-182 up- ......" | 27476169 |
| hsa-miR-182-3p | breast cancer | DDX5 | "We demonstrated that DDX5 regulated a subset of Mi ......" | 22086602 |
| hsa-miR-182-3p | prostate cancer | EGLN1 | "Hypoxia inducible miR 182 enhances HIF1α signalin ......" | 26205124 |
| hsa-miR-182-3p | colorectal cancer | ENTPD5 | "The inverse relation between miR-182 and the expre ......" | 25115394 |
| hsa-miR-182-3p | breast cancer | ESR1 | "Furthermore the serum levels of miR-182 in the est ......" | 24260062 |
| hsa-miR-182-3p | colorectal cancer | F2 | "miR 182 promotes cell growth and invasion by targe ......" | 25738520 |
| hsa-miR-182-3p | breast cancer | FBXW7 | "We further identified the E3 ubiquitin-protein lig ......" | 27648365 |
| hsa-miR-182-3p | colorectal cancer | FOXF2 | "miR 182 promotes cell growth and invasion by targe ......" | 25738520 |
| hsa-miR-182-3p | breast cancer | GHR | "miR-96 and miR-182 also targeted GHR providing a p ......" | 25873390 |
| hsa-miR-182-3p | prostate cancer | GNA13 | "MicroRNA 182 and microRNA 200a control G protein s ......" | 23329838 |
| hsa-miR-182-3p | prostate cancer | GNB2 | "MicroRNA 182 and microRNA 200a control G protein s ......" | 23329838 |
| hsa-miR-182-3p | acute myeloid leukemia | HDAC1 | "The gene repressors HDAC1 and HDAC2 became recruit ......" | 26858310 |
| hsa-miR-182-3p | acute myeloid leukemia | HDAC2 | "The gene repressors HDAC1 and HDAC2 became recruit ......" | 26858310 |
| hsa-miR-182-3p | acute myeloid leukemia | HDAC9 | "HDAC Inhibition Induces MicroRNA 182 which Targets ......" | 26858310 |
| hsa-miR-182-3p | prostate cancer | HIF1AN | "Hypoxia inducible miR 182 enhances HIF1α signalin ......" | 26205124 |
| hsa-miR-182-3p | kidney renal cell cancer | IGF1R | "MicroRNA 182 suppresses clear cell renal cell carc ......" | 27468875 |
| hsa-miR-182-3p | liver cancer | KLRC1 | "Our findings suggest that miR-182 may augment NK-c ......" | 27262453 |
| hsa-miR-182-3p | liver cancer | KLRK1 | "Our findings suggest that miR-182 may augment NK-c ......" | 27262453 |
| hsa-miR-182-3p | ovarian cancer | LEP | "In this report we demonstrate that crosstalk betwe ......" | 23262295 |
| hsa-miR-182-3p | melanoma | MET | "The expression of oncogene c-Met and its downstrea ......" | 22848417 |
| hsa-miR-182-3p | melanoma | MITF | "In human tissues expression of miR-182 increases w ......" | 19188590 |
| hsa-miR-182-3p | prostate cancer | NDRG1 | "Additionally we demonstrated that miR-182 could do ......" | 23874837 |
| hsa-miR-182-3p | ovarian cancer | NUP214 | "In addition to these specific effects reversing th ......" | 20081105 |
| hsa-miR-182-3p | ovarian cancer | NYS3 | "We conclude that the aberrant miR-182 expression i ......" | 27295517 |
| hsa-miR-182-3p | breast cancer | PARP1 | "Conversely antagonizing miR-182 enhances BRCA1 lev ......" | 21195000 |
| hsa-miR-182-3p | lung cancer | PDK4 | "The microRNA 182 PDK4 axis regulates lung tumorige ......" | 27641336 |
| hsa-miR-182-3p | lung cancer | PDP1 | "Here we show that microRNA-182 miR-182 suppresses ......" | 27641336 |
| hsa-miR-182-3p | breast cancer | PFN1 | "We aimed to evaluate the expression of microRNA-18 ......" | 23430586 |
| hsa-miR-182-3p | breast cancer | PGR | "The serum levels of miR-182 in the progesterone re ......" | 24260062 |
| hsa-miR-182-3p | ovarian cancer | PRDM5 | "Deletion of the PRDM5 locus may play a supportive ......" | 27295517 |
| hsa-miR-182-3p | liver cancer | PRF1 | "Finally miR-182 was reported to induce NK-cell cyt ......" | 27262453 |
| hsa-miR-182-3p | acute myeloid leukemia | RAD51 | "HDAC Inhibition Induces MicroRNA 182 which Targets ......" | 26858310 |
| hsa-miR-182-3p | lung cancer | RGS17 | "Hsa mir 182 suppresses lung tumorigenesis through ......" | 20420807 |
| hsa-miR-182-3p | breast cancer | RHOA | "Suppression of MIM by microRNA 182 activates RhoA ......" | 23474751 |
| hsa-miR-182-3p | colorectal cancer | SATB2 | "Restoring SATB2 expression could reverse the effec ......" | 24884732 |
| hsa-miR-182-3p | lung cancer | SP1 | "Sp1 mediated microRNA 182 expression regulates lun ......" | 24519909 |
| hsa-miR-182-3p | cervical and endocervical cancer | TBATA | "Spatial expression of miR-182 in cervical carcinom ......" | 23313739 |
| hsa-miR-182-3p | endometrial cancer | TCEAL7 | "The purpose of this study was to examine the role ......" | 24021963 |
| hsa-miR-182-3p | colon cancer | THBS1 | "Effects of anti miR 182 on TSP 1 expression in hum ......" | 24053448 |
| hsa-miR-182-3p | sarcoma | TIAM1 | "The Downregulation of MiR 182 Is Associated with t ......" | 25973950 |
| hsa-miR-182-3p | breast cancer | TNF | "Knockdown of miR 182 promotes apoptosis via regula ......" | 27476169 |
| hsa-miR-182-3p | breast cancer | UBE2K | "We further identified the E3 ubiquitin-protein lig ......" | 27648365 |
| hsa-miR-182-3p | gastric cancer | ZFAND4 | "MicroRNA 182 inhibits proliferation through target ......" | 25682742 |