microRNA information: hsa-miR-184
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-184 | miRbase |
| Accession: | MIMAT0000454 | miRbase |
| Precursor name: | hsa-mir-184 | miRbase |
| Precursor accession: | MI0000481 | miRbase |
| Symbol: | MIR184 | HGNC |
| RefSeq ID: | NR_029705 | GenBank |
| Sequence: | UGGACGGAGAACUGAUAAGGGU |
Reported expression in cancers: hsa-miR-184
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-184 | liver cancer | upregulation | "Our study showed that miR-184 is upregulated in HC ......" | 24558429 | |
| hsa-miR-184 | lung cancer | downregulation | "We here hypothesized that miR-184 could be down-re ......" | 27083050 | |
| hsa-miR-184 | lymphoma | deregulation | "The profiles of miRNAs in conjunctival MALT lympho ......" | 22183793 | Microarray; qPCR |
| hsa-miR-184 | ovarian cancer | downregulation | "MicroRNA 184 acts as a potential diagnostic and pr ......" | 26601424 | qPCR |
| hsa-miR-184 | prostate cancer | deregulation | "This study aimed to investigate the microRNA miRNA ......" | 19676045 | qPCR; Microarray |
| hsa-miR-184 | prostate cancer | deregulation | "Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......" | 23781281 |
Reported cancer pathway affected by hsa-miR-184
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-184 | breast cancer | cell cycle pathway | "Inhibitory effect of miR 184 on the potential of p ......" | 26464691 | Transwell assay |
| hsa-miR-184 | kidney renal cell cancer | Apoptosis pathway | "microRNA 184 functions as tumor suppressor in rena ......" | 25667660 | Flow cytometry |
| hsa-miR-184 | liver cancer | Apoptosis pathway | "miR 184 functions as an oncogenic regulator in hep ......" | 24183204 | Luciferase |
| hsa-miR-184 | liver cancer | cell cycle pathway | "Mir 184 post transcriptionally regulates SOX7 expr ......" | 24558429 | |
| hsa-miR-184 | ovarian cancer | Apoptosis pathway | "MicroRNA 184 acts as a potential diagnostic and pr ......" | 26601424 |
Reported cancer prognosis affected by hsa-miR-184
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-184 | breast cancer | metastasis; differentiation; progression | "MicroRNA profiling of the pubertal mouse mammary g ......" | 26070602 | Luciferase |
| hsa-miR-184 | kidney renal cell cancer | tumorigenesis | "With the advent of second-generation sequencing th ......" | 21253009 | |
| hsa-miR-184 | kidney renal cell cancer | metastasis; malignant trasformation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
| hsa-miR-184 | kidney renal cell cancer | cell migration | "microRNA 184 functions as tumor suppressor in rena ......" | 25667660 | Flow cytometry |
| hsa-miR-184 | liver cancer | progression | "Mir 184 post transcriptionally regulates SOX7 expr ......" | 24558429 | |
| hsa-miR-184 | lung cancer | drug resistance; poor survival; progression | "Reduction of microRNA 184 by E6 oncoprotein confer ......" | 27083050 | MTT assay; Luciferase |
| hsa-miR-184 | lung squamous cell cancer | poor survival; worse prognosis | "MicroRNA 184 Deregulated by the MicroRNA 21 Promot ......" | 25990966 | |
| hsa-miR-184 | lung squamous cell cancer | metastasis; worse prognosis | "Tumor invasion and metastasis regulated by microRN ......" | 26587830 | |
| hsa-miR-184 | lung squamous cell cancer | worse prognosis | "In the present study we investigated whether singl ......" | 26632718 | |
| hsa-miR-184 | ovarian cancer | progression; tumorigenesis; staging; poor survival; worse prognosis | "MicroRNA 184 acts as a potential diagnostic and pr ......" | 26601424 | |
| hsa-miR-184 | sarcoma | metastasis; differentiation | "Recent studies showed that microRNA184 miR-184 is ......" | 26600482 | Transwell assay |
Reported gene related to hsa-miR-184
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-184 | kidney renal cell cancer | MYC | "In the present study we identified that miR-184 co ......" | 27431728 |
| hsa-miR-184 | lung cancer | MYC | "MicroRNA-184 suppresses cell growth and survival v ......" | 27083050 |
| hsa-miR-184 | lung squamous cell cancer | MYC | "Boyden chamber assay was used to assess whether mi ......" | 25990966 |
| hsa-miR-184 | lung squamous cell cancer | MYC | "Mechanistically CCDC19 functions as a potential tu ......" | 24976536 |
| hsa-miR-184 | lung cancer | CDC25A | "We recently reported that miR-184 promotes tumor p ......" | 27083050 |
| hsa-miR-184 | lung squamous cell cancer | CDC25A | "Wild-type or mutant CDC25A promoters were construc ......" | 25990966 |
| hsa-miR-184 | gastric cancer | TNFAIP2 | "The miR 184 binding site rs8126 T>C polymorphism i ......" | 23724109 |
| hsa-miR-184 | head and neck cancer | TNFAIP2 | "A functional variant at the miR 184 binding site i ......" | 21934093 |
| hsa-miR-184 | lung cancer | BCL2 | "Reduction of microRNA 184 by E6 oncoprotein confer ......" | 27083050 |
| hsa-miR-184 | lung squamous cell cancer | CCDC19 | "Mechanistically CCDC19 functions as a potential tu ......" | 24976536 |
| hsa-miR-184 | liver cancer | INPPL1 | "We found that miR-184 expression was significantly ......" | 24183204 |
| hsa-miR-184 | kidney renal cell cancer | PKM | "Further analysis by computer bioinformatics reveal ......" | 27431728 |
| hsa-miR-184 | lung squamous cell cancer | SCLC1 | "We showed that miR-184 significantly attenuated th ......" | 26587830 |
| hsa-miR-184 | liver cancer | SOX7 | "Mir 184 post transcriptionally regulates SOX7 expr ......" | 24558429 |
| hsa-miR-184 | lung cancer | TP53 | "Luciferase reporter assay and real- time PCR analy ......" | 27083050 |