microRNA information: hsa-miR-185-5p

SectionIDlink
Mature name: hsa-miR-185-5pmiRbase
Accession: MIMAT0000455miRbase
Precursor name: hsa-mir-185 miRbase
Precursor accession: MI0000482miRbase
Symbol: MIR185HGNC
RefSeq ID: NR_029706GenBank
Sequence: UGGAGAGAAAGGCAGUUCCUGA



Reported expression in cancers: hsa-miR-185-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-185-5p

breast cancerdownregulation"In this study we found that miR-185 was strongly d ......"25319390
hsa-miR-185-5p

breast cancerdownregulation"miR-185 has been demonstrated to be involved in th ......"25371748qPCR
hsa-miR-185-5p

colorectal cancerderegulation"miR 185 and miR 133b deregulation is associated wi ......"21573504qPCR
hsa-miR-185-5p

endometrial cancerderegulation"In endometrial cancer cells expression levels of m ......"26535032
hsa-miR-185-5p

esophageal cancerdownregulation"To explore the role and mechanism of microRNA185 m ......"24025511qPCR
hsa-miR-185-5p

gastric cancerderegulation"The results from the miRNA microarray analysis wer ......"21475928qPCR; Microarray
hsa-miR-185-5p

gastric cancerdownregulation"miR 185 is an independent prognosis factor and sup ......"24352663
hsa-miR-185-5p

gastric cancerupregulation"A total of 33 miRNAs were identified through the i ......"26059512Reverse transcription PCR; qPCR
hsa-miR-185-5p

glioblastomaderegulation"Hypoxic signature of microRNAs in glioblastoma: in ......"25129238RNA-Seq
hsa-miR-185-5p

liver cancerupregulation"Metastasis related miR 185 is a potential prognost ......"23648054Microarray
hsa-miR-185-5p

lung squamous cell cancerdownregulation"Increasing evidence has shown that microRNAs play ......"26617940
hsa-miR-185-5p

prostate cancerdownregulation"In this study miR-185 was found to be down-regulat ......"23417242
hsa-miR-185-5p

thyroid cancerdownregulation"Interestingly miR-152-3p miR-185-5p and miR-574-3p ......"27586203



Reported cancer pathway affected by hsa-miR-185-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-185-5p

breast cancerApoptosis pathway"MicroRNA 185 inhibits proliferation by targeting c ......"25371748Flow cytometry; MTT assay; Western blot; Luciferase
hsa-miR-185-5p

gastric cancerApoptosis pathway"MicroRNA 185 regulates chemotherapeutic sensitivit ......"24763054
hsa-miR-185-5p

gastric cancercell cycle pathway; Apoptosis pathway"TRIM29 functions as an oncogene in gastric cancer ......"26191199RNAi; Colony formation; Luciferase
hsa-miR-185-5p

kidney renal cell cancerApoptosis pathway"MicroRNA 185 inhibits cell proliferation and induc ......"25700976Colony formation; Cell Proliferation Assay; Luciferase
hsa-miR-185-5p

liver cancerEpithelial mesenchymal transition pathway"MicroRNA 185 inhibits cell proliferation and epith ......"27212161Wound Healing Assay; Western blot; Luciferase
hsa-miR-185-5p

lung squamous cell cancercell cycle pathway"MiR 107 and MiR 185 can induce cell cycle arrest i ......"19688090
hsa-miR-185-5p

ovarian cancerApoptosis pathway"MiR 152 and miR 185 co contribute to ovarian cance ......"23318422
hsa-miR-185-5p

prostate cancercell cycle pathway"MicroRNA 185 suppresses proliferation invasion mig ......"23417242Luciferase
hsa-miR-185-5p

prostate cancerApoptosis pathway"MicroRNA 185 and 342 inhibit tumorigenicity and in ......"23951060



Reported cancer prognosis affected by hsa-miR-185-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-185-5p

breast cancermetastasis; worse prognosis"The expression of miRNAs in patients with primary ......"24846313
hsa-miR-185-5p

breast cancerstaging; metastasis; poor survival"miR 185 suppresses tumor proliferation by directly ......"25319390
hsa-miR-185-5p

breast cancermetastasis"RKIP suppresses the proliferation and metastasis o ......"27651238
hsa-miR-185-5p

colon cancermetastasis"MicroRNA 185 suppresses growth and invasion of col ......"25216407Western blot; MTT assay; Transwell assay
hsa-miR-185-5p

colon cancerstaging"We assessed by qRT-PCR expression of 754 microRNAs ......"27485175
hsa-miR-185-5p

colorectal cancermetastasis; poor survival"miR 185 and miR 133b deregulation is associated wi ......"21573504
hsa-miR-185-5p

colorectal cancermetastasis; worse prognosis"STIM1 a direct target of microRNA 185 promotes tum ......"25531324
hsa-miR-185-5p

endometrial cancermetastasis; tumorigenesis"In endometrial cancer cells expression levels of m ......"26535032
hsa-miR-185-5p

esophageal cancercell migration; metastasis"Plasma miR 185 is decreased in patients with esoph ......"26316588Luciferase
hsa-miR-185-5p

gastric cancermetastasis; worse prognosis; staging; progression; poor survival"miR 185 is an independent prognosis factor and sup ......"24352663
hsa-miR-185-5p

gastric cancerstaging"A total of 33 miRNAs were identified through the i ......"26059512
hsa-miR-185-5p

kidney renal cell cancerstaging; tumor size"MicroRNA 185 inhibits cell proliferation and induc ......"25700976Colony formation; Cell Proliferation Assay; Luciferase
hsa-miR-185-5p

liver cancerstaging; metastasis; recurrence; differentiation; tumor size; poor survival"Metastasis related miR 185 is a potential prognost ......"23648054
hsa-miR-185-5p

liver cancermetastasis; progression"MicroRNA 185 inhibits cell proliferation and epith ......"27212161Wound Healing Assay; Western blot; Luciferase
hsa-miR-185-5p

lung cancermalignant trasformation"Diagnostic Value of Circulating Extracellular miR ......"24851110
hsa-miR-185-5p

lung squamous cell cancerprogression; motility"MiR 185 acts as a tumor suppressor by targeting AK ......"26617940
hsa-miR-185-5p

ovarian cancerdrug resistance"MiR 152 and miR 185 co contribute to ovarian cance ......"23318422
hsa-miR-185-5p

prostate cancerdrug resistance"MiR 185 attenuates androgen receptor function in p ......"26940039Luciferase; Western blot



Reported gene related to hsa-miR-185-5p

miRNAcancergenereportingPUBMED
hsa-miR-185-5p

prostate cancerAR"MicroRNA 185 downregulates androgen receptor expre ......"25673182
hsa-miR-185-5p

prostate cancerAR"MMTV-Fluc reporter assays revealed that miR-185 ca ......"26940039
hsa-miR-185-5p

prostate cancerAR"MicroRNA 185 suppresses proliferation invasion mig ......"23417242
hsa-miR-185-5p

esophageal cancerCDH1"After transfection of miR-185 inhibitor into KYSE3 ......"24025511
hsa-miR-185-5p

liver cancerCDH1"We also found that ectopic expression of miR-185 r ......"27212161
hsa-miR-185-5p

liver cancerDNMT1"miR-185 overexpression inhibited DNMT1 3' untransl ......"24911372
hsa-miR-185-5p

ovarian cancerDNMT1"MiR 152 and miR 185 co contribute to ovarian cance ......"23318422
hsa-miR-185-5p

liver cancerAFP"There was no direct relationship between miR-185 a ......"23648054
hsa-miR-185-5p

prostate cancerAGO2"Putative miRNA response element MRE of miR-185 in ......"26940039
hsa-miR-185-5p

lung squamous cell cancerAKT1"MiR 185 acts as a tumor suppressor by targeting AK ......"26617940
hsa-miR-185-5p

gastric cancerARC"In elucidating the molecular mechanism by which mi ......"24763054
hsa-miR-185-5p

prostate cancerBRD8"Putative miRNA response element MRE of miR-185 in ......"26940039
hsa-miR-185-5p

colorectal cancerCCND1"Mechanically we demonstrated that miR-185 could su ......"27453420
hsa-miR-185-5p

prostate cancerCDC6"CDC6 one target of AR and an important regulatory ......"23417242
hsa-miR-185-5p

lung squamous cell cancerCDK6"Using miRNA-target prediction analyses and the arr ......"19688090
hsa-miR-185-5p

gastric cancerFRTS1"Moreover miR-185 might independently predict OS an ......"24352663
hsa-miR-185-5p

breast cancerHMGA2"RKIP suppresses the proliferation and metastasis o ......"27651238
hsa-miR-185-5p

breast cancerMET"MicroRNA 185 inhibits proliferation by targeting c ......"25371748
hsa-miR-185-5p

colorectal cancerMYC"Mechanically we demonstrated that miR-185 could su ......"27453420
hsa-miR-185-5p

liver cancerNTSR1"We classified 95 patients with early stage HCC int ......"23648054
hsa-miR-185-5p

breast cancerPEBP1"RKIP suppresses the proliferation and metastasis o ......"27651238
hsa-miR-185-5p

liver cancerPTEN"These results provide novel evidence that miR-185 ......"24911372
hsa-miR-185-5p

esophageal cancerRTCA"The xCELLigence RTCA MP system and Transwell assay ......"24025511
hsa-miR-185-5p

gastric cancerRUNX3"Finally we found that RUNX3 Runt-related transcrip ......"24763054
hsa-miR-185-5p

esophageal cancerSIX1"After transfection of miR-185 inhibitor into KYSE3 ......"24025511
hsa-miR-185-5p

liver cancerSIX2"MicroRNA 185 inhibits cell proliferation and epith ......"27212161
hsa-miR-185-5p

colorectal cancerSTIM1"STIM1 a direct target of microRNA 185 promotes tum ......"25531324
hsa-miR-185-5p

gastric cancerTRIM29"TRIM29 functions as an oncogene in gastric cancer ......"26191199
hsa-miR-185-5p

kidney renal cell cancerVEGFA"MicroRNA 185 inhibits cell proliferation and induc ......"25700976
hsa-miR-185-5p

kidney renal cell cancerVHL"We used 786O A498 VHL inactivated and Caki-1 VHL i ......"25700976
hsa-miR-185-5p

liver cancerVIM"We also found that ectopic expression of miR-185 r ......"27212161



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-185-5p
AR
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.584; TCGA BRCA -1.158; TCGA COAD -1.027; TCGA ESCA -1.126; TCGA HNSC -0.692; TCGA LIHC -0.56; TCGA LUAD -0.665; TCGA LUSC -0.802; TCGA PAAD -0.441; TCGA SARC -1.148; TCGA STAD -1.374; TCGA UCEC -0.721
hsa-miR-185-5p
ASH1L
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.146; TCGA BRCA -0.341; TCGA COAD -0.177; TCGA KIRC -0.231; TCGA KIRP -0.206; TCGA LUAD -0.17; TCGA LUSC -0.106; TCGA SARC -0.313; TCGA STAD -0.127; TCGA UCEC -0.133
hsa-miR-185-5p
CACHD1
9 cancers: BLCA; BRCA; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.473; TCGA BRCA -0.553; TCGA KIRC -0.34; TCGA LUAD -0.224; TCGA PAAD -0.231; TCGA PRAD -0.226; TCGA SARC -0.188; TCGA STAD -0.198; TCGA UCEC -0.229
hsa-miR-185-5p
CORO2B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; OV; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.54; TCGA BRCA -0.45; TCGA CESC -0.405; TCGA COAD -0.746; TCGA ESCA -0.599; TCGA KIRC -0.726; TCGA KIRP -0.597; TCGA LUAD -0.437; TCGA LUSC -0.578; TCGA OV -0.23; TCGA STAD -0.864; TCGA UCEC -0.813
hsa-miR-185-5p
DENND2A
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.366; TCGA BRCA -0.125; TCGA CESC -0.611; TCGA ESCA -0.439; TCGA KIRC -0.43; TCGA KIRP -0.547; TCGA LUAD -0.282; TCGA LUSC -0.569; TCGA STAD -0.574; TCGA UCEC -0.582
hsa-miR-185-5p
EEF1A1
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.173; TCGA BRCA -0.196; TCGA CESC -0.085; TCGA HNSC -0.164; TCGA KIRC -0.087; TCGA LGG -0.193; TCGA LUAD -0.158; TCGA LUSC -0.089; TCGA OV -0.127; TCGA PRAD -0.175; TCGA SARC -0.087; TCGA THCA -0.099; TCGA STAD -0.176; TCGA UCEC -0.262
hsa-miR-185-5p
MATR3
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; OV; SARC
miRNAWalker2 validate
TCGA BLCA -0.08; TCGA BRCA -0.167; TCGA KIRC -0.084; TCGA KIRP -0.092; TCGA LGG -0.056; TCGA LIHC -0.079; TCGA LUAD -0.117; TCGA OV -0.075; TCGA SARC -0.121
hsa-miR-185-5p
NTRK3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; mirMAP
TCGA BLCA -1.075; TCGA BRCA -0.907; TCGA CESC -0.685; TCGA COAD -1.342; TCGA ESCA -1.513; TCGA HNSC -0.762; TCGA KIRC -0.588; TCGA KIRP -0.358; TCGA LGG -0.086; TCGA LUAD -0.449; TCGA LUSC -0.612; TCGA PRAD -0.439; TCGA SARC -0.886; TCGA THCA -0.771; TCGA STAD -1.376; TCGA UCEC -0.884
hsa-miR-185-5p
SMG6
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.105; TCGA BRCA -0.119; TCGA CESC -0.098; TCGA ESCA -0.175; TCGA KIRC -0.121; TCGA KIRP -0.14; TCGA LIHC -0.088; TCGA LUAD -0.131; TCGA PRAD -0.109; TCGA THCA -0.098; TCGA STAD -0.168; TCGA UCEC -0.205
hsa-miR-185-5p
WNT5B
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.606; TCGA CESC -0.269; TCGA COAD -0.64; TCGA ESCA -0.478; TCGA HNSC -0.304; TCGA LIHC -0.637; TCGA LUSC -0.469; TCGA PRAD -0.403; TCGA THCA -0.776; TCGA STAD -0.402; TCGA UCEC -0.555
hsa-miR-185-5p
LIX1L
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.378; TCGA BRCA -0.091; TCGA COAD -0.403; TCGA ESCA -0.374; TCGA LGG -0.223; TCGA LUAD -0.121; TCGA LUSC -0.345; TCGA SARC -0.114; TCGA STAD -0.568; TCGA UCEC -0.317
hsa-miR-185-5p
PCP4
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -2.351; TCGA CESC -1.801; TCGA COAD -2.147; TCGA ESCA -2.414; TCGA KIRC -1.657; TCGA LUSC -0.715; TCGA OV -0.68; TCGA PRAD -0.755; TCGA SARC -2.495; TCGA STAD -1.67; TCGA UCEC -0.731
hsa-miR-185-5p
PCYT1B
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.495; TCGA BRCA -0.567; TCGA CESC -0.405; TCGA COAD -0.912; TCGA KIRC -0.26; TCGA KIRP -0.497; TCGA LUAD -0.391; TCGA OV -0.235; TCGA PRAD -0.464; TCGA SARC -1.29; TCGA STAD -1.117; TCGA UCEC -0.521
hsa-miR-185-5p
MXRA5
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; UCEC
MirTarget
TCGA BLCA -0.445; TCGA BRCA -0.272; TCGA COAD -0.357; TCGA KIRC -0.681; TCGA KIRP -0.336; TCGA LIHC -0.441; TCGA LUSC -0.832; TCGA PAAD -0.507; TCGA THCA -0.361; TCGA UCEC -0.137
hsa-miR-185-5p
FOXJ2
9 cancers: BLCA; BRCA; KIRP; LGG; LIHC; LUAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.237; TCGA BRCA -0.093; TCGA KIRP -0.102; TCGA LGG -0.09; TCGA LIHC -0.096; TCGA LUAD -0.096; TCGA SARC -0.167; TCGA STAD -0.217; TCGA UCEC -0.21
hsa-miR-185-5p
EIF4B
10 cancers: BLCA; BRCA; HNSC; LGG; LUAD; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.164; TCGA BRCA -0.26; TCGA HNSC -0.077; TCGA LGG -0.148; TCGA LUAD -0.156; TCGA OV -0.141; TCGA PRAD -0.107; TCGA SARC -0.155; TCGA STAD -0.076; TCGA UCEC -0.16
hsa-miR-185-5p
VAT1L
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.426; TCGA BRCA -0.17; TCGA COAD -0.72; TCGA ESCA -0.407; TCGA KIRC -1.238; TCGA KIRP -0.921; TCGA LGG -0.193; TCGA LIHC -0.371; TCGA LUSC -0.471; TCGA PRAD -0.274; TCGA THCA -0.818; TCGA STAD -0.763; TCGA UCEC -0.498
hsa-miR-185-5p
LRRC32
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.581; TCGA BRCA -0.207; TCGA CESC -0.381; TCGA COAD -0.412; TCGA ESCA -0.37; TCGA KIRC -0.148; TCGA LIHC -0.319; TCGA LUAD -0.25; TCGA LUSC -0.452; TCGA THCA -0.166; TCGA STAD -0.209; TCGA UCEC -0.448
hsa-miR-185-5p
PNMA2
9 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.654; TCGA BRCA -0.545; TCGA CESC -0.406; TCGA ESCA -0.776; TCGA LUAD -0.482; TCGA LUSC -0.552; TCGA SARC -0.656; TCGA THCA -0.544; TCGA UCEC -0.335
hsa-miR-185-5p
MEF2D
9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.233; TCGA COAD -0.222; TCGA ESCA -0.202; TCGA LUAD -0.108; TCGA LUSC -0.174; TCGA PRAD -0.055; TCGA SARC -0.2; TCGA STAD -0.335; TCGA UCEC -0.24
hsa-miR-185-5p
KLHL29
9 cancers: BLCA; BRCA; CESC; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.257; TCGA BRCA -0.413; TCGA CESC -0.238; TCGA LUAD -0.211; TCGA PRAD -0.183; TCGA SARC -0.181; TCGA THCA -0.287; TCGA STAD -0.478; TCGA UCEC -0.221
hsa-miR-185-5p
HDX
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.271; TCGA BRCA -0.365; TCGA COAD -0.456; TCGA ESCA -0.441; TCGA HNSC -0.256; TCGA KIRC -0.103; TCGA LGG -0.078; TCGA LIHC -0.475; TCGA LUAD -0.178; TCGA LUSC -0.465; TCGA SARC -0.264; TCGA STAD -0.756; TCGA UCEC -0.312
hsa-miR-185-5p
ABCA3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.411; TCGA BRCA -0.115; TCGA COAD -0.437; TCGA ESCA -0.826; TCGA HNSC -0.656; TCGA LGG -0.058; TCGA LUAD -0.516; TCGA SARC -0.289; TCGA STAD -0.566; TCGA UCEC -0.178
hsa-miR-185-5p
CSDC2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.315; TCGA BRCA -0.436; TCGA CESC -1.186; TCGA COAD -1.101; TCGA ESCA -1.052; TCGA HNSC -0.472; TCGA KIRC -0.765; TCGA LGG -0.174; TCGA LIHC -0.418; TCGA LUAD -0.236; TCGA LUSC -0.671; TCGA PRAD -0.184; TCGA SARC -1.439; TCGA THCA -0.836; TCGA STAD -0.948; TCGA UCEC -1.139
hsa-miR-185-5p
KIAA1644
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.307; TCGA BRCA -0.169; TCGA CESC -0.3; TCGA COAD -1.007; TCGA ESCA -0.54; TCGA LUAD -0.496; TCGA LUSC -0.791; TCGA PRAD -0.449; TCGA THCA -0.785; TCGA STAD -1.515; TCGA UCEC -1.124
hsa-miR-185-5p
IGF1R
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; OV; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.21; TCGA BRCA -0.548; TCGA COAD -0.292; TCGA KIRC -0.186; TCGA KIRP -0.176; TCGA LGG -0.142; TCGA OV -0.192; TCGA PRAD -0.165; TCGA SARC -0.303; TCGA THCA -0.245; TCGA UCEC -0.322
hsa-miR-185-5p
CCND2
9 cancers: BLCA; BRCA; ESCA; LGG; LUAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.596; TCGA BRCA -0.252; TCGA ESCA -0.388; TCGA LGG -0.183; TCGA LUAD -0.239; TCGA PRAD -0.193; TCGA THCA -0.381; TCGA STAD -0.504; TCGA UCEC -0.572
hsa-miR-185-5p
LTBP2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.268; TCGA BRCA -0.478; TCGA CESC -0.238; TCGA COAD -0.43; TCGA ESCA -0.455; TCGA LUAD -0.471; TCGA LUSC -0.525; TCGA THCA -0.355; TCGA STAD -0.27; TCGA UCEC -0.452
hsa-miR-185-5p
ITGB3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.694; TCGA BRCA -0.305; TCGA COAD -0.598; TCGA ESCA -0.7; TCGA KIRC -0.381; TCGA KIRP -0.617; TCGA LUAD -0.353; TCGA LUSC -0.654; TCGA STAD -0.505; TCGA UCEC -0.378
hsa-miR-185-5p
GLIS3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.329; TCGA BRCA -0.276; TCGA CESC -0.403; TCGA COAD -0.373; TCGA ESCA -0.347; TCGA KIRC -0.337; TCGA KIRP -0.393; TCGA LUSC -0.488; TCGA STAD -0.268; TCGA UCEC -0.146
hsa-miR-185-5p
UBE2QL1
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.483; TCGA COAD -0.672; TCGA ESCA -0.667; TCGA HNSC -0.61; TCGA KIRC -0.626; TCGA KIRP -0.342; TCGA LUSC -1.028; TCGA PRAD -0.36; TCGA SARC -0.986; TCGA THCA -0.53; TCGA STAD -1.03; TCGA UCEC -0.409
hsa-miR-185-5p
ITPRIP
9 cancers: BLCA; ESCA; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.355; TCGA ESCA -0.308; TCGA LIHC -0.215; TCGA LUAD -0.194; TCGA LUSC -0.239; TCGA PRAD -0.108; TCGA THCA -0.1; TCGA STAD -0.169; TCGA UCEC -0.267
hsa-miR-185-5p
LGR6
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUSC; OV; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.758; TCGA BRCA -0.735; TCGA COAD -0.536; TCGA KIRC -0.433; TCGA KIRP -0.462; TCGA LUSC -0.431; TCGA OV -0.342; TCGA PAAD -0.686; TCGA PRAD -0.656; TCGA SARC -0.76; TCGA THCA -0.596
hsa-miR-185-5p
SUCLG2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC
MirTarget
TCGA BLCA -0.104; TCGA BRCA -0.137; TCGA CESC -0.136; TCGA ESCA -0.237; TCGA HNSC -0.214; TCGA KIRC -0.265; TCGA LIHC -0.336; TCGA LUAD -0.15; TCGA LUSC -0.104; TCGA PAAD -0.221; TCGA SARC -0.062
hsa-miR-185-5p
CDC42EP3
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.297; TCGA BRCA -0.201; TCGA COAD -0.437; TCGA ESCA -0.445; TCGA KIRC -0.327; TCGA KIRP -0.341; TCGA LIHC -0.231; TCGA LUSC -0.25; TCGA PRAD -0.222; TCGA SARC -0.688; TCGA THCA -0.481; TCGA STAD -0.677; TCGA UCEC -0.442
hsa-miR-185-5p
SV2B
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.721; TCGA BRCA -0.294; TCGA COAD -1.039; TCGA ESCA -1.351; TCGA HNSC -0.581; TCGA LUAD -0.341; TCGA PRAD -0.298; TCGA STAD -0.777; TCGA UCEC -0.537
hsa-miR-185-5p
LRRFIP1
10 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.176; TCGA BRCA -0.171; TCGA KIRC -0.163; TCGA KIRP -0.17; TCGA LIHC -0.193; TCGA LUAD -0.141; TCGA LUSC -0.153; TCGA PRAD -0.109; TCGA SARC -0.179; TCGA STAD -0.111
hsa-miR-185-5p
FRY
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.32; TCGA BRCA -0.514; TCGA CESC -0.364; TCGA COAD -0.605; TCGA ESCA -0.8; TCGA HNSC -0.428; TCGA KIRC -0.523; TCGA KIRP -0.324; TCGA LGG -0.129; TCGA LIHC -0.215; TCGA LUAD -0.365; TCGA PAAD -0.206; TCGA SARC -0.7; TCGA STAD -0.628; TCGA UCEC -0.512
hsa-miR-185-5p
CYP4V2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; UCEC
MirTarget
TCGA BLCA -0.193; TCGA BRCA -0.21; TCGA CESC -0.193; TCGA ESCA -0.351; TCGA HNSC -0.247; TCGA LIHC -0.584; TCGA LUAD -0.161; TCGA LUSC -0.28; TCGA SARC -0.146; TCGA UCEC -0.17
hsa-miR-185-5p
UNC5C
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.909; TCGA BRCA -0.73; TCGA COAD -0.35; TCGA ESCA -0.553; TCGA KIRC -0.562; TCGA KIRP -0.426; TCGA LUAD -0.477; TCGA LUSC -1.006; TCGA SARC -0.683; TCGA STAD -0.271; TCGA UCEC -0.508
hsa-miR-185-5p
ASTN1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.281; TCGA BRCA -0.776; TCGA CESC -0.841; TCGA COAD -1.392; TCGA ESCA -1.517; TCGA HNSC -0.549; TCGA KIRC -0.546; TCGA LGG -0.089; TCGA LIHC -0.458; TCGA LUAD -0.412; TCGA OV -0.466; TCGA PRAD -0.33; TCGA SARC -1.254; TCGA STAD -1.764; TCGA UCEC -0.995
hsa-miR-185-5p
GJA5
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.51; TCGA BRCA -0.119; TCGA CESC -0.298; TCGA COAD -0.411; TCGA KIRC -0.282; TCGA LUAD -0.188; TCGA LUSC -0.646; TCGA SARC -0.307; TCGA THCA -0.253; TCGA UCEC -0.36
hsa-miR-185-5p
ZNF662
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.398; TCGA BRCA -0.58; TCGA CESC -0.625; TCGA COAD -0.639; TCGA ESCA -0.964; TCGA HNSC -0.753; TCGA KIRC -0.395; TCGA KIRP -0.359; TCGA LIHC -0.334; TCGA LUAD -0.271; TCGA LUSC -0.483; TCGA PRAD -0.417; TCGA SARC -0.528; TCGA THCA -0.246; TCGA STAD -1.157; TCGA UCEC -0.539
hsa-miR-185-5p
RORA
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.423; TCGA BRCA -0.308; TCGA COAD -0.554; TCGA ESCA -0.511; TCGA HNSC -0.237; TCGA KIRP -0.249; TCGA LIHC -0.432; TCGA LUAD -0.269; TCGA STAD -0.503; TCGA UCEC -0.286
hsa-miR-185-5p
STAC2
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.228; TCGA BRCA -0.689; TCGA ESCA -0.648; TCGA HNSC -0.88; TCGA KIRC -1.701; TCGA KIRP -0.55; TCGA LUSC -0.348; TCGA PRAD -0.492; TCGA SARC -1.062; TCGA THCA -0.724; TCGA UCEC -0.392
hsa-miR-185-5p
GJA1
10 cancers: BLCA; BRCA; COAD; KIRP; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.208; TCGA BRCA -0.397; TCGA COAD -0.362; TCGA KIRP -0.19; TCGA LUAD -0.368; TCGA PAAD -0.255; TCGA PRAD -0.256; TCGA THCA -0.302; TCGA STAD -0.534; TCGA UCEC -0.194
hsa-miR-185-5p
SOX5
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.734; TCGA BRCA -0.446; TCGA CESC -0.351; TCGA COAD -0.695; TCGA KIRC -0.482; TCGA LUAD -0.349; TCGA SARC -0.523; TCGA STAD -0.831; TCGA UCEC -0.282
hsa-miR-185-5p
EDA2R
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.422; TCGA BRCA -0.592; TCGA COAD -0.52; TCGA ESCA -0.523; TCGA HNSC -0.423; TCGA LIHC -0.425; TCGA LUAD -0.649; TCGA LUSC -0.41; TCGA PRAD -0.228; TCGA SARC -0.543; TCGA THCA -0.203; TCGA STAD -0.574; TCGA UCEC -0.668
hsa-miR-185-5p
PROX1
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; UCEC
MirTarget
TCGA BLCA -0.371; TCGA BRCA -0.607; TCGA COAD -0.335; TCGA KIRC -1.221; TCGA KIRP -0.708; TCGA LIHC -0.345; TCGA LUAD -0.731; TCGA LUSC -0.605; TCGA UCEC -0.734
hsa-miR-185-5p
TBC1D5
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; SARC; UCEC
MirTarget
TCGA BLCA -0.067; TCGA BRCA -0.183; TCGA COAD -0.115; TCGA KIRC -0.209; TCGA KIRP -0.137; TCGA LGG -0.062; TCGA LUAD -0.14; TCGA SARC -0.061; TCGA UCEC -0.103
hsa-miR-185-5p
PCDHAC2
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.426; TCGA BRCA -0.195; TCGA ESCA -0.738; TCGA HNSC -0.411; TCGA LIHC -0.471; TCGA LUSC -0.481; TCGA SARC -0.372; TCGA THCA -0.611; TCGA STAD -0.684; TCGA UCEC -0.285
hsa-miR-185-5p
IGFBP5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.875; TCGA BRCA -0.174; TCGA CESC -0.626; TCGA COAD -0.67; TCGA ESCA -0.832; TCGA KIRC -0.529; TCGA KIRP -0.401; TCGA LIHC -0.349; TCGA LUAD -0.423; TCGA LUSC -0.347; TCGA SARC -0.41; TCGA THCA -1.088; TCGA STAD -0.804; TCGA UCEC -0.576
hsa-miR-185-5p
SORT1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; STAD
MirTarget
TCGA BLCA -0.151; TCGA BRCA -0.068; TCGA CESC -0.176; TCGA ESCA -0.414; TCGA HNSC -0.341; TCGA KIRC -0.431; TCGA LUAD -0.143; TCGA LUSC -0.206; TCGA SARC -0.425; TCGA STAD -0.147
hsa-miR-185-5p
ATXN1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.455; TCGA BRCA -0.22; TCGA COAD -0.276; TCGA ESCA -0.177; TCGA KIRP -0.117; TCGA LUAD -0.15; TCGA LUSC -0.122; TCGA SARC -0.168; TCGA STAD -0.442; TCGA UCEC -0.275
hsa-miR-185-5p
TCF21
14 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.995; TCGA CESC -0.714; TCGA COAD -0.744; TCGA ESCA -0.934; TCGA KIRC -1.142; TCGA KIRP -0.706; TCGA LIHC -0.704; TCGA LUAD -0.492; TCGA LUSC -0.608; TCGA PAAD -0.521; TCGA PRAD -0.296; TCGA SARC -0.456; TCGA STAD -0.841; TCGA UCEC -0.93
hsa-miR-185-5p
CADM3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.507; TCGA BRCA -0.376; TCGA CESC -0.52; TCGA COAD -1.507; TCGA ESCA -2.456; TCGA HNSC -0.418; TCGA LUAD -0.293; TCGA LUSC -0.72; TCGA THCA -1.018; TCGA STAD -2.007; TCGA UCEC -0.747
hsa-miR-185-5p
CCDC102A
9 cancers: BLCA; COAD; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.441; TCGA COAD -0.236; TCGA LIHC -0.179; TCGA OV -0.123; TCGA PRAD -0.154; TCGA SARC -0.444; TCGA THCA -0.146; TCGA STAD -0.429; TCGA UCEC -0.234
hsa-miR-185-5p
FNDC5
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.178; TCGA BRCA -0.168; TCGA COAD -0.489; TCGA ESCA -1.265; TCGA HNSC -0.712; TCGA KIRC -0.478; TCGA LIHC -1.078; TCGA PRAD -0.151; TCGA STAD -1.438; TCGA UCEC -0.36
hsa-miR-185-5p
MLLT3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; SARC; STAD
MirTarget
TCGA BLCA -0.269; TCGA BRCA -0.351; TCGA CESC -0.315; TCGA COAD -0.189; TCGA ESCA -0.311; TCGA HNSC -0.316; TCGA KIRP -0.189; TCGA LGG -0.126; TCGA SARC -0.151; TCGA STAD -0.168
hsa-miR-185-5p
PCDHA10
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUSC; UCEC
MirTarget
TCGA BLCA -0.377; TCGA BRCA -0.604; TCGA CESC -1.091; TCGA COAD -0.571; TCGA ESCA -1.024; TCGA KIRC -0.512; TCGA LIHC -0.656; TCGA LUSC -0.514; TCGA UCEC -0.893
hsa-miR-185-5p
TPM2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.913; TCGA CESC -0.558; TCGA COAD -0.793; TCGA ESCA -0.905; TCGA HNSC -0.49; TCGA LUSC -0.385; TCGA PRAD -0.557; TCGA SARC -1.011; TCGA THCA -0.402; TCGA STAD -1.54; TCGA UCEC -0.399
hsa-miR-185-5p
HOOK3
11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.089; TCGA BRCA -0.117; TCGA COAD -0.188; TCGA ESCA -0.211; TCGA KIRP -0.163; TCGA LGG -0.078; TCGA LUAD -0.131; TCGA SARC -0.106; TCGA THCA -0.095; TCGA STAD -0.196; TCGA UCEC -0.133
hsa-miR-185-5p
SNAP25
10 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.522; TCGA COAD -1.383; TCGA ESCA -0.488; TCGA LUAD -0.239; TCGA LUSC -0.569; TCGA PRAD -0.286; TCGA SARC -1.089; TCGA THCA -1.039; TCGA STAD -1.69; TCGA UCEC -0.577
hsa-miR-185-5p
FAIM2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.181; TCGA BRCA -0.344; TCGA CESC -0.637; TCGA ESCA -0.702; TCGA HNSC -0.718; TCGA KIRC -0.332; TCGA LUAD -0.644; TCGA LUSC -0.534; TCGA PRAD -0.353; TCGA SARC -0.351; TCGA THCA -1.08; TCGA STAD -0.905; TCGA UCEC -0.45
hsa-miR-185-5p
NOTCH2
10 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.205; TCGA BRCA -0.265; TCGA ESCA -0.278; TCGA KIRP -0.124; TCGA LIHC -0.154; TCGA LUSC -0.259; TCGA PAAD -0.398; TCGA THCA -0.191; TCGA STAD -0.275; TCGA UCEC -0.122
hsa-miR-185-5p
NPTN
9 cancers: BLCA; BRCA; CESC; KIRC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.208; TCGA BRCA -0.185; TCGA CESC -0.081; TCGA KIRC -0.126; TCGA LUAD -0.087; TCGA PRAD -0.173; TCGA SARC -0.289; TCGA STAD -0.288; TCGA UCEC -0.164
hsa-miR-185-5p
DTX3
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.147; TCGA BRCA -0.108; TCGA CESC -0.258; TCGA COAD -0.603; TCGA KIRC -0.186; TCGA LGG -0.125; TCGA OV -0.148; TCGA PRAD -0.102; TCGA SARC -0.484; TCGA STAD -0.831; TCGA UCEC -0.279
hsa-miR-185-5p
LMO3
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.061; TCGA CESC -1.243; TCGA COAD -2.157; TCGA ESCA -1.753; TCGA HNSC -0.839; TCGA KIRC -1.411; TCGA KIRP -0.575; TCGA LUAD -0.469; TCGA PAAD -0.481; TCGA PRAD -0.317; TCGA SARC -1.188; TCGA THCA -0.282; TCGA STAD -1.77; TCGA UCEC -0.531
hsa-miR-185-5p
EIF4EBP2
10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.122; TCGA BRCA -0.138; TCGA COAD -0.11; TCGA KIRC -0.136; TCGA LGG -0.105; TCGA LUAD -0.099; TCGA LUSC -0.181; TCGA PAAD -0.136; TCGA PRAD -0.08; TCGA STAD -0.165
hsa-miR-185-5p
TNS1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.171; TCGA BRCA -0.411; TCGA CESC -0.19; TCGA COAD -0.952; TCGA ESCA -1.183; TCGA HNSC -0.312; TCGA KIRC -0.149; TCGA LUAD -0.423; TCGA LUSC -0.318; TCGA PAAD -0.418; TCGA PRAD -0.348; TCGA SARC -0.7; TCGA STAD -1.404; TCGA UCEC -0.667
hsa-miR-185-5p
BACH2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.674; TCGA BRCA -0.422; TCGA CESC -0.214; TCGA COAD -0.698; TCGA ESCA -0.48; TCGA KIRC -0.361; TCGA KIRP -0.283; TCGA LGG -0.095; TCGA LIHC -0.425; TCGA THCA -0.7; TCGA STAD -0.489; TCGA UCEC -0.545
hsa-miR-185-5p
IKZF4
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.11; TCGA BRCA -0.224; TCGA COAD -0.178; TCGA ESCA -0.242; TCGA KIRC -0.11; TCGA KIRP -0.213; TCGA LUAD -0.142; TCGA SARC -0.231; TCGA THCA -0.193; TCGA STAD -0.21; TCGA UCEC -0.181
hsa-miR-185-5p
ARHGEF6
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.294; TCGA BRCA -0.224; TCGA COAD -0.303; TCGA ESCA -0.528; TCGA HNSC -0.275; TCGA LGG -0.069; TCGA LUAD -0.144; TCGA LUSC -0.49; TCGA THCA -0.205; TCGA STAD -0.414; TCGA UCEC -0.305
hsa-miR-185-5p
MRVI1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.979; TCGA BRCA -0.38; TCGA CESC -0.568; TCGA COAD -0.907; TCGA ESCA -1.223; TCGA HNSC -0.182; TCGA KIRC -0.13; TCGA LIHC -0.206; TCGA LUAD -0.358; TCGA LUSC -0.595; TCGA PAAD -0.318; TCGA PRAD -0.311; TCGA SARC -1.234; TCGA THCA -0.251; TCGA STAD -1.295; TCGA UCEC -0.781
hsa-miR-185-5p
ZNF704
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.269; TCGA BRCA -0.489; TCGA CESC -0.417; TCGA COAD -0.284; TCGA ESCA -0.345; TCGA KIRC -0.439; TCGA LGG -0.119; TCGA LUAD -0.317; TCGA LUSC -0.364; TCGA PAAD -0.405; TCGA SARC -0.536; TCGA STAD -0.581; TCGA UCEC -0.344
hsa-miR-185-5p
DLG2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.925; TCGA BRCA -0.547; TCGA CESC -0.62; TCGA COAD -1.269; TCGA ESCA -1.847; TCGA HNSC -1.043; TCGA KIRC -0.611; TCGA KIRP -0.238; TCGA LIHC -0.585; TCGA LUSC -0.778; TCGA SARC -0.883; TCGA STAD -1.469; TCGA UCEC -0.819
hsa-miR-185-5p
PHLDB1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUSC; PAAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.248; TCGA BRCA -0.14; TCGA CESC -0.323; TCGA COAD -0.172; TCGA ESCA -0.338; TCGA KIRP -0.198; TCGA LUSC -0.389; TCGA PAAD -0.192; TCGA THCA -0.233; TCGA STAD -0.411; TCGA UCEC -0.144
hsa-miR-185-5p
KIAA1328
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.187; TCGA BRCA -0.337; TCGA ESCA -0.202; TCGA HNSC -0.159; TCGA KIRC -0.204; TCGA KIRP -0.193; TCGA LUAD -0.231; TCGA LUSC -0.156; TCGA PRAD -0.101; TCGA SARC -0.235; TCGA STAD -0.175; TCGA UCEC -0.199
hsa-miR-185-5p
PRKAB2
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.172; TCGA BRCA -0.124; TCGA COAD -0.167; TCGA ESCA -0.27; TCGA KIRC -0.183; TCGA KIRP -0.115; TCGA LGG -0.06; TCGA PAAD -0.248; TCGA SARC -0.277; TCGA STAD -0.372
hsa-miR-185-5p
SLC8A1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.573; TCGA BRCA -0.14; TCGA CESC -0.229; TCGA COAD -0.672; TCGA ESCA -0.615; TCGA LGG -0.116; TCGA LIHC -0.234; TCGA LUAD -0.182; TCGA LUSC -0.302; TCGA PRAD -0.32; TCGA SARC -0.742; TCGA THCA -0.336; TCGA STAD -0.758; TCGA UCEC -0.359
hsa-miR-185-5p
TCF12
10 cancers: BLCA; BRCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.151; TCGA BRCA -0.283; TCGA KIRP -0.092; TCGA LGG -0.385; TCGA LIHC -0.125; TCGA LUAD -0.192; TCGA LUSC -0.174; TCGA PAAD -0.153; TCGA SARC -0.086; TCGA UCEC -0.159
hsa-miR-185-5p
TMEM150C
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.456; TCGA BRCA -0.462; TCGA COAD -0.781; TCGA HNSC -0.327; TCGA KIRC -0.326; TCGA LIHC -0.324; TCGA LUAD -0.284; TCGA SARC -0.354; TCGA STAD -0.46; TCGA UCEC -0.49
hsa-miR-185-5p
HIP1
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; PAAD; SARC
MirTarget; mirMAP
TCGA BLCA -0.147; TCGA BRCA -0.264; TCGA COAD -0.195; TCGA KIRC -0.344; TCGA KIRP -0.309; TCGA LGG -0.086; TCGA LUAD -0.264; TCGA PAAD -0.247; TCGA SARC -0.183
hsa-miR-185-5p
RYR2
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.114; TCGA BRCA -0.264; TCGA COAD -0.919; TCGA ESCA -1.889; TCGA LUAD -0.227; TCGA PAAD -0.386; TCGA SARC -1.128; TCGA STAD -1.27; TCGA UCEC -0.34
hsa-miR-185-5p
SH3BGR
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.615; TCGA BRCA -0.172; TCGA CESC -0.228; TCGA COAD -0.32; TCGA ESCA -0.729; TCGA HNSC -0.723; TCGA KIRC -0.274; TCGA LUSC -0.164; TCGA OV -0.192; TCGA PRAD -0.277; TCGA SARC -0.658; TCGA STAD -1.138
hsa-miR-185-5p
KIDINS220
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.079; TCGA BRCA -0.293; TCGA COAD -0.178; TCGA KIRC -0.148; TCGA KIRP -0.091; TCGA LGG -0.064; TCGA LUAD -0.145; TCGA SARC -0.171; TCGA THCA -0.107; TCGA STAD -0.181; TCGA UCEC -0.144
hsa-miR-185-5p
RSBN1
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; OV; SARC; UCEC
MirTarget
TCGA BLCA -0.051; TCGA BRCA -0.24; TCGA ESCA -0.152; TCGA KIRC -0.114; TCGA KIRP -0.136; TCGA LIHC -0.158; TCGA LUAD -0.156; TCGA OV -0.087; TCGA SARC -0.137; TCGA UCEC -0.09
hsa-miR-185-5p
LIMS2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.898; TCGA BRCA -0.226; TCGA CESC -0.471; TCGA COAD -0.934; TCGA ESCA -0.863; TCGA HNSC -0.222; TCGA KIRC -0.261; TCGA KIRP -0.34; TCGA LGG -0.168; TCGA LIHC -0.321; TCGA LUAD -0.282; TCGA LUSC -0.235; TCGA OV -0.165; TCGA PRAD -0.445; TCGA SARC -0.672; TCGA STAD -1.448; TCGA UCEC -0.674
hsa-miR-185-5p
PPP1R3B
10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.349; TCGA BRCA -0.373; TCGA COAD -0.156; TCGA ESCA -0.378; TCGA LIHC -0.47; TCGA LUAD -0.237; TCGA PRAD -0.126; TCGA SARC -0.587; TCGA THCA -0.261; TCGA UCEC -0.21
hsa-miR-185-5p
FAM161B
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.32; TCGA BRCA -0.576; TCGA COAD -0.179; TCGA ESCA -0.393; TCGA KIRC -0.343; TCGA LUAD -0.176; TCGA LUSC -0.301; TCGA SARC -0.264; TCGA STAD -0.506; TCGA UCEC -0.265
hsa-miR-185-5p
RBM20
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.64; TCGA BRCA -0.456; TCGA CESC -0.427; TCGA COAD -0.812; TCGA ESCA -0.867; TCGA HNSC -0.692; TCGA SARC -0.854; TCGA STAD -1.19; TCGA UCEC -0.631
hsa-miR-185-5p
BMPR2
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.206; TCGA BRCA -0.345; TCGA COAD -0.408; TCGA ESCA -0.202; TCGA KIRC -0.12; TCGA KIRP -0.182; TCGA LIHC -0.248; TCGA LUAD -0.212; TCGA LUSC -0.193; TCGA SARC -0.26; TCGA THCA -0.093; TCGA STAD -0.142; TCGA UCEC -0.19
hsa-miR-185-5p
CTF1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.251; TCGA BRCA -0.359; TCGA CESC -0.408; TCGA COAD -0.749; TCGA ESCA -0.448; TCGA HNSC -0.327; TCGA KIRC -0.424; TCGA KIRP -0.379; TCGA LIHC -0.324; TCGA OV -0.166; TCGA PRAD -0.472; TCGA SARC -0.639; TCGA THCA -0.506; TCGA STAD -1.08; TCGA UCEC -0.445
hsa-miR-185-5p
SIN3A
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.085; TCGA BRCA -0.196; TCGA KIRC -0.094; TCGA KIRP -0.145; TCGA LGG -0.07; TCGA LUAD -0.103; TCGA SARC -0.252; TCGA STAD -0.057; TCGA UCEC -0.086
hsa-miR-185-5p
CDADC1
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.111; TCGA BRCA -0.119; TCGA CESC -0.139; TCGA ESCA -0.135; TCGA KIRC -0.158; TCGA LIHC -0.193; TCGA OV -0.069; TCGA PRAD -0.095; TCGA STAD -0.154; TCGA UCEC -0.059
hsa-miR-185-5p
NFIX
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.601; TCGA BRCA -0.252; TCGA CESC -0.162; TCGA COAD -0.225; TCGA ESCA -0.516; TCGA HNSC -0.317; TCGA LGG -0.177; TCGA LIHC -0.161; TCGA LUAD -0.457; TCGA LUSC -0.166; TCGA PAAD -0.368; TCGA SARC -0.326; TCGA STAD -0.568; TCGA UCEC -0.436
hsa-miR-185-5p
PCDH10
11 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.898; TCGA BRCA -0.362; TCGA CESC -0.43; TCGA ESCA -1.37; TCGA KIRP -0.696; TCGA LUAD -0.53; TCGA LUSC -0.501; TCGA SARC -0.875; TCGA THCA -0.252; TCGA STAD -2.296; TCGA UCEC -0.614
hsa-miR-185-5p
MSRA
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.244; TCGA BRCA -0.091; TCGA CESC -0.298; TCGA ESCA -0.291; TCGA HNSC -0.276; TCGA KIRC -0.208; TCGA LIHC -0.397; TCGA LUAD -0.238; TCGA LUSC -0.352; TCGA PRAD -0.218; TCGA STAD -0.224; TCGA UCEC -0.223
hsa-miR-185-5p
BTG2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.318; TCGA BRCA -0.43; TCGA CESC -0.238; TCGA COAD -0.206; TCGA ESCA -0.497; TCGA HNSC -0.204; TCGA KIRC -0.327; TCGA LUAD -0.397; TCGA PRAD -0.343; TCGA SARC -0.342; TCGA STAD -0.723; TCGA UCEC -0.28
hsa-miR-185-5p
FZD4
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.162; TCGA BRCA -0.328; TCGA COAD -0.259; TCGA ESCA -0.456; TCGA HNSC -0.213; TCGA KIRP -0.207; TCGA LIHC -0.2; TCGA LUAD -0.194; TCGA LUSC -0.28; TCGA STAD -0.359; TCGA UCEC -0.326
hsa-miR-185-5p
XYLT1
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.412; TCGA BRCA -0.256; TCGA COAD -0.324; TCGA ESCA -0.424; TCGA LGG -0.13; TCGA LUAD -0.401; TCGA LUSC -0.82; TCGA PRAD -0.13; TCGA THCA -0.176; TCGA STAD -0.265; TCGA UCEC -0.556
hsa-miR-185-5p
KANK2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.676; TCGA BRCA -0.211; TCGA CESC -0.352; TCGA COAD -0.593; TCGA ESCA -0.926; TCGA LUAD -0.233; TCGA LUSC -0.345; TCGA PAAD -0.271; TCGA PRAD -0.153; TCGA SARC -0.61; TCGA THCA -0.238; TCGA STAD -1.014; TCGA UCEC -0.625
hsa-miR-185-5p
HDAC5
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.224; TCGA CESC -0.106; TCGA COAD -0.241; TCGA ESCA -0.24; TCGA HNSC -0.181; TCGA KIRC -0.14; TCGA PRAD -0.117; TCGA SARC -0.195; TCGA STAD -0.485; TCGA UCEC -0.259
hsa-miR-185-5p
ADAMTS17
10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.333; TCGA BRCA -0.169; TCGA KIRC -0.329; TCGA KIRP -0.293; TCGA LGG -0.108; TCGA LUAD -0.195; TCGA SARC -0.287; TCGA THCA -0.382; TCGA STAD -0.28; TCGA UCEC -0.47
hsa-miR-185-5p
PDS5B
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; SARC; UCEC
MirTarget
TCGA BLCA -0.136; TCGA BRCA -0.248; TCGA COAD -0.165; TCGA KIRC -0.169; TCGA KIRP -0.166; TCGA LIHC -0.096; TCGA LUAD -0.124; TCGA LUSC -0.18; TCGA OV -0.066; TCGA SARC -0.076; TCGA UCEC -0.152
hsa-miR-185-5p
PCDHA4
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUSC; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.41; TCGA BRCA -0.506; TCGA ESCA -0.788; TCGA HNSC -0.464; TCGA KIRP -0.488; TCGA LUSC -0.54; TCGA SARC -0.347; TCGA THCA -0.541; TCGA UCEC -0.486
hsa-miR-185-5p
TEAD1
16 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.337; TCGA BRCA -0.369; TCGA COAD -0.316; TCGA ESCA -0.23; TCGA KIRC -0.148; TCGA KIRP -0.176; TCGA LGG -0.17; TCGA LIHC -0.221; TCGA LUAD -0.115; TCGA LUSC -0.137; TCGA PAAD -0.142; TCGA PRAD -0.114; TCGA SARC -0.262; TCGA THCA -0.185; TCGA STAD -0.567; TCGA UCEC -0.17
hsa-miR-185-5p
PABPC4L
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.414; TCGA BRCA -0.284; TCGA COAD -0.626; TCGA ESCA -0.485; TCGA KIRP -0.353; TCGA LUAD -0.219; TCGA LUSC -0.421; TCGA OV -0.135; TCGA PRAD -0.363; TCGA SARC -0.429; TCGA STAD -0.707; TCGA UCEC -0.376
hsa-miR-185-5p
AKAP6
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.11; TCGA BRCA -0.381; TCGA CESC -0.192; TCGA COAD -0.685; TCGA ESCA -1.086; TCGA HNSC -0.496; TCGA KIRC -0.334; TCGA LIHC -0.339; TCGA LUAD -0.218; TCGA LUSC -0.241; TCGA PRAD -0.146; TCGA SARC -1.018; TCGA STAD -1.675; TCGA UCEC -0.36
hsa-miR-185-5p
ADAM22
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.238; TCGA BRCA -0.598; TCGA CESC -0.311; TCGA ESCA -0.694; TCGA KIRC -0.247; TCGA LGG -0.133; TCGA LUAD -0.249; TCGA LUSC -0.821; TCGA SARC -0.994; TCGA STAD -0.262; TCGA UCEC -0.4
hsa-miR-185-5p
SEMA3D
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LUAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.567; TCGA BRCA -0.826; TCGA CESC -0.463; TCGA COAD -1.217; TCGA KIRC -0.666; TCGA LGG -0.309; TCGA LUAD -0.334; TCGA PRAD -0.398; TCGA STAD -1.006; TCGA UCEC -0.412
hsa-miR-185-5p
CBFA2T3
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.39; TCGA BRCA -0.167; TCGA ESCA -0.403; TCGA HNSC -0.256; TCGA LIHC -0.308; TCGA LUAD -0.182; TCGA PRAD -0.207; TCGA STAD -0.648; TCGA UCEC -0.42
hsa-miR-185-5p
LYRM7
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; SARC; STAD
MirTarget
TCGA BLCA -0.07; TCGA BRCA -0.203; TCGA HNSC -0.175; TCGA KIRC -0.122; TCGA KIRP -0.08; TCGA LGG -0.071; TCGA LIHC -0.087; TCGA LUAD -0.078; TCGA OV -0.084; TCGA SARC -0.22; TCGA STAD -0.119
hsa-miR-185-5p
PCDHA3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; UCEC
MirTarget
TCGA BLCA -0.592; TCGA BRCA -0.668; TCGA CESC -0.497; TCGA COAD -1.071; TCGA ESCA -0.717; TCGA KIRC -0.528; TCGA KIRP -0.504; TCGA LUAD -0.274; TCGA LUSC -0.623; TCGA SARC -0.407; TCGA UCEC -0.869
hsa-miR-185-5p
MARCH8
10 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.258; TCGA BRCA -0.554; TCGA ESCA -0.236; TCGA KIRC -0.133; TCGA LGG -0.131; TCGA LUAD -0.192; TCGA LUSC -0.225; TCGA SARC -0.142; TCGA STAD -0.262; TCGA UCEC -0.234
hsa-miR-185-5p
TJP1
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.167; TCGA BRCA -0.264; TCGA CESC -0.113; TCGA COAD -0.156; TCGA KIRC -0.22; TCGA KIRP -0.238; TCGA LIHC -0.166; TCGA LUAD -0.187; TCGA PAAD -0.208; TCGA SARC -0.194; TCGA THCA -0.087; TCGA STAD -0.238; TCGA UCEC -0.229
hsa-miR-185-5p
PCDH9
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.932; TCGA BRCA -0.317; TCGA CESC -0.53; TCGA COAD -0.95; TCGA ESCA -1.379; TCGA KIRC -1.101; TCGA KIRP -0.511; TCGA LUAD -0.246; TCGA THCA -0.406; TCGA STAD -1.689
hsa-miR-185-5p
SYNM
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1.545; TCGA BRCA -0.57; TCGA COAD -1.742; TCGA ESCA -1.741; TCGA HNSC -0.508; TCGA LUAD -0.161; TCGA PRAD -0.639; TCGA SARC -1.057; TCGA STAD -2.329; TCGA UCEC -0.467
hsa-miR-185-5p
GAS7
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.795; TCGA BRCA -0.337; TCGA CESC -0.262; TCGA COAD -0.572; TCGA ESCA -0.95; TCGA HNSC -0.415; TCGA LUAD -0.231; TCGA LUSC -0.737; TCGA THCA -0.626; TCGA STAD -0.653; TCGA UCEC -0.404
hsa-miR-185-5p
CELF2
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.824; TCGA BRCA -0.136; TCGA ESCA -1.075; TCGA HNSC -0.305; TCGA LUAD -0.289; TCGA LUSC -0.431; TCGA THCA -0.361; TCGA STAD -0.781; TCGA UCEC -0.393
hsa-miR-185-5p
CAMK2A
9 cancers: BLCA; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -1.208; TCGA ESCA -0.495; TCGA KIRC -1.055; TCGA KIRP -0.37; TCGA LUSC -0.577; TCGA PRAD -0.27; TCGA SARC -0.506; TCGA STAD -1.144; TCGA UCEC -1.063
hsa-miR-185-5p
GNAO1
9 cancers: BLCA; COAD; ESCA; LIHC; OV; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -1.106; TCGA COAD -1.405; TCGA ESCA -1.005; TCGA LIHC -0.619; TCGA OV -0.261; TCGA PRAD -0.24; TCGA SARC -1.189; TCGA STAD -1.796; TCGA UCEC -0.703
hsa-miR-185-5p
CHST3
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.275; TCGA BRCA -0.162; TCGA COAD -0.479; TCGA ESCA -0.418; TCGA KIRC -0.171; TCGA KIRP -0.343; TCGA LGG -0.078; TCGA LUSC -0.275; TCGA PRAD -0.141; TCGA STAD -0.585; TCGA UCEC -0.355
hsa-miR-185-5p
HIF3A
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -1.122; TCGA BRCA -0.437; TCGA COAD -0.763; TCGA ESCA -1.241; TCGA HNSC -0.464; TCGA KIRC -0.595; TCGA KIRP -0.504; TCGA PAAD -0.343; TCGA PRAD -0.627; TCGA SARC -0.999; TCGA STAD -1.528; TCGA UCEC -0.475
hsa-miR-185-5p
WDTC1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.082; TCGA BRCA -0.115; TCGA COAD -0.225; TCGA ESCA -0.225; TCGA HNSC -0.128; TCGA KIRC -0.156; TCGA LUAD -0.074; TCGA LUSC -0.197; TCGA STAD -0.234; TCGA UCEC -0.187
hsa-miR-185-5p
NTRK2
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.908; TCGA BRCA -0.87; TCGA CESC -0.474; TCGA COAD -0.78; TCGA KIRC -0.904; TCGA LIHC -0.707; TCGA SARC -0.716; TCGA STAD -0.86; TCGA UCEC -0.668
hsa-miR-185-5p
GFRA1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -1.156; TCGA BRCA -1.216; TCGA CESC -0.613; TCGA COAD -1.482; TCGA ESCA -1.785; TCGA HNSC -0.725; TCGA KIRC -0.374; TCGA KIRP -0.386; TCGA LGG -0.386; TCGA LIHC -0.832; TCGA LUAD -0.773; TCGA LUSC -0.821; TCGA PRAD -0.264; TCGA STAD -1.954; TCGA UCEC -0.91
hsa-miR-185-5p
SHROOM4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.184; TCGA BRCA -0.364; TCGA CESC -0.28; TCGA COAD -0.456; TCGA ESCA -0.425; TCGA KIRC -0.232; TCGA KIRP -0.244; TCGA LIHC -0.215; TCGA LUAD -0.443; TCGA LUSC -0.408; TCGA THCA -0.926; TCGA STAD -0.176; TCGA UCEC -0.316
hsa-miR-185-5p
NFASC
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.723; TCGA BRCA -0.264; TCGA COAD -0.901; TCGA ESCA -0.871; TCGA KIRC -0.717; TCGA KIRP -0.274; TCGA LUAD -0.365; TCGA LUSC -0.307; TCGA SARC -1.398; TCGA STAD -1.425; TCGA UCEC -0.797
hsa-miR-185-5p
SCN3B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.77; TCGA BRCA -0.79; TCGA CESC -0.459; TCGA COAD -0.933; TCGA ESCA -0.691; TCGA HNSC -0.289; TCGA KIRC -0.277; TCGA KIRP -0.194; TCGA LUAD -0.248; TCGA PRAD -0.373; TCGA SARC -0.286; TCGA STAD -1.093; TCGA UCEC -0.745
hsa-miR-185-5p
COL8A2
10 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.698; TCGA BRCA -0.453; TCGA COAD -0.609; TCGA ESCA -0.704; TCGA LUSC -0.699; TCGA PAAD -0.477; TCGA SARC -0.255; TCGA THCA -1.249; TCGA STAD -0.752; TCGA UCEC -0.163
hsa-miR-185-5p
YPEL2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.136; TCGA BRCA -0.27; TCGA CESC -0.168; TCGA COAD -0.231; TCGA ESCA -0.309; TCGA HNSC -0.258; TCGA KIRP -0.2; TCGA LIHC -0.407; TCGA LUSC -0.189; TCGA SARC -0.139; TCGA THCA -0.162; TCGA STAD -0.227; TCGA UCEC -0.227
hsa-miR-185-5p
CTDSP2
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.222; TCGA BRCA -0.241; TCGA COAD -0.174; TCGA ESCA -0.116; TCGA KIRC -0.145; TCGA KIRP -0.166; TCGA LUAD -0.155; TCGA LUSC -0.135; TCGA PAAD -0.128; TCGA STAD -0.172; TCGA UCEC -0.174
hsa-miR-185-5p
SCN4B
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.541; TCGA BRCA -0.72; TCGA COAD -0.788; TCGA ESCA -0.946; TCGA HNSC -0.306; TCGA LUAD -0.551; TCGA LUSC -0.362; TCGA SARC -0.468; TCGA STAD -1.175; TCGA UCEC -0.72
hsa-miR-185-5p
MXRA7
11 cancers: BLCA; CESC; COAD; ESCA; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.561; TCGA CESC -0.155; TCGA COAD -0.544; TCGA ESCA -0.35; TCGA LUAD -0.152; TCGA OV -0.107; TCGA PRAD -0.174; TCGA SARC -0.19; TCGA THCA -0.146; TCGA STAD -0.947; TCGA UCEC -0.299
hsa-miR-185-5p
MKL2
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.097; TCGA BRCA -0.436; TCGA COAD -0.186; TCGA ESCA -0.163; TCGA KIRC -0.112; TCGA KIRP -0.157; TCGA LIHC -0.114; TCGA LUAD -0.155; TCGA LUSC -0.139; TCGA SARC -0.14; TCGA STAD -0.227; TCGA UCEC -0.221
hsa-miR-185-5p
PLXNA4
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.95; TCGA BRCA -0.442; TCGA COAD -1.012; TCGA ESCA -0.976; TCGA KIRC -0.654; TCGA KIRP -0.452; TCGA LIHC -0.395; TCGA LUAD -0.428; TCGA LUSC -0.675; TCGA SARC -1.088; TCGA STAD -0.986; TCGA UCEC -0.274
hsa-miR-185-5p
SLC16A2
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.604; TCGA BRCA -0.124; TCGA COAD -0.563; TCGA ESCA -0.486; TCGA KIRC -0.472; TCGA KIRP -0.287; TCGA LGG -0.072; TCGA LIHC -0.46; TCGA LUAD -0.238; TCGA LUSC -0.572; TCGA PRAD -0.177; TCGA SARC -0.236; TCGA STAD -0.635; TCGA UCEC -0.545
hsa-miR-185-5p
KLF7
9 cancers: BLCA; BRCA; COAD; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.349; TCGA COAD -0.496; TCGA KIRP -0.264; TCGA LUAD -0.264; TCGA LUSC -0.206; TCGA SARC -0.18; TCGA STAD -0.498; TCGA UCEC -0.265
hsa-miR-185-5p
ENTPD1
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.373; TCGA BRCA -0.104; TCGA COAD -0.241; TCGA ESCA -0.276; TCGA LUAD -0.094; TCGA LUSC -0.284; TCGA SARC -0.311; TCGA THCA -0.415; TCGA STAD -0.264; TCGA UCEC -0.234
hsa-miR-185-5p
KIAA0141
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.141; TCGA ESCA -0.126; TCGA HNSC -0.164; TCGA LIHC -0.1; TCGA LUAD -0.079; TCGA PRAD -0.074; TCGA SARC -0.076; TCGA STAD -0.107; TCGA UCEC -0.103
hsa-miR-185-5p
PBX1
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.401; TCGA BRCA -0.314; TCGA COAD -0.79; TCGA ESCA -0.746; TCGA HNSC -0.357; TCGA KIRC -0.532; TCGA KIRP -0.259; TCGA LGG -0.119; TCGA LUAD -0.307; TCGA LUSC -0.383; TCGA OV -0.127; TCGA PAAD -0.203; TCGA PRAD -0.221; TCGA SARC -0.915; TCGA THCA -0.108; TCGA STAD -0.937; TCGA UCEC -0.413
hsa-miR-185-5p
DTNA
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.197; TCGA CESC -0.41; TCGA COAD -1.515; TCGA ESCA -1.193; TCGA HNSC -0.322; TCGA LUSC -0.383; TCGA PRAD -0.246; TCGA SARC -0.677; TCGA STAD -1.583; TCGA UCEC -0.507
hsa-miR-185-5p
ATXN1L
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.229; TCGA COAD -0.121; TCGA KIRC -0.202; TCGA KIRP -0.118; TCGA LUAD -0.171; TCGA SARC -0.139; TCGA STAD -0.159; TCGA UCEC -0.148
hsa-miR-185-5p
NFIB
13 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.22; TCGA ESCA -0.328; TCGA HNSC -0.246; TCGA LGG -0.269; TCGA LIHC -0.423; TCGA LUAD -0.327; TCGA LUSC -0.209; TCGA PAAD -0.268; TCGA PRAD -0.235; TCGA SARC -0.3; TCGA THCA -0.124; TCGA STAD -0.265
hsa-miR-185-5p
TMOD2
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.239; TCGA BRCA -0.134; TCGA COAD -0.267; TCGA ESCA -0.423; TCGA KIRP -0.125; TCGA LUAD -0.187; TCGA LUSC -0.177; TCGA THCA -0.129; TCGA STAD -0.498; TCGA UCEC -0.379
hsa-miR-185-5p
CPEB2
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.351; TCGA BRCA -0.443; TCGA COAD -0.115; TCGA ESCA -0.461; TCGA LIHC -0.231; TCGA LUAD -0.103; TCGA SARC -0.167; TCGA STAD -0.255; TCGA UCEC -0.164
hsa-miR-185-5p
HIPK1
9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; PAAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.123; TCGA BRCA -0.208; TCGA ESCA -0.188; TCGA KIRC -0.132; TCGA KIRP -0.122; TCGA LUAD -0.136; TCGA PAAD -0.149; TCGA SARC -0.099; TCGA UCEC -0.073
hsa-miR-185-5p
FOXN3
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.346; TCGA BRCA -0.238; TCGA COAD -0.336; TCGA ESCA -0.433; TCGA LGG -0.054; TCGA LUAD -0.17; TCGA PRAD -0.116; TCGA SARC -0.359; TCGA STAD -0.55; TCGA UCEC -0.285
hsa-miR-185-5p
MAP4
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.154; TCGA COAD -0.069; TCGA ESCA -0.174; TCGA HNSC -0.137; TCGA KIRC -0.064; TCGA LUAD -0.12; TCGA LUSC -0.241; TCGA PAAD -0.098; TCGA SARC -0.091; TCGA THCA -0.23; TCGA STAD -0.276; TCGA UCEC -0.085
hsa-miR-185-5p
PRX
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.298; TCGA BRCA -0.193; TCGA COAD -0.177; TCGA ESCA -0.311; TCGA KIRC -0.352; TCGA KIRP -0.193; TCGA PRAD -0.087; TCGA SARC -0.209; TCGA STAD -0.478; TCGA UCEC -0.371
hsa-miR-185-5p
CPEB4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.29; TCGA BRCA -0.289; TCGA COAD -0.152; TCGA ESCA -0.295; TCGA HNSC -0.201; TCGA KIRC -0.22; TCGA LIHC -0.243; TCGA LUAD -0.162; TCGA LUSC -0.234; TCGA SARC -0.288; TCGA STAD -0.228; TCGA UCEC -0.129
hsa-miR-185-5p
SSBP2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.392; TCGA BRCA -0.325; TCGA CESC -0.364; TCGA COAD -0.452; TCGA ESCA -0.487; TCGA HNSC -0.318; TCGA KIRC -0.078; TCGA KIRP -0.112; TCGA LUAD -0.245; TCGA OV -0.175; TCGA PRAD -0.123; TCGA SARC -0.343; TCGA THCA -0.19; TCGA STAD -1.005; TCGA UCEC -0.32
hsa-miR-185-5p
SPTBN4
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.588; TCGA BRCA -0.201; TCGA CESC -0.223; TCGA COAD -0.378; TCGA ESCA -0.896; TCGA HNSC -0.341; TCGA SARC -0.671; TCGA STAD -0.803; TCGA UCEC -0.322
hsa-miR-185-5p
EBF1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.684; TCGA BRCA -0.388; TCGA CESC -0.423; TCGA COAD -0.41; TCGA ESCA -0.475; TCGA LGG -0.164; TCGA LUAD -0.267; TCGA LUSC -0.397; TCGA THCA -0.273; TCGA STAD -0.492; TCGA UCEC -0.565
hsa-miR-185-5p
WWC2
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.287; TCGA BRCA -0.419; TCGA COAD -0.484; TCGA ESCA -0.21; TCGA KIRC -0.302; TCGA KIRP -0.28; TCGA LIHC -0.297; TCGA LUAD -0.16; TCGA LUSC -0.254; TCGA PAAD -0.313; TCGA STAD -0.252
hsa-miR-185-5p
FMO2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.933; TCGA BRCA -0.753; TCGA CESC -0.536; TCGA COAD -0.667; TCGA ESCA -1.204; TCGA HNSC -1.027; TCGA KIRC -0.338; TCGA LIHC -0.443; TCGA LUAD -0.575; TCGA LUSC -0.382; TCGA PAAD -0.513; TCGA PRAD -0.321; TCGA STAD -0.983; TCGA UCEC -0.863
hsa-miR-185-5p
DAB2IP
9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; LUSC; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.147; TCGA BRCA -0.111; TCGA KIRC -0.107; TCGA KIRP -0.175; TCGA LUAD -0.093; TCGA LUSC -0.203; TCGA SARC -0.223; TCGA THCA -0.365; TCGA UCEC -0.174
hsa-miR-185-5p
SEMA6D
11 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.542; TCGA BRCA -0.701; TCGA KIRC -1.031; TCGA KIRP -0.491; TCGA LIHC -0.62; TCGA LUAD -0.44; TCGA OV -0.205; TCGA PRAD -0.195; TCGA SARC -0.279; TCGA STAD -0.69; TCGA UCEC -0.377
hsa-miR-185-5p
PTMS
9 cancers: BLCA; CESC; LGG; LIHC; LUAD; OV; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.155; TCGA CESC -0.276; TCGA LGG -0.115; TCGA LIHC -0.256; TCGA LUAD -0.151; TCGA OV -0.156; TCGA PRAD -0.124; TCGA THCA -0.2; TCGA STAD -0.21
hsa-miR-185-5p
LRFN5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -1.195; TCGA BRCA -0.707; TCGA CESC -0.715; TCGA COAD -0.823; TCGA ESCA -1.187; TCGA KIRC -0.461; TCGA KIRP -0.796; TCGA LUAD -0.258; TCGA LUSC -0.714; TCGA PRAD -0.325; TCGA STAD -1.109; TCGA UCEC -0.889
hsa-miR-185-5p
COPS4
9 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; OV; PRAD; STAD
miRNATAP
TCGA BLCA -0.107; TCGA BRCA -0.066; TCGA HNSC -0.082; TCGA KIRC -0.088; TCGA LIHC -0.153; TCGA LUAD -0.075; TCGA OV -0.117; TCGA PRAD -0.073; TCGA STAD -0.115
hsa-miR-185-5p
PIK3R1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.306; TCGA BRCA -0.576; TCGA COAD -0.236; TCGA ESCA -0.418; TCGA HNSC -0.284; TCGA LGG -0.169; TCGA LIHC -0.255; TCGA LUAD -0.266; TCGA LUSC -0.289; TCGA SARC -0.315; TCGA STAD -0.332; TCGA UCEC -0.263
hsa-miR-185-5p
ROBO2
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.268; TCGA BRCA -0.742; TCGA CESC -0.522; TCGA COAD -0.979; TCGA HNSC -0.706; TCGA KIRC -0.702; TCGA LUAD -0.78; TCGA SARC -0.445; TCGA THCA -0.693; TCGA STAD -0.345
hsa-miR-185-5p
GARNL3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.356; TCGA BRCA -0.332; TCGA CESC -0.291; TCGA COAD -0.229; TCGA ESCA -0.642; TCGA HNSC -0.191; TCGA LIHC -0.244; TCGA LUAD -0.203; TCGA SARC -0.513; TCGA STAD -0.533; TCGA UCEC -0.583
hsa-miR-185-5p
TSHZ3
11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.772; TCGA BRCA -0.385; TCGA COAD -0.613; TCGA ESCA -0.629; TCGA KIRP -0.273; TCGA LIHC -0.201; TCGA LUAD -0.14; TCGA LUSC -0.472; TCGA PRAD -0.178; TCGA STAD -0.799; TCGA UCEC -0.802
hsa-miR-185-5p
RALGAPA1
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.111; TCGA BRCA -0.316; TCGA ESCA -0.214; TCGA KIRC -0.208; TCGA KIRP -0.173; TCGA LGG -0.066; TCGA LIHC -0.119; TCGA LUAD -0.112; TCGA SARC -0.256; TCGA STAD -0.108; TCGA UCEC -0.116
hsa-miR-185-5p
ZADH2
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; OV; SARC; STAD
MirTarget
TCGA BRCA -0.227; TCGA CESC -0.088; TCGA HNSC -0.095; TCGA KIRC -0.276; TCGA KIRP -0.063; TCGA LIHC -0.333; TCGA LUAD -0.19; TCGA OV -0.077; TCGA SARC -0.072; TCGA STAD -0.135
hsa-miR-185-5p
ZFP1
9 cancers: BRCA; COAD; KIRP; LGG; LIHC; LUAD; OV; SARC; STAD
MirTarget
TCGA BRCA -0.111; TCGA COAD -0.122; TCGA KIRP -0.072; TCGA LGG -0.066; TCGA LIHC -0.54; TCGA LUAD -0.127; TCGA OV -0.124; TCGA SARC -0.202; TCGA STAD -0.138
hsa-miR-185-5p
ZDHHC2
9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; OV; STAD; UCEC
MirTarget
TCGA BRCA -0.297; TCGA COAD -0.327; TCGA KIRC -0.492; TCGA KIRP -0.215; TCGA LIHC -0.23; TCGA LUAD -0.348; TCGA OV -0.165; TCGA STAD -0.348; TCGA UCEC -0.229
hsa-miR-185-5p
LZTFL1
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; STAD
MirTarget
TCGA BRCA -0.352; TCGA CESC -0.179; TCGA HNSC -0.204; TCGA KIRC -0.279; TCGA KIRP -0.184; TCGA LIHC -0.227; TCGA LUAD -0.198; TCGA LUSC -0.207; TCGA OV -0.177; TCGA STAD -0.108
hsa-miR-185-5p
VANGL2
9 cancers: BRCA; COAD; KIRC; LGG; OV; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.185; TCGA COAD -0.948; TCGA KIRC -0.46; TCGA LGG -0.228; TCGA OV -0.175; TCGA PRAD -0.484; TCGA SARC -0.554; TCGA THCA -0.196; TCGA STAD -0.592
hsa-miR-185-5p
PCDHA11
9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUSC; THCA; UCEC
MirTarget
TCGA BRCA -0.62; TCGA CESC -0.557; TCGA COAD -0.737; TCGA KIRC -0.738; TCGA KIRP -0.465; TCGA LIHC -0.421; TCGA LUSC -0.607; TCGA THCA -0.294; TCGA UCEC -0.627
hsa-miR-185-5p
PRTG
10 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; LUSC; OV; STAD; UCEC
MirTarget
TCGA BRCA -0.663; TCGA CESC -0.302; TCGA COAD -0.738; TCGA KIRC -0.93; TCGA KIRP -0.471; TCGA LGG -0.268; TCGA LUSC -0.487; TCGA OV -0.282; TCGA STAD -0.813; TCGA UCEC -0.558
hsa-miR-185-5p
VGLL3
11 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.368; TCGA CESC -0.415; TCGA COAD -0.587; TCGA ESCA -0.583; TCGA KIRC -0.489; TCGA LUAD -0.214; TCGA LUSC -0.669; TCGA PAAD -0.514; TCGA THCA -0.523; TCGA STAD -0.46; TCGA UCEC -0.696
hsa-miR-185-5p
UBXN10
14 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.765; TCGA CESC -0.461; TCGA ESCA -0.74; TCGA HNSC -0.406; TCGA KIRC -0.182; TCGA KIRP -0.24; TCGA LIHC -0.715; TCGA LUAD -0.379; TCGA LUSC -0.869; TCGA OV -0.154; TCGA PRAD -0.621; TCGA THCA -0.148; TCGA STAD -0.736; TCGA UCEC -0.221
hsa-miR-185-5p
DPP6
13 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.595; TCGA CESC -1.174; TCGA COAD -1.638; TCGA ESCA -1.733; TCGA KIRC -1.283; TCGA LGG -0.18; TCGA LUAD -0.426; TCGA LUSC -0.548; TCGA OV -0.359; TCGA PRAD -0.472; TCGA SARC -1.414; TCGA STAD -2.517; TCGA UCEC -1.505
hsa-miR-185-5p
GATAD2B
9 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; SARC; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.072; TCGA COAD -0.087; TCGA KIRC -0.136; TCGA KIRP -0.097; TCGA LGG -0.123; TCGA LUAD -0.118; TCGA LUSC -0.08; TCGA SARC -0.226; TCGA UCEC -0.081
hsa-miR-185-5p
RPS23
9 cancers: BRCA; CESC; HNSC; LGG; LUAD; OV; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.073; TCGA CESC -0.132; TCGA HNSC -0.163; TCGA LGG -0.176; TCGA LUAD -0.162; TCGA OV -0.254; TCGA PRAD -0.198; TCGA STAD -0.097; TCGA UCEC -0.108
hsa-miR-185-5p
ASTN2
9 cancers: BRCA; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.374; TCGA ESCA -0.589; TCGA KIRP -0.262; TCGA LUAD -0.212; TCGA LUSC -0.327; TCGA PRAD -0.29; TCGA SARC -0.173; TCGA STAD -0.427; TCGA UCEC -0.193
hsa-miR-185-5p
CFTR
9 cancers: BRCA; CESC; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; THCA
MirTarget
TCGA BRCA -0.363; TCGA CESC -0.742; TCGA HNSC -0.935; TCGA KIRC -1.18; TCGA LIHC -0.994; TCGA LUAD -0.604; TCGA PAAD -1.39; TCGA PRAD -0.499; TCGA THCA -1.057
hsa-miR-185-5p
OPCML
9 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LUAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.356; TCGA COAD -0.897; TCGA ESCA -0.896; TCGA KIRC -0.978; TCGA KIRP -0.62; TCGA LUAD -0.547; TCGA THCA -1.589; TCGA STAD -1.05; TCGA UCEC -0.974
hsa-miR-185-5p
PREPL
9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; OV; SARC; STAD
MirTarget
TCGA BRCA -0.252; TCGA COAD -0.09; TCGA KIRC -0.257; TCGA KIRP -0.135; TCGA LIHC -0.138; TCGA LUAD -0.094; TCGA OV -0.092; TCGA SARC -0.272; TCGA STAD -0.124
hsa-miR-185-5p
ZMIZ1
9 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; STAD; UCEC
MirTarget
TCGA BRCA -0.1; TCGA COAD -0.186; TCGA KIRC -0.126; TCGA KIRP -0.145; TCGA LGG -0.204; TCGA LUAD -0.199; TCGA LUSC -0.278; TCGA STAD -0.23; TCGA UCEC -0.319
hsa-miR-185-5p
HOXB5
9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA BRCA -0.445; TCGA CESC -0.571; TCGA KIRC -0.808; TCGA KIRP -0.662; TCGA LIHC -0.287; TCGA LUSC -0.513; TCGA PAAD -0.465; TCGA THCA -0.468; TCGA STAD -0.331
hsa-miR-185-5p
ACVR2A
15 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.307; TCGA COAD -0.106; TCGA ESCA -0.255; TCGA HNSC -0.195; TCGA KIRC -0.184; TCGA KIRP -0.102; TCGA LGG -0.114; TCGA LIHC -0.17; TCGA LUAD -0.119; TCGA OV -0.142; TCGA PRAD -0.159; TCGA SARC -0.095; TCGA THCA -0.063; TCGA STAD -0.193; TCGA UCEC -0.094
hsa-miR-185-5p
ADAMTS19
10 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; OV; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.428; TCGA CESC -0.71; TCGA COAD -0.691; TCGA ESCA -1.274; TCGA KIRC -1.036; TCGA KIRP -0.528; TCGA OV -0.724; TCGA SARC -0.598; TCGA STAD -0.671; TCGA UCEC -0.949
hsa-miR-185-5p
ZCCHC12
9 cancers: CESC; COAD; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.717; TCGA COAD -0.386; TCGA LUAD -0.405; TCGA OV -0.263; TCGA PRAD -0.232; TCGA SARC -0.367; TCGA THCA -2.117; TCGA STAD -1.05; TCGA UCEC -1.138
hsa-miR-185-5p
ZC4H2
13 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC
MirTarget
TCGA CESC -0.314; TCGA COAD -0.306; TCGA ESCA -0.638; TCGA HNSC -0.292; TCGA KIRC -0.232; TCGA LGG -0.202; TCGA LUAD -0.187; TCGA LUSC -0.488; TCGA OV -0.172; TCGA PRAD -0.289; TCGA SARC -0.397; TCGA STAD -0.537; TCGA UCEC -0.318
hsa-miR-185-5p
FOXP4
9 cancers: COAD; KIRC; KIRP; LUAD; LUSC; OV; SARC; THCA; UCEC
mirMAP
TCGA COAD -0.133; TCGA KIRC -0.164; TCGA KIRP -0.112; TCGA LUAD -0.14; TCGA LUSC -0.137; TCGA OV -0.175; TCGA SARC -0.211; TCGA THCA -0.179; TCGA UCEC -0.117
hsa-miR-185-5p
WTIP
9 cancers: COAD; ESCA; KIRC; KIRP; LUSC; OV; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.465; TCGA ESCA -0.452; TCGA KIRC -0.382; TCGA KIRP -0.342; TCGA LUSC -0.237; TCGA OV -0.138; TCGA THCA -0.522; TCGA STAD -0.572; TCGA UCEC -0.198
hsa-miR-185-5p
GIPC3
9 cancers: COAD; ESCA; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA COAD -0.263; TCGA ESCA -0.324; TCGA LIHC -0.148; TCGA LUAD -0.129; TCGA LUSC -0.301; TCGA SARC -0.627; TCGA THCA -0.178; TCGA STAD -0.204; TCGA UCEC -0.348
hsa-miR-185-5p
DPF2
9 cancers: KIRP; LGG; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA KIRP -0.075; TCGA LGG -0.129; TCGA LUAD -0.07; TCGA OV -0.069; TCGA PRAD -0.054; TCGA SARC -0.164; TCGA THCA -0.121; TCGA STAD -0.137; TCGA UCEC -0.067





Enriched cancer pathways of putative targets