microRNA information: hsa-miR-187-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-187-3p | miRbase |
Accession: | MIMAT0000262 | miRbase |
Precursor name: | hsa-mir-187 | miRbase |
Precursor accession: | MI0000274 | miRbase |
Symbol: | MIR187 | HGNC |
RefSeq ID: | NR_029616 | GenBank |
Sequence: | UCGUGUCUUGUGUUGCAGCCGG |
Reported expression in cancers: hsa-miR-187-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-187-3p | breast cancer | upregulation | "Ectopic expression studies were carried out in MCF ......" | 23060431 | Microarray; in situ hybridization |
hsa-miR-187-3p | colorectal cancer | downregulation | "MicroRNA 187 a downstream effector of TGFβ pathwa ......" | 26820227 | |
hsa-miR-187-3p | colorectal cancer | downregulation | "However the underlying functions of microRNA-187 m ......" | 27329595 | |
hsa-miR-187-3p | kidney renal cell cancer | downregulation | "Based on the preliminary deep sequencing data we h ......" | 23916610 | RNA-Seq |
hsa-miR-187-3p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-187-3p | liver cancer | downregulation | "miR-187-3p a novel cancer-related microRNA was pre ......" | 27544906 | |
hsa-miR-187-3p | lung cancer | downregulation | "Two lung development related microRNAs miR 134 and ......" | 26642897 | qPCR |
hsa-miR-187-3p | lung squamous cell cancer | downregulation | "Hsa-microRNA-187-3p miR-187-3p has recently been d ......" | 26845350 | |
hsa-miR-187-3p | prostate cancer | downregulation | "Recently we have demonstrated that miR-187 is sign ......" | 25969992 |
Reported cancer pathway affected by hsa-miR-187-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-187-3p | breast cancer | Apoptosis pathway | "Based on the results obtained in the last decade s ......" | 26199650 | |
hsa-miR-187-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "MicroRNA 187 a downstream effector of TGFβ pathwa ......" | 26820227 | |
hsa-miR-187-3p | colorectal cancer | Apoptosis pathway | "MicroRNA 187 inhibits tumor growth and invasion by ......" | 27329595 | Luciferase |
hsa-miR-187-3p | liver cancer | Epithelial mesenchymal transition pathway | "miR 187 3p inhibits the metastasis and epithelial ......" | 27544906 | |
hsa-miR-187-3p | lung cancer | cell cycle pathway | "Two lung development related microRNAs miR 134 and ......" | 26642897 | Flow cytometry |
hsa-miR-187-3p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 187 3p mitigates non small cell lung canc ......" | 26845350 | Colony formation |
Reported cancer prognosis affected by hsa-miR-187-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-187-3p | breast cancer | poor survival | "miR 187 is an independent prognostic factor in bre ......" | 23060431 | |
hsa-miR-187-3p | breast cancer | metastasis; worse prognosis | "Based on the results obtained in the last decade s ......" | 26199650 | |
hsa-miR-187-3p | colorectal cancer | metastasis; worse prognosis | "MicroRNA 187 a downstream effector of TGFβ pathwa ......" | 26820227 | |
hsa-miR-187-3p | colorectal cancer | poor survival; progression | "MicroRNA 187 inhibits tumor growth and invasion by ......" | 27329595 | Luciferase |
hsa-miR-187-3p | kidney renal cell cancer | poor survival; staging; motility | "MicroRNA 187 down regulated in clear cell renal ce ......" | 23916610 | |
hsa-miR-187-3p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-187-3p | liver cancer | metastasis; staging; worse prognosis | "miR 187 3p inhibits the metastasis and epithelial ......" | 27544906 | |
hsa-miR-187-3p | lung squamous cell cancer | progression | "MicroRNA 187 5p suppresses cancer cell progression ......" | 27495872 | |
hsa-miR-187-3p | lymphoma | staging; worse prognosis; progression | "MiR187 was overexpressed in peripheral T-cell lymp ......" | 24104394 | |
hsa-miR-187-3p | ovarian cancer | progression; poor survival; recurrence; tumorigenesis; staging | "Regulation of ovarian cancer progression by microR ......" | 21725366 | Luciferase |
hsa-miR-187-3p | pancreatic cancer | staging; differentiation | "Expressions of miRNAs were determined with the Taq ......" | 22851141 | |
hsa-miR-187-3p | prostate cancer | worse prognosis; staging | "Identification of miR 187 and miR 182 as biomarker ......" | 24518785 | |
hsa-miR-187-3p | thyroid cancer | malignant trasformation | "A limited set of miRNA have been assessed as part ......" | 22771635 |
Reported gene related to hsa-miR-187-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-187-3p | colorectal cancer | CD276 | "MicroRNA 187 inhibits tumor growth and invasion by ......" | 27329595 |
hsa-miR-187-3p | kidney renal cell cancer | CD276 | "MicroRNA 187 down regulated in clear cell renal ce ......" | 23916610 |
hsa-miR-187-3p | prostate cancer | ALDH1A3 | "MiR 187 Targets the Androgen Regulated Gene ALDH1A ......" | 25969992 |
hsa-miR-187-3p | lung squamous cell cancer | BCL6 | "MicroRNA 187 3p mitigates non small cell lung canc ......" | 26845350 |
hsa-miR-187-3p | kidney renal cell cancer | CD80 | "MicroRNA 187 down regulated in clear cell renal ce ......" | 23916610 |
hsa-miR-187-3p | lung squamous cell cancer | CYP1B1 | "MicroRNA 187 5p suppresses cancer cell progression ......" | 27495872 |
hsa-miR-187-3p | ovarian cancer | DAB2 | "Ectopic expression of miR-187 in cancer cells prom ......" | 21725366 |
hsa-miR-187-3p | prostate cancer | F2 | "miR-187 inversely correlated with cT p = 0.125 and ......" | 24518785 |
hsa-miR-187-3p | lymphoma | MYC | "Bortezomib inhibited T-lymphoma cell proliferation ......" | 24104394 |
hsa-miR-187-3p | colorectal cancer | NT5E | "Together with the fact that high SOX4 or NT5E leve ......" | 26820227 |
hsa-miR-187-3p | prostate cancer | PCA3 | "A prediction model including serum prostate specif ......" | 24518785 |
hsa-miR-187-3p | liver cancer | S100A4 | "miR 187 3p inhibits the metastasis and epithelial ......" | 27544906 |
hsa-miR-187-3p | colorectal cancer | SOX4 | "Together with the fact that high SOX4 or NT5E leve ......" | 26820227 |
Expression profile in cancer corhorts: