microRNA information: hsa-miR-18a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-18a-3p | miRbase |
| Accession: | MIMAT0002891 | miRbase |
| Precursor name: | hsa-mir-18a | miRbase |
| Precursor accession: | MI0000072 | miRbase |
| Symbol: | MIR18A | HGNC |
| RefSeq ID: | NR_029488 | GenBank |
| Sequence: | ACUGCCCUAAGUGCUCCUUCUGG |
Reported expression in cancers: hsa-miR-18a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-18a-3p | bladder cancer | deregulation | "Analysis of bladder-associated microRNAs in carcin ......" | 21388952 | |
| hsa-miR-18a-3p | colorectal cancer | upregulation | "Quantitative reverse-transcription PCR was used to ......" | 23267864 | Reverse transcription PCR |
| hsa-miR-18a-3p | colorectal cancer | upregulation | "miR-18a is one of the most up-regulated miRNAs in ......" | 23437304 | |
| hsa-miR-18a-3p | colorectal cancer | upregulation | "microRNA 221 and microRNA 18a identification in st ......" | 25233396 | |
| hsa-miR-18a-3p | gastric cancer | upregulation | "The most highly expressed miRNAs in gastric cancer ......" | 19175831 | |
| hsa-miR-18a-3p | gastric cancer | upregulation | "We identified five miRNAs that were most consisten ......" | 24040025 | qPCR |
| hsa-miR-18a-3p | gastric cancer | upregulation | "MicroRNA microarray was applied to assess the miRN ......" | 24054006 | Microarray |
| hsa-miR-18a-3p | gastric cancer | upregulation | "Diagnostic and prognostic value of circulating miR ......" | 25416437 | qPCR |
| hsa-miR-18a-3p | gastric cancer | upregulation | "MicroRNA-18a miR-18a has been reported to be upreg ......" | 26173586 | |
| hsa-miR-18a-3p | gastric cancer | upregulation | "Plasma samples from 3 independent groups comprise ......" | 26607322 | Microarray |
| hsa-miR-18a-3p | glioblastoma | upregulation | "However the association of miR-18a an important me ......" | 24657544 | qPCR |
| hsa-miR-18a-3p | liver cancer | upregulation | "This study aims to delineate the mechanism underly ......" | 24975878 | |
| hsa-miR-18a-3p | lung squamous cell cancer | deregulation | "Locked nucleic acids miRNA microarray expression p ......" | 20508945 | Microarray |
| hsa-miR-18a-3p | ovarian cancer | deregulation | "The authors used quantitative polymerase chain rea ......" | 25556270 | qPCR |
| hsa-miR-18a-3p | prostate cancer | upregulation | "In this study we found significant upregulation of ......" | 24752237 | |
| hsa-miR-18a-3p | prostate cancer | upregulation | "Increased oncogenic microRNA 18a expression in the ......" | 26893719 | qPCR |
Reported cancer pathway affected by hsa-miR-18a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-18a-3p | breast cancer | Apoptosis pathway | "MiR 18a upregulation decreases Dicer expression an ......" | 27338043 | Western blot |
| hsa-miR-18a-3p | breast cancer | cell cycle pathway | "Long non coding RNA UCA1 enhances tamoxifen resist ......" | 27629141 | |
| hsa-miR-18a-3p | cervical and endocervical cancer | Apoptosis pathway | "MicroRNA 18a enhances the radiosensitivity of cerv ......" | 25963391 | |
| hsa-miR-18a-3p | colon cancer | Apoptosis pathway | "microRNA 18a induces apoptosis in colon cancer cel ......" | 24166503 | MTT assay |
| hsa-miR-18a-3p | colorectal cancer | Apoptosis pathway | "MicroRNA 18a attenuates DNA damage repair through ......" | 23437304 | Western blot; Luciferase; Colony formation |
| hsa-miR-18a-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "miR 18a inhibits CDC42 and plays a tumour suppress ......" | 25379703 | Luciferase |
| hsa-miR-18a-3p | esophageal cancer | mTOR signaling pathway | "miR 18a promotes cell proliferation of esophageal ......" | 27291152 | |
| hsa-miR-18a-3p | gastric cancer | mTOR signaling pathway | "The role of miR 18a in gastric cancer angiogenesis ......" | 24624454 | MTT assay; Western blot |
| hsa-miR-18a-3p | gastric cancer | p53 signaling pathway | "MicroRNA 18a modulates P53 expression by targeting ......" | 26173586 | Western blot |
| hsa-miR-18a-3p | gastric cancer | Apoptosis pathway | "microRNA 18a regulates gastric carcinoma cell apop ......" | 26622381 | Flow cytometry; Luciferase |
| hsa-miR-18a-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "MiR 18a regulates the proliferation migration and ......" | 24657544 | Luciferase; Western blot; Flow cytometry; Transwell assay |
| hsa-miR-18a-3p | liver cancer | Apoptosis pathway | "The relationship between microRNA 18 and BTG2 in t ......" | 19203451 | |
| hsa-miR-18a-3p | prostate cancer | Apoptosis pathway | "MicroRNA 18a is elevated in prostate cancer and pr ......" | 24752237 | Luciferase |
Reported cancer prognosis affected by hsa-miR-18a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-18a-3p | B cell lymphoma | poor survival; progression | "We measured the expression of each miRNA by quanti ......" | 21525173 | |
| hsa-miR-18a-3p | breast cancer | staging | "Global miRNA analysis was performed on serum from ......" | 24694649 | |
| hsa-miR-18a-3p | breast cancer | metastasis; drug resistance; cell migration; poor survival | "MicroRNA 18a inhibits hypoxia inducible factor 1α ......" | 25069832 | Luciferase |
| hsa-miR-18a-3p | breast cancer | drug resistance; progression | "MiR 18a upregulation decreases Dicer expression an ......" | 27338043 | Western blot |
| hsa-miR-18a-3p | breast cancer | staging | "We employed qRT-PCR to determine expression level ......" | 27596294 | |
| hsa-miR-18a-3p | breast cancer | drug resistance | "Long non coding RNA UCA1 enhances tamoxifen resist ......" | 27629141 | |
| hsa-miR-18a-3p | breast cancer | metastasis | "Ginsenoside Rd attenuates breast cancer metastasis ......" | 27641158 | |
| hsa-miR-18a-3p | cervical and endocervical cancer | drug resistance | "MicroRNA 18a enhances the radiosensitivity of cerv ......" | 25963391 | |
| hsa-miR-18a-3p | colon cancer | progression | "MicroRNA 18a upregulates autophagy and ataxia tela ......" | 23229340 | Western blot; Luciferase |
| hsa-miR-18a-3p | colon cancer | progression | "microRNA 18a induces apoptosis in colon cancer cel ......" | 24166503 | MTT assay |
| hsa-miR-18a-3p | colon cancer | metastasis | "However higher levels of the miR-17~92 cluster swi ......" | 24681249 | |
| hsa-miR-18a-3p | colon cancer | metastasis | "Grapefruit derived nanovectors deliver miR 18a for ......" | 27028860 | |
| hsa-miR-18a-3p | colorectal cancer | worse prognosis | "The expression profiles of miRNAs were determined ......" | 19287964 | |
| hsa-miR-18a-3p | colorectal cancer | poor survival | "MicroRNA 18a attenuates DNA damage repair through ......" | 23437304 | Western blot; Luciferase; Colony formation |
| hsa-miR-18a-3p | colorectal cancer | staging | "In the present study we measured the levels of fiv ......" | 23625654 | |
| hsa-miR-18a-3p | colorectal cancer | staging | "microRNA expression profile in stage III colorecta ......" | 23673725 | |
| hsa-miR-18a-3p | colorectal cancer | staging | "microRNA 221 and microRNA 18a identification in st ......" | 25233396 | |
| hsa-miR-18a-3p | colorectal cancer | progression; cell migration | "miR 18a inhibits CDC42 and plays a tumour suppress ......" | 25379703 | Luciferase |
| hsa-miR-18a-3p | colorectal cancer | progression | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
| hsa-miR-18a-3p | esophageal cancer | staging; progression; poor survival | "MicroRNA 17 microRNA 18a and microRNA 19a are prog ......" | 24360091 | |
| hsa-miR-18a-3p | esophageal cancer | drug resistance | "An in-vitro model of acquired chemotherapy resista ......" | 25356050 | |
| hsa-miR-18a-3p | esophageal cancer | poor survival | "miRNA high-throughput sequencing data were downloa ......" | 26498375 | |
| hsa-miR-18a-3p | gastric cancer | progression | "The role of miR 18a in gastric cancer angiogenesis ......" | 24624454 | MTT assay; Western blot |
| hsa-miR-18a-3p | gastric cancer | staging; poor survival; worse prognosis | "Diagnostic and prognostic value of circulating miR ......" | 25416437 | |
| hsa-miR-18a-3p | gastric cancer | poor survival; worse prognosis | "MicroRNA 18a modulates P53 expression by targeting ......" | 26173586 | Western blot |
| hsa-miR-18a-3p | glioblastoma | poor survival | "Targeting of TGFβ signature and its essential com ......" | 23249750 | |
| hsa-miR-18a-3p | head and neck cancer | poor survival | "Our findings showed that significant elevated expr ......" | 25677760 | |
| hsa-miR-18a-3p | liver cancer | tumorigenesis; differentiation | "The relationship between microRNA 18 and BTG2 in t ......" | 19203451 | |
| hsa-miR-18a-3p | liver cancer | tumorigenesis | "Elevated p53 promotes the processing of miR 18a to ......" | 24975878 | |
| hsa-miR-18a-3p | lung squamous cell cancer | drug resistance; staging; metastasis; differentiation | "Effect of miR 18a overexpression on the radiosensi ......" | 25755757 | |
| hsa-miR-18a-3p | ovarian cancer | worse prognosis | "The microRNA expression profiles were examined usi ......" | 18451233 | |
| hsa-miR-18a-3p | prostate cancer | tumorigenesis | "MicroRNA 18a is elevated in prostate cancer and pr ......" | 24752237 | Luciferase |
| hsa-miR-18a-3p | prostate cancer | staging; progression | "Increased oncogenic microRNA 18a expression in the ......" | 26893719 | |
| hsa-miR-18a-3p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 |
Reported gene related to hsa-miR-18a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-18a-3p | breast cancer | ATM | "Furthermore we used antisense oligonucleotides aga ......" | 23857602 |
| hsa-miR-18a-3p | cervical and endocervical cancer | ATM | "However the upregulation of miR-18a suppressed the ......" | 25963391 |
| hsa-miR-18a-3p | colon cancer | ATM | "MicroRNA 18a upregulates autophagy and ataxia tela ......" | 23229340 |
| hsa-miR-18a-3p | colorectal cancer | ATM | "MicroRNA 18a attenuates DNA damage repair through ......" | 23437304 |
| hsa-miR-18a-3p | colorectal cancer | CCND1 | "Inhibition of CCND1 by miR-18a may also assist in ......" | 25379703 |
| hsa-miR-18a-3p | esophageal cancer | CCND1 | "Transfection of miR-18a mimetics increased cyclin ......" | 27291152 |
| hsa-miR-18a-3p | bladder cancer | DICER1 | "microRNA 18a a member of the oncogenic miR 17 92 c ......" | 21935572 |
| hsa-miR-18a-3p | breast cancer | DICER1 | "MiR 18a upregulation decreases Dicer expression an ......" | 27338043 |
| hsa-miR-18a-3p | liver cancer | ESR1 | "MicroRNA 18a prevents estrogen receptor alpha expr ......" | 19027010 |
| hsa-miR-18a-3p | liver cancer | ESR1 | "Elevated p53 promotes the processing of miR 18a to ......" | 24975878 |
| hsa-miR-18a-3p | colon cancer | IRF2 | "Furthermore the miR-18a mediated induction of macr ......" | 27028860 |
| hsa-miR-18a-3p | gastric cancer | IRF2 | "MicroRNA 18a modulates P53 expression by targeting ......" | 26173586 |
| hsa-miR-18a-3p | esophageal cancer | MTOR | "miR 18a promotes cell proliferation of esophageal ......" | 27291152 |
| hsa-miR-18a-3p | gastric cancer | MTOR | "Because of the key role of mammalian target of rap ......" | 24624454 |
| hsa-miR-18a-3p | colon cancer | PTEN | "However higher levels of the miR-17~92 cluster swi ......" | 24681249 |
| hsa-miR-18a-3p | esophageal cancer | PTEN | "miR 18a promotes cell proliferation of esophageal ......" | 27291152 |
| hsa-miR-18a-3p | gastric cancer | TP53 | "MicroRNA 18a modulates P53 expression by targeting ......" | 26173586 |
| hsa-miR-18a-3p | liver cancer | TP53 | "Elevated p53 promotes the processing of miR 18a to ......" | 24975878 |
| hsa-miR-18a-3p | colorectal cancer | ACAD8 | "Data analysis of miRNA from the training set showe ......" | 27135244 |
| hsa-miR-18a-3p | breast cancer | AGO2 | "miRNA-mRNA interactions AGO2 immunoprecipitation a ......" | 25069832 |
| hsa-miR-18a-3p | liver cancer | BTG2 | "The relationship between microRNA 18 and BTG2 in t ......" | 19203451 |
| hsa-miR-18a-3p | liver cancer | BTG3 | "Furthermore the expression of B-cell translocation ......" | 19203451 |
| hsa-miR-18a-3p | colorectal cancer | CASC2 | "The long noncoding RNA CASC2 functions as a compet ......" | 27198161 |
| hsa-miR-18a-3p | colorectal cancer | CDC42 | "miR 18a inhibits CDC42 and plays a tumour suppress ......" | 25379703 |
| hsa-miR-18a-3p | colorectal cancer | CDK19 | "NEDD9 and CDK19 were identified as novel miR-18a t ......" | 22308110 |
| hsa-miR-18a-3p | glioblastoma | CTGF | "Targeting of TGFβ signature and its essential com ......" | 23249750 |
| hsa-miR-18a-3p | colon cancer | CTNNB1 | "However higher levels of the miR-17~92 cluster swi ......" | 24681249 |
| hsa-miR-18a-3p | colorectal cancer | FGD1 | "Only miR18a was confirmed to be significantly up-r ......" | 23267864 |
| hsa-miR-18a-3p | gastric cancer | GLS | "In this study miR-18a expression in gastric adenoc ......" | 26173586 |
| hsa-miR-18a-3p | breast cancer | HIF1A | "Last clinically relevant correlations between miR- ......" | 25069832 |
| hsa-miR-18a-3p | colon cancer | HNRNPA1 | "In vitro single and in vivo double isotope assays ......" | 24166503 |
| hsa-miR-18a-3p | colon cancer | IL12A | "Furthermore the miR-18a mediated induction of macr ......" | 27028860 |
| hsa-miR-18a-3p | colorectal cancer | NEDD9 | "NEDD9 and CDK19 were identified as novel miR-18a t ......" | 22308110 |
| hsa-miR-18a-3p | glioblastoma | NEO1 | "MiR 18a regulates the proliferation migration and ......" | 24657544 |
| hsa-miR-18a-3p | esophageal cancer | PCNA | "Transfection of miR-18a mimetics increased cyclin ......" | 27291152 |
| hsa-miR-18a-3p | colorectal cancer | PIAS3 | "Further functional experiments indicate that CASC2 ......" | 27198161 |
| hsa-miR-18a-3p | breast cancer | SMAD2 | "Ginsenoside Rd attenuates breast cancer metastasis ......" | 27641158 |
| hsa-miR-18a-3p | glioblastoma | SMAD3 | "The unexpected effects of miR-18a on CTGF transcri ......" | 23249750 |
| hsa-miR-18a-3p | prostate cancer | STK4 | "MicroRNA 18a is elevated in prostate cancer and pr ......" | 24752237 |
| hsa-miR-18a-3p | colorectal cancer | TBPL1 | "Tumor suppressor microRNA 18a regulates tumor prol ......" | 26398009 |
| hsa-miR-18a-3p | breast cancer | UCA1 | "Long non coding RNA UCA1 enhances tamoxifen resist ......" | 27629141 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-18a-3p | ATP8B2 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.184; TCGA CESC -0.174; TCGA COAD -0.369; TCGA ESCA -0.343; TCGA HNSC -0.177; TCGA LUSC -0.153; TCGA PAAD -0.164; TCGA STAD -0.332; TCGA UCEC -0.191 |
hsa-miR-18a-3p | CLU | 9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.57; TCGA COAD -0.479; TCGA ESCA -0.343; TCGA HNSC -0.481; TCGA LUSC -0.324; TCGA OV -0.572; TCGA PAAD -0.304; TCGA STAD -0.479; TCGA UCEC -0.445 |
hsa-miR-18a-3p | NOTCH4 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.144; TCGA CESC -0.12; TCGA COAD -0.167; TCGA ESCA -0.122; TCGA HNSC -0.129; TCGA LUSC -0.372; TCGA PAAD -0.099; TCGA STAD -0.075; TCGA UCEC -0.217 |
hsa-miR-18a-3p | THSD4 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.118; TCGA CESC -0.183; TCGA COAD -0.201; TCGA ESCA -0.376; TCGA HNSC -0.186; TCGA LUSC -0.184; TCGA OV -0.306; TCGA PAAD -0.293; TCGA STAD -0.309; TCGA UCEC -0.153 |
hsa-miR-18a-3p | HSPB7 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.792; TCGA CESC -0.524; TCGA COAD -0.793; TCGA ESCA -0.978; TCGA HNSC -0.631; TCGA LUSC -0.591; TCGA PAAD -0.331; TCGA STAD -0.984; TCGA UCEC -0.793 |
hsa-miR-18a-3p | TEF | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.124; TCGA CESC -0.21; TCGA COAD -0.111; TCGA ESCA -0.276; TCGA HNSC -0.161; TCGA LUSC -0.106; TCGA OV -0.189; TCGA STAD -0.273; TCGA UCEC -0.302 |
hsa-miR-18a-3p | MSRB3 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.427; TCGA COAD -0.566; TCGA ESCA -0.568; TCGA HNSC -0.289; TCGA LUSC -0.482; TCGA OV -0.208; TCGA PAAD -0.305; TCGA STAD -0.566; TCGA UCEC -0.528 |
hsa-miR-18a-3p | GIT2 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.065; TCGA COAD -0.055; TCGA ESCA -0.088; TCGA HNSC -0.07; TCGA LUSC -0.105; TCGA OV -0.062; TCGA PAAD -0.066; TCGA STAD -0.123; TCGA UCEC -0.081 |
hsa-miR-18a-3p | CBX7 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.317; TCGA CESC -0.364; TCGA COAD -0.177; TCGA ESCA -0.471; TCGA HNSC -0.316; TCGA LUSC -0.282; TCGA OV -0.388; TCGA PAAD -0.16; TCGA STAD -0.429; TCGA UCEC -0.513 |
hsa-miR-18a-3p | FAM19A5 | 9 cancers: BLCA; CESC; COAD; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.467; TCGA CESC -0.444; TCGA COAD -0.4; TCGA HNSC -0.281; TCGA LUSC -0.183; TCGA OV -0.317; TCGA PAAD -0.266; TCGA STAD -0.18; TCGA UCEC -0.301 |
hsa-miR-18a-3p | RCSD1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.155; TCGA CESC -0.145; TCGA COAD -0.27; TCGA ESCA -0.242; TCGA HNSC -0.291; TCGA LUSC -0.426; TCGA OV -0.138; TCGA STAD -0.269; TCGA UCEC -0.198 |
hsa-miR-18a-3p | TIMP2 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.3; TCGA CESC -0.246; TCGA COAD -0.429; TCGA ESCA -0.261; TCGA HNSC -0.277; TCGA LUSC -0.385; TCGA OV -0.123; TCGA PAAD -0.106; TCGA STAD -0.268; TCGA UCEC -0.289 |
hsa-miR-18a-3p | MGLL | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.115; TCGA CESC -0.148; TCGA COAD -0.112; TCGA ESCA -0.229; TCGA HNSC -0.289; TCGA LUSC -0.431; TCGA OV -0.257; TCGA STAD -0.177; TCGA UCEC -0.206 |
hsa-miR-18a-3p | MEF2C | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.272; TCGA CESC -0.252; TCGA COAD -0.318; TCGA ESCA -0.239; TCGA HNSC -0.409; TCGA LUSC -0.413; TCGA OV -0.155; TCGA PAAD -0.155; TCGA STAD -0.332; TCGA UCEC -0.424 |
hsa-miR-18a-3p | KLF9 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.318; TCGA CESC -0.272; TCGA COAD -0.28; TCGA ESCA -0.371; TCGA HNSC -0.281; TCGA LUSC -0.384; TCGA OV -0.154; TCGA PAAD -0.147; TCGA STAD -0.394; TCGA UCEC -0.384 |
hsa-miR-18a-3p | ZMAT3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.194; TCGA CESC -0.196; TCGA COAD -0.198; TCGA ESCA -0.156; TCGA HNSC -0.256; TCGA OV -0.102; TCGA PAAD -0.183; TCGA STAD -0.121; TCGA UCEC -0.134 |
hsa-miR-18a-3p | ACVRL1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.176; TCGA CESC -0.15; TCGA COAD -0.137; TCGA ESCA -0.126; TCGA HNSC -0.132; TCGA LUSC -0.469; TCGA OV -0.107; TCGA PAAD -0.103; TCGA STAD -0.086; TCGA UCEC -0.22 |
hsa-miR-18a-3p | ERMAP | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.058; TCGA CESC -0.073; TCGA COAD -0.072; TCGA ESCA -0.133; TCGA HNSC -0.111; TCGA LUSC -0.086; TCGA OV -0.155; TCGA PAAD -0.063; TCGA STAD -0.084; TCGA UCEC -0.139 |
hsa-miR-18a-3p | TACC1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.273; TCGA CESC -0.17; TCGA COAD -0.127; TCGA ESCA -0.215; TCGA HNSC -0.183; TCGA LUSC -0.279; TCGA OV -0.273; TCGA PAAD -0.114; TCGA STAD -0.251; TCGA UCEC -0.435 |
hsa-miR-18a-3p | FGF7 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.556; TCGA CESC -0.442; TCGA COAD -0.452; TCGA ESCA -0.605; TCGA HNSC -0.468; TCGA LUSC -0.45; TCGA OV -0.367; TCGA PAAD -0.269; TCGA STAD -0.492; TCGA UCEC -0.684 |
hsa-miR-18a-3p | XYLT1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.206; TCGA CESC -0.36; TCGA COAD -0.104; TCGA ESCA -0.17; TCGA HNSC -0.345; TCGA LUSC -0.198; TCGA OV -0.239; TCGA STAD -0.118; TCGA UCEC -0.468 |
hsa-miR-18a-3p | KIAA0513 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.305; TCGA CESC -0.163; TCGA COAD -0.239; TCGA ESCA -0.307; TCGA HNSC -0.193; TCGA LUSC -0.295; TCGA OV -0.156; TCGA STAD -0.222; TCGA UCEC -0.19 |
hsa-miR-18a-3p | SCN2B | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.373; TCGA CESC -0.274; TCGA COAD -0.773; TCGA ESCA -0.765; TCGA HNSC -0.383; TCGA LUSC -0.66; TCGA OV -0.428; TCGA PAAD -0.451; TCGA STAD -0.83; TCGA UCEC -0.546 |
hsa-miR-18a-3p | GNG7 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.357; TCGA CESC -0.379; TCGA COAD -0.373; TCGA ESCA -0.578; TCGA HNSC -0.393; TCGA LUSC -0.411; TCGA OV -0.221; TCGA PAAD -0.177; TCGA STAD -0.502; TCGA UCEC -0.492 |
hsa-miR-18a-3p | AR | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.291; TCGA CESC -0.578; TCGA COAD -0.663; TCGA ESCA -0.612; TCGA HNSC -0.796; TCGA LUSC -0.474; TCGA PAAD -0.304; TCGA STAD -0.58; TCGA UCEC -0.518 |
hsa-miR-18a-3p | ESR1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.359; TCGA CESC -0.584; TCGA COAD -0.53; TCGA ESCA -0.441; TCGA HNSC -0.257; TCGA LUSC -0.367; TCGA OV -0.39; TCGA PAAD -0.267; TCGA STAD -0.367; TCGA UCEC -0.395 |
hsa-miR-18a-3p | ZBTB4 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.137; TCGA CESC -0.112; TCGA COAD -0.192; TCGA ESCA -0.267; TCGA HNSC -0.126; TCGA LUSC -0.215; TCGA OV -0.226; TCGA PAAD -0.108; TCGA STAD -0.268; TCGA UCEC -0.261 |
hsa-miR-18a-3p | JPH4 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.306; TCGA CESC -0.336; TCGA COAD -0.44; TCGA ESCA -0.357; TCGA HNSC -0.167; TCGA LUSC -0.31; TCGA PAAD -0.238; TCGA STAD -0.348; TCGA UCEC -0.735 |
hsa-miR-18a-3p | DLC1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.256; TCGA CESC -0.232; TCGA COAD -0.288; TCGA ESCA -0.226; TCGA HNSC -0.201; TCGA LUSC -0.599; TCGA PAAD -0.158; TCGA STAD -0.279; TCGA UCEC -0.313 |
Enriched cancer pathways of putative targets