microRNA information: hsa-miR-18b-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-18b-5p | miRbase |
Accession: | MIMAT0001412 | miRbase |
Precursor name: | hsa-mir-18b | miRbase |
Precursor accession: | MI0001518 | miRbase |
Symbol: | MIR18B | HGNC |
RefSeq ID: | NR_029949 | GenBank |
Sequence: | UAAGGUGCAUCUAGUGCAGUUAG |
Reported expression in cancers: hsa-miR-18b-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-18b-5p | breast cancer | upregulation | "microRNA 18b is upregulated in breast cancer and m ......" | 23970382 | |
hsa-miR-18b-5p | esophageal cancer | downregulation | "The relative expression of some candidate miRNAs w ......" | 24155113 | qPCR |
hsa-miR-18b-5p | gastric cancer | upregulation | "The most highly expressed miRNAs in gastric cancer ......" | 19175831 | |
hsa-miR-18b-5p | liver cancer | downregulation | "The expression level of miR 18b in hepatocellular ......" | 23496901 | Microarray |
hsa-miR-18b-5p | lung cancer | deregulation | "The expression of 319 miRNAs was evaluated by Exiq ......" | 20818338 | Microarray |
Reported cancer pathway affected by hsa-miR-18b-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-18b-5p | liver cancer | Apoptosis pathway | "To study the difference of microRNA expression bet ......" | 19203451 | |
hsa-miR-18b-5p | lymphoma | Apoptosis pathway | "miR 18b overexpression identifies mantle cell lymp ......" | 25736311 | |
hsa-miR-18b-5p | melanoma | cell cycle pathway; Apoptosis pathway | "The role of miR 18b in MDM2 p53 pathway signaling ......" | 23365201 | Colony formation |
Reported cancer prognosis affected by hsa-miR-18b-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-18b-5p | breast cancer | poor survival | "In this study expression levels of miRNAs that dir ......" | 21755340 | |
hsa-miR-18b-5p | breast cancer | cell migration; metastasis | "microRNA 18b is upregulated in breast cancer and m ......" | 23970382 | |
hsa-miR-18b-5p | breast cancer | poor survival | "We performed genome-wide serum miRNA expression an ......" | 25547678 | |
hsa-miR-18b-5p | colon cancer | staging | "We assessed by qRT-PCR expression of 754 microRNAs ......" | 27485175 | |
hsa-miR-18b-5p | colorectal cancer | progression | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
hsa-miR-18b-5p | glioblastoma | poor survival | "Targeting of TGFβ signature and its essential com ......" | 23249750 | |
hsa-miR-18b-5p | liver cancer | differentiation | "To study the difference of microRNA expression bet ......" | 19203451 | |
hsa-miR-18b-5p | liver cancer | worse prognosis; progression | "The expression level of miR 18b in hepatocellular ......" | 23496901 | |
hsa-miR-18b-5p | lymphoma | worse prognosis; drug resistance | "miR 18b overexpression identifies mantle cell lymp ......" | 25736311 | |
hsa-miR-18b-5p | melanoma | progression; cell migration | "The role of miR 18b in MDM2 p53 pathway signaling ......" | 23365201 | Colony formation |
hsa-miR-18b-5p | ovarian cancer | drug resistance | "Analysis of microarray identified genes and microR ......" | 26261572 | |
hsa-miR-18b-5p | prostate cancer | drug resistance | "To screen for epigenetically silenced miRNAs in pr ......" | 22310291 | |
hsa-miR-18b-5p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 |
Reported gene related to hsa-miR-18b-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-18b-5p | liver cancer | AGO2 | "Based on miRanda and Targetscan target search algo ......" | 23496901 |
hsa-miR-18b-5p | liver cancer | BTG2 | "Furthermore the expression of B-cell translocation ......" | 19203451 |
hsa-miR-18b-5p | liver cancer | BTG3 | "Furthermore the expression of B-cell translocation ......" | 19203451 |
hsa-miR-18b-5p | glioblastoma | CTGF | "Targeting of TGFβ signature and its essential com ......" | 23249750 |
hsa-miR-18b-5p | melanoma | MDM2 | "The role of miR 18b in MDM2 p53 pathway signaling ......" | 23365201 |
hsa-miR-18b-5p | liver cancer | TNRC6B | "Based on miRanda and Targetscan target search algo ......" | 23496901 |
hsa-miR-18b-5p | melanoma | TP53 | "The role of miR 18b in MDM2 p53 pathway signaling ......" | 23365201 |