microRNA information: hsa-miR-190b
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-190b | miRbase |
Accession: | MIMAT0004929 | miRbase |
Precursor name: | hsa-mir-190b | miRbase |
Precursor accession: | MI0005545 | miRbase |
Symbol: | MIR190B | HGNC |
RefSeq ID: | NR_030600 | GenBank |
Sequence: | UGAUAUGUUUGAUAUUGGGUU |
Reported expression in cancers: hsa-miR-190b
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-190b | breast cancer | upregulation | "MiR 190b the highest up regulated miRNA in ERα po ......" | 26141719 | Microarray; qPCR |
hsa-miR-190b | liver cancer | upregulation | "Up regulation of microRNA 190b plays a role for de ......" | 24586785 | |
hsa-miR-190b | pancreatic cancer | upregulation | "Profiling of 95 microRNAs in pancreatic cancer cel ......" | 19030927 | qPCR |
Reported cancer pathway affected by hsa-miR-190b
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-190b
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-190b | breast cancer | metastasis; poor survival; tumorigenesis | "MiR 190b the highest up regulated miRNA in ERα po ......" | 26141719 | |
hsa-miR-190b | liver cancer | drug resistance | "Up regulation of microRNA 190b plays a role for de ......" | 24586785 | Western blot; Luciferase |
Reported gene related to hsa-miR-190b
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-190b | gastric cancer | FOXP2 | "To investigate how microRNA-190 miR-190 regulates ......" | 27382302 |