microRNA information: hsa-miR-192-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-192-3p | miRbase |
| Accession: | MIMAT0004543 | miRbase |
| Precursor name: | hsa-mir-192 | miRbase |
| Precursor accession: | MI0000234 | miRbase |
| Symbol: | MIR192 | HGNC |
| RefSeq ID: | NR_029578 | GenBank |
| Sequence: | CUGCCAAUUCCAUAGGUCACAG |
Reported expression in cancers: hsa-miR-192-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-192-3p | colon cancer | upregulation | "MicroRNA 192 suppresses liver metastasis of colon ......" | 24213572 | |
| hsa-miR-192-3p | colorectal cancer | downregulation | "microRNA 192 194 and 215 are frequently downregula ......" | 22969930 | qPCR |
| hsa-miR-192-3p | gastric cancer | downregulation | "Expression levels of microRNA 192 and 215 in gastr 0.05 paired t-test. Also the down-regulation of miR-192 and -215 was demonstrated to be associated with increased tumor sizes both p = 0.003 Mann-Whitney U test and advanced Borrmann type tumors p = 0.015 and p = 0.044 respectively Kruskal-Wallis H test. Furthermore there was a strong correlation between miR-192 and -215 in gastric cancer tissues p < 0.001 Pearson regressions. miR-192 and -215 might be related to the proliferation and invasion of gastric cancer"> ......" | 22205577 | qPCR |
| hsa-miR-192-3p | gastric cancer | upregulation | "Plasma miR 122 and miR 192 as potential novel biom ......" | 24481716 | Reverse transcription PCR; qPCR |
| hsa-miR-192-3p | kidney renal cell cancer | downregulation | "miR 192 miR 194 and miR 215: a convergent microRNA ......" | 23715501 | |
| hsa-miR-192-3p | pancreatic cancer | upregulation | "Metformin up-regulated the expression of miR-26a m ......" | 22245693 | |
| hsa-miR-192-3p | pancreatic cancer | downregulation | "Early Epigenetic Downregulation of microRNA 192 Ex ......" | 27216198 | |
| hsa-miR-192-3p | retinoblastoma | downregulation | "Analysis of miRNA expression in clinical samples s ......" | 21511813 | |
| hsa-miR-192-3p | sarcoma | downregulation | "However the pathophysiological role of miR-192 and ......" | 27683056 | qPCR |
Reported cancer pathway affected by hsa-miR-192-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-192-3p | bladder cancer | cell cycle pathway; Apoptosis pathway | "Regulation of growth of human bladder cancer by mi ......" | 25566965 | MTT assay; Flow cytometry; Western blot |
| hsa-miR-192-3p | breast cancer | cell cycle pathway | "BMP 6 inhibits cell proliferation by targeting mic ......" | 24012720 | |
| hsa-miR-192-3p | colon cancer | Apoptosis pathway | "MicroRNA 192 suppresses liver metastasis of colon ......" | 24213572 | |
| hsa-miR-192-3p | gastric cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 192 and 215 are upregulated in human gast ......" | 21119604 | Western blot; Luciferase |
| hsa-miR-192-3p | lung cancer | Apoptosis pathway | "MiR 192 confers cisplatin resistance by targeting ......" | 24854555 | Western blot; Luciferase |
| hsa-miR-192-3p | lung squamous cell cancer | Apoptosis pathway | "Curcumin promotes apoptosis by activating the p53 ......" | 25444916 | |
| hsa-miR-192-3p | lung squamous cell cancer | PI3K/Akt signaling pathway; Apoptosis pathway | "Curcumin inhibits cell proliferation and induces a ......" | 26351877 | |
| hsa-miR-192-3p | ovarian cancer | cell cycle pathway | "Pro-proliferative and anti-proliferative miRNAs in ......" | 23588298 | |
| hsa-miR-192-3p | pancreatic cancer | Epithelial mesenchymal transition pathway | "Early Epigenetic Downregulation of microRNA 192 Ex ......" | 27216198 | |
| hsa-miR-192-3p | prostate cancer | cell cycle pathway | "MiR 192 suppresses the tumorigenicity of prostate ......" | 26743688 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-192-3p | retinoblastoma | Apoptosis pathway | "MicroRNA 192 targeting retinoblastoma 1 inhibits c ......" | 21511813 | |
| hsa-miR-192-3p | sarcoma | Apoptosis pathway | "Upregulation of miR 192 inhibits cell growth and i ......" | 27683056 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-192-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-192-3p | bladder cancer | progression | "Regulation of growth of human bladder cancer by mi ......" | 25566965 | MTT assay; Flow cytometry; Western blot |
| hsa-miR-192-3p | breast cancer | progression | "BMP 6 inhibits cell proliferation by targeting mic ......" | 24012720 | |
| hsa-miR-192-3p | breast cancer | drug resistance | "MiR 192 Mediated Positive Feedback Loop Controls t ......" | 26642352 | |
| hsa-miR-192-3p | colon cancer | metastasis; drug resistance; staging; progression | "MicroRNA 192 suppresses liver metastasis of colon ......" | 24213572 | |
| hsa-miR-192-3p | colorectal cancer | tumor size; tumorigenesis | "microRNA 192 194 and 215 are frequently downregula ......" | 22969930 | |
| hsa-miR-192-3p | colorectal cancer | poor survival | "A total of 1893 carcinoma samples were run on the ......" | 27198570 | |
| hsa-miR-192-3p | colorectal cancer | poor survival | "The expression levels of miR-206 miR-219 miR-192 m ......" | 27666868 | |
| hsa-miR-192-3p | colorectal cancer | staging; poor survival | "Significant inverse correlation between the expres ......" | 27747302 | |
| hsa-miR-192-3p | esophageal cancer | staging; drug resistance | "MicroRNA profiling in locally advanced esophageal ......" | 23649428 | |
| hsa-miR-192-3p | gastric cancer | cell migration | "MicroRNA 192 and 215 are upregulated in human gast ......" | 21119604 | Western blot; Luciferase |
| hsa-miR-192-3p | gastric cancer | staging; tumor size | "Expression levels of microRNA 192 and 215 in gastr 0.05 paired t-test; Interestingly miR-192 and -215 were down-regulated in MGC-803 cells BGC-823 cells and SGC-7901 cells all p < 0.01 paired t-test; Also the down-regulation of miR-192 and -215 was demonstrated to be associated with increased tumor sizes both p = 0.003 Mann-Whitney U test and advanced Borrmann type tumors p = 0.015 and p = 0.044 respectively Kruskal-Wallis H test; Moreover the expression of miR-192 was significantly lower in the pT4 stage of gastric cancer than in pT1 pT2 and pT3 stages p = 0.026; Furthermore there was a strong correlation between miR-192 and -215 in gastric cancer tissues p < 0.001 Pearson regressions; miR-192 and -215 might be related to the proliferation and invasion of gastric cancer"> ......" | 22205577 | |
| hsa-miR-192-3p | gastric cancer | metastasis; worse prognosis; poor survival | "Plasma miR 122 and miR 192 as potential novel biom ......" | 24481716 | |
| hsa-miR-192-3p | gastric cancer | tumorigenesis | "However the role of miR-215 or miR-192 in gastric ......" | 24981590 | |
| hsa-miR-192-3p | kidney renal cell cancer | progression | "miR 192 miR 194 and miR 215: a convergent microRNA ......" | 23715501 | Luciferase |
| hsa-miR-192-3p | liver cancer | metastasis | "MicroRNA 192 5p Promote the Proliferation and Meta ......" | 26580097 | Flow cytometry |
| hsa-miR-192-3p | liver cancer | metastasis; cell migration; poor survival | "miR 192 a prognostic indicator targets the SLC39A6 ......" | 26684241 | |
| hsa-miR-192-3p | lung cancer | drug resistance | "MiR 192 confers cisplatin resistance by targeting ......" | 24854555 | Western blot; Luciferase |
| hsa-miR-192-3p | lung cancer | drug resistance | "MicroRNA 192 regulates chemo resistance of lung ad ......" | 26550150 | Western blot; MTT assay |
| hsa-miR-192-3p | lung squamous cell cancer | poor survival | "The 3-miRNA panel expression miR-192 miR-200c and ......" | 27153322 | |
| hsa-miR-192-3p | ovarian cancer | staging | "The aim of this study was to investigate whether m ......" | 22340095 | Western blot |
| hsa-miR-192-3p | pancreatic cancer | progression | "Early Epigenetic Downregulation of microRNA 192 Ex ......" | 27216198 | |
| hsa-miR-192-3p | retinoblastoma | tumorigenesis | "MicroRNA 192 targeting retinoblastoma 1 inhibits c ......" | 21511813 |
Reported gene related to hsa-miR-192-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-192-3p | breast cancer | TP53 | "MiR 192 Mediated Positive Feedback Loop Controls t ......" | 26642352 |
| hsa-miR-192-3p | lung squamous cell cancer | TP53 | "Curcumin promotes apoptosis by activating the p53 ......" | 25444916 |
| hsa-miR-192-3p | liver cancer | AGO2 | "In the current study we identified miR-192 and miR ......" | 26710269 |
| hsa-miR-192-3p | gastric cancer | ALCAM | "MicroRNA 192 and 215 are upregulated in human gast ......" | 21119604 |
| hsa-miR-192-3p | lung cancer | BCL2 | "MicroRNA 192 regulates chemo resistance of lung ad ......" | 26550150 |
| hsa-miR-192-3p | lung cancer | BCL2L11 | "MiR 192 confers cisplatin resistance by targeting ......" | 24854555 |
| hsa-miR-192-3p | breast cancer | BMP6 | "BMP 6 inhibits cell proliferation by targeting mic ......" | 24012720 |
| hsa-miR-192-3p | retinoblastoma | CASP7 | "Both caspase-7 and the PARP protein were activated ......" | 21511813 |
| hsa-miR-192-3p | gastric cancer | DMPK | "Our results demonstrated that assessment of decrea ......" | 24481716 |
| hsa-miR-192-3p | liver cancer | HOTTIP | "In the current study we identified miR-192 and miR ......" | 26710269 |
| hsa-miR-192-3p | prostate cancer | MAP2K6 | "Furthermore miR-192 inhibited the expression of p3 ......" | 26743688 |
| hsa-miR-192-3p | prostate cancer | NIN | "MiR 192 suppresses the tumorigenicity of prostate ......" | 26743688 |
| hsa-miR-192-3p | prostate cancer | NOB1 | "Bioinformatics analysis results revealed that NOB1 ......" | 26743688 |
| hsa-miR-192-3p | colorectal cancer | PER1 | "Significant inverse correlation between the expres ......" | 27747302 |
| hsa-miR-192-3p | liver cancer | SEMA3A | "MicroRNA 192 5p Promote the Proliferation and Meta ......" | 26580097 |
| hsa-miR-192-3p | liver cancer | SLC39A6 | "Solute carrier family 39 member 6 SLC39A6 was iden ......" | 26684241 |
| hsa-miR-192-3p | liver cancer | SNAI1 | "Suppression of migration and invasion caused by mi ......" | 26684241 |
| hsa-miR-192-3p | sarcoma | TCF7 | "Upregulation of miR 192 inhibits cell growth and i ......" | 27683056 |
| hsa-miR-192-3p | lung squamous cell cancer | XIAP | "Curcumin promotes apoptosis by activating the p53 ......" | 25444916 |
| hsa-miR-192-3p | gastric cancer | ZNF135 | "Moreover the expression of miR-192 was significant ......" | 22205577 |
| hsa-miR-192-3p | gastric cancer | ZNF77 | "Moreover the expression of miR-192 was significant ......" | 22205577 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-192-3p | CLEC2B | 9 cancers: CESC; COAD; ESCA; LIHC; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA CESC -0.394; TCGA COAD -0.532; TCGA ESCA -0.319; TCGA LIHC -0.264; TCGA LUSC -0.192; TCGA PAAD -0.296; TCGA THCA -0.238; TCGA STAD -0.183; TCGA UCEC -0.137 |
hsa-miR-192-3p | MARCKS | 9 cancers: CESC; ESCA; KIRP; LGG; LIHC; LUSC; PAAD; THCA; UCEC | MirTarget | TCGA CESC -0.092; TCGA ESCA -0.068; TCGA KIRP -0.114; TCGA LGG -0.065; TCGA LIHC -0.294; TCGA LUSC -0.093; TCGA PAAD -0.112; TCGA THCA -0.126; TCGA UCEC -0.138 |
hsa-miR-192-3p | ST8SIA1 | 9 cancers: CESC; COAD; ESCA; KIRP; LIHC; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA CESC -0.128; TCGA COAD -0.623; TCGA ESCA -0.236; TCGA KIRP -0.097; TCGA LIHC -0.486; TCGA LUSC -0.15; TCGA PAAD -0.443; TCGA STAD -0.307; TCGA UCEC -0.274 |
hsa-miR-192-3p | CILP | 9 cancers: CESC; COAD; ESCA; KIRC; LIHC; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA CESC -0.137; TCGA COAD -1.234; TCGA ESCA -0.256; TCGA KIRC -0.231; TCGA LIHC -0.248; TCGA LUSC -0.335; TCGA PAAD -0.93; TCGA STAD -0.547; TCGA UCEC -0.24 |
hsa-miR-192-3p | TSHZ3 | 10 cancers: CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.172; TCGA COAD -0.496; TCGA ESCA -0.23; TCGA KIRC -0.112; TCGA KIRP -0.137; TCGA LIHC -0.428; TCGA LUSC -0.196; TCGA PAAD -0.225; TCGA STAD -0.292; TCGA UCEC -0.273 |
hsa-miR-192-3p | SH3PXD2A | 9 cancers: CESC; COAD; ESCA; KIRP; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.082; TCGA COAD -0.114; TCGA ESCA -0.112; TCGA KIRP -0.086; TCGA LUSC -0.086; TCGA PAAD -0.164; TCGA THCA -0.112; TCGA STAD -0.164; TCGA UCEC -0.135 |
hsa-miR-192-3p | FBXO32 | 10 cancers: CESC; COAD; ESCA; KIRC; LIHC; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.092; TCGA COAD -0.389; TCGA ESCA -0.139; TCGA KIRC -0.125; TCGA LIHC -0.416; TCGA LUSC -0.247; TCGA PAAD -0.182; TCGA THCA -0.37; TCGA STAD -0.424; TCGA UCEC -0.247 |
hsa-miR-192-3p | SCARA3 | 10 cancers: CESC; COAD; ESCA; KIRC; KIRP; LGG; PAAD; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.195; TCGA COAD -0.457; TCGA ESCA -0.256; TCGA KIRC -0.37; TCGA KIRP -0.243; TCGA LGG -0.102; TCGA PAAD -0.299; TCGA THCA -0.16; TCGA STAD -0.356; TCGA UCEC -0.113 |
hsa-miR-192-3p | CHST15 | 9 cancers: CESC; COAD; ESCA; KIRP; LIHC; LUSC; PAAD; THCA; STAD | miRNATAP | TCGA CESC -0.156; TCGA COAD -0.468; TCGA ESCA -0.166; TCGA KIRP -0.124; TCGA LIHC -0.15; TCGA LUSC -0.105; TCGA PAAD -0.269; TCGA THCA -0.14; TCGA STAD -0.292 |
hsa-miR-192-3p | AGPAT4 | 9 cancers: COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA COAD -0.418; TCGA ESCA -0.092; TCGA KIRC -0.089; TCGA KIRP -0.098; TCGA LIHC -0.31; TCGA LUSC -0.163; TCGA PAAD -0.18; TCGA STAD -0.188; TCGA UCEC -0.156 |
hsa-miR-192-3p | TIMP2 | 9 cancers: COAD; ESCA; KIRP; LIHC; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA COAD -0.574; TCGA ESCA -0.055; TCGA KIRP -0.131; TCGA LIHC -0.503; TCGA LUSC -0.191; TCGA PAAD -0.213; TCGA THCA -0.141; TCGA STAD -0.208; TCGA UCEC -0.234 |
hsa-miR-192-3p | RNF144A | 9 cancers: COAD; ESCA; KIRC; KIRP; LIHC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA COAD -0.308; TCGA ESCA -0.079; TCGA KIRC -0.126; TCGA KIRP -0.114; TCGA LIHC -0.334; TCGA PAAD -0.247; TCGA THCA -0.159; TCGA STAD -0.1; TCGA UCEC -0.198 |
hsa-miR-192-3p | C14orf132 | 9 cancers: COAD; ESCA; KIRC; KIRP; LIHC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA COAD -0.617; TCGA ESCA -0.264; TCGA KIRC -0.412; TCGA KIRP -0.127; TCGA LIHC -0.365; TCGA PAAD -0.251; TCGA THCA -0.162; TCGA STAD -0.433; TCGA UCEC -0.347 |
Enriched cancer pathways of putative targets