microRNA information: hsa-miR-193b-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-193b-5p | miRbase |
| Accession: | MIMAT0004767 | miRbase |
| Precursor name: | hsa-mir-193b | miRbase |
| Precursor accession: | MI0003137 | miRbase |
| Symbol: | MIR193B | HGNC |
| RefSeq ID: | NR_030177 | GenBank |
| Sequence: | CGGGGUUUUGAGGGCGAGAUGA |
Reported expression in cancers: hsa-miR-193b-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-193b-5p | breast cancer | upregulation | "In this study expression profiles of microRNAs miR ......" | 23183268 | Microarray; qPCR |
| hsa-miR-193b-5p | gastric cancer | deregulation | "Association of miR 193b down regulation and miR 19 ......" | 25374225 | qPCR; Microarray |
| hsa-miR-193b-5p | liver cancer | downregulation | "The expression profiles of miR-193b were compared ......" | 20655737 | qPCR |
| hsa-miR-193b-5p | lung squamous cell cancer | downregulation | "Here we investigated the role of microRNA-193b miR ......" | 22491710 | |
| hsa-miR-193b-5p | lymphoma | deregulation | "We found miR-34a miR-146a and miR-193b to be up-re ......" | 25862860 | |
| hsa-miR-193b-5p | melanoma | downregulation | "Notably miR-193b was significantly down-regulated ......" | 20304954 | |
| hsa-miR-193b-5p | melanoma | downregulation | "Among the miRNAs that were commonly and significan ......" | 27149382 | |
| hsa-miR-193b-5p | ovarian cancer | downregulation | "Tissue miR 193b as a Novel Biomarker for Patients ......" | 26675282 | |
| hsa-miR-193b-5p | pancreatic cancer | downregulation | "Here we identified miR-193b as a tumor-suppressive ......" | 25905463 | |
| hsa-miR-193b-5p | prostate cancer | deregulation | "Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......" | 23781281 |
Reported cancer pathway affected by hsa-miR-193b-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-193b-5p | bladder cancer | Apoptosis pathway | "Bladder cancer cell lines were exposed to normoxic ......" | 26196183 | Flow cytometry |
| hsa-miR-193b-5p | breast cancer | Apoptosis pathway | "Profiling studies also exposed a rapid metformin-i ......" | 25213330 | |
| hsa-miR-193b-5p | esophageal cancer | Apoptosis pathway | "MiR 193b promotes autophagy and non apoptotic cell ......" | 26878873 | Colony formation |
| hsa-miR-193b-5p | liver cancer | cell cycle pathway | "MicroRNA 193b regulates proliferation migration an ......" | 20655737 | Luciferase |
| hsa-miR-193b-5p | liver cancer | Apoptosis pathway | "Restoration of miR 193b sensitizes Hepatitis B vir ......" | 25034398 | Western blot; Luciferase; Flow cytometry |
| hsa-miR-193b-5p | pancreatic cancer | cell cycle pathway | "Deregulation of the MiR 193b KRAS Axis Contributes ......" | 25905463 | |
| hsa-miR-193b-5p | pancreatic cancer | MAPK signaling pathway | "In our previous studies we identified four microRN ......" | 27380024 | |
| hsa-miR-193b-5p | prostate cancer | cell cycle pathway | "miR 193b is an epigenetically regulated putative t ......" | 20073067 |
Reported cancer prognosis affected by hsa-miR-193b-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-193b-5p | breast cancer | progression; metastasis | "Downregulation of miR 193b contributes to enhance ......" | 19701247 | |
| hsa-miR-193b-5p | breast cancer | malignant trasformation | "In support of these findings in vitro functional s ......" | 24104550 | |
| hsa-miR-193b-5p | breast cancer | progression | "Tumor suppressive microRNA 193b promotes breast ca ......" | 25550792 | Luciferase |
| hsa-miR-193b-5p | breast cancer | drug resistance | "miR 193b Modulates Resistance to Doxorubicin in Hu ......" | 26526790 | |
| hsa-miR-193b-5p | cervical and endocervical cancer | tumorigenesis | "The methylation status was determined using Human ......" | 26797462 | |
| hsa-miR-193b-5p | gastric cancer | metastasis | "We detected the expression profiles of miRNA by mi ......" | 23372348 | Western blot; Wound Healing Assay |
| hsa-miR-193b-5p | gastric cancer | worse prognosis; staging; metastasis; differentiation; poor survival | "Association of miR 193b down regulation and miR 19 ......" | 25374225 | |
| hsa-miR-193b-5p | head and neck cancer | poor survival | "Alteration in miR-193b expression level does not s ......" | 25677760 | |
| hsa-miR-193b-5p | melanoma | poor survival | "Furthermore low expression of miR-191 and high exp ......" | 20357817 | |
| hsa-miR-193b-5p | melanoma | malignant trasformation; progression | "miR 193b Regulates Mcl 1 in Melanoma; In a previou ......" | 21893020 | |
| hsa-miR-193b-5p | ovarian cancer | metastasis | "Microenvironment induced downregulation of miR 193 ......" | 25798837 | |
| hsa-miR-193b-5p | ovarian cancer | poor survival; staging; metastasis; tumor size; worse prognosis | "Tissue miR 193b as a Novel Biomarker for Patients ......" | 26675282 | |
| hsa-miR-193b-5p | pancreatic cancer | metastasis | "miR 193b directly targets STMN1 and uPA genes and ......" | 25215905 | |
| hsa-miR-193b-5p | pancreatic cancer | malignant trasformation; tumorigenesis | "Deregulation of the MiR 193b KRAS Axis Contributes ......" | 25905463 | |
| hsa-miR-193b-5p | prostate cancer | progression; malignant trasformation | "CFTR suppresses tumor progression through miR 193b ......" | 22797075 | |
| hsa-miR-193b-5p | prostate cancer | staging | "Epigenetically altered miR 193b targets cyclin D1 ......" | 26129688 | |
| hsa-miR-193b-5p | thyroid cancer | metastasis | "To identify the miRNA signature in PTC with LN met ......" | 23609190 |
Reported gene related to hsa-miR-193b-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-193b-5p | gastric cancer | CCND1 | "MicroRNA 193b inhibits the proliferation migration ......" | 27071318 |
| hsa-miR-193b-5p | liver cancer | CCND1 | "CCND1 and ETS1 were revealed to be regulated by mi ......" | 20655737 |
| hsa-miR-193b-5p | melanoma | CCND1 | "MicroRNA 193b represses cell proliferation and reg ......" | 20304954 |
| hsa-miR-193b-5p | melanoma | CCND1 | "In a previous study we reported that miR-193b repr ......" | 21893020 |
| hsa-miR-193b-5p | prostate cancer | CCND1 | "Epigenetically altered miR 193b targets cyclin D1 ......" | 26129688 |
| hsa-miR-193b-5p | gastric cancer | PCNA | "MicroRNA 193b inhibits the proliferation migration ......" | 27071318 |
| hsa-miR-193b-5p | melanoma | PCNA | "MicroRNA 193b represses cell proliferation and reg ......" | 20304954 |
| hsa-miR-193b-5p | melanoma | PCNA | "In a previous study we reported that miR-193b repr ......" | 21893020 |
| hsa-miR-193b-5p | prostate cancer | PCNA | "Epigenetically altered miR 193b targets cyclin D1 ......" | 26129688 |
| hsa-miR-193b-5p | breast cancer | MCL1 | "miR 193b Modulates Resistance to Doxorubicin in Hu ......" | 26526790 |
| hsa-miR-193b-5p | liver cancer | MCL1 | "Expression of miR-193b and myeloid cell leukemia-1 ......" | 25034398 |
| hsa-miR-193b-5p | melanoma | MCL1 | "miR 193b Regulates Mcl 1 in Melanoma; Herein we de ......" | 21893020 |
| hsa-miR-193b-5p | breast cancer | PLAU | "Downregulation of miR 193b contributes to enhance ......" | 19701247 |
| hsa-miR-193b-5p | gastric cancer | PLAU | "Among the altered miRNAs TGF-β1 induced the down- ......" | 23372348 |
| hsa-miR-193b-5p | pancreatic cancer | PLAU | "miR 193b directly targets STMN1 and uPA genes and ......" | 25215905 |
| hsa-miR-193b-5p | esophageal cancer | STMN1 | "The critical mRNA targets of miR-193b are unknown ......" | 26878873 |
| hsa-miR-193b-5p | pancreatic cancer | STMN1 | "miR 193b directly targets STMN1 and uPA genes and ......" | 25215905 |
| hsa-miR-193b-5p | prostate cancer | CFTR | "Taken together the present study has demonstrated ......" | 22797075 |
| hsa-miR-193b-5p | lung cancer | CYP27A1 | "Only miR-193 was associated with biochemical marke ......" | 23142363 |
| hsa-miR-193b-5p | breast cancer | DNAJC13 | "Tumor suppressive microRNA 193b promotes breast ca ......" | 25550792 |
| hsa-miR-193b-5p | liver cancer | ETS1 | "CCND1 and ETS1 were revealed to be regulated by mi ......" | 20655737 |
| hsa-miR-193b-5p | breast cancer | FASN | "Profiling studies also exposed a rapid metformin-i ......" | 25213330 |
| hsa-miR-193b-5p | breast cancer | IGFBP5 | "Experimental and bioinformatics studies have shown ......" | 25983620 |
| hsa-miR-193b-5p | pancreatic cancer | KRAS | "Deregulation of the MiR 193b KRAS Axis Contributes ......" | 25905463 |
| hsa-miR-193b-5p | breast cancer | LINC01194 | "Here we applied a high-throughput strategy using q ......" | 21512034 |
| hsa-miR-193b-5p | breast cancer | PLG | "Downregulation of miR 193b contributes to enhance ......" | 19701247 |
| hsa-miR-193b-5p | breast cancer | RAB22A | "Tumor suppressive microRNA 193b promotes breast ca ......" | 25550792 |
| hsa-miR-193b-5p | prostate cancer | ZNF135 | "We found reduced miR-193b expression P < 0.05 in s ......" | 26129688 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-193b-5p | ACVR2A | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; STAD; UCEC | MirTarget | TCGA BLCA -0.142; TCGA CESC -0.127; TCGA COAD -0.067; TCGA ESCA -0.157; TCGA HNSC -0.315; TCGA KIRC -0.063; TCGA LGG -0.061; TCGA STAD -0.114; TCGA UCEC -0.115 |
hsa-miR-193b-5p | KIAA0232 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.135; TCGA CESC -0.121; TCGA ESCA -0.212; TCGA HNSC -0.106; TCGA KIRC -0.061; TCGA LUSC -0.078; TCGA OV -0.096; TCGA PAAD -0.1; TCGA SARC -0.092; TCGA STAD -0.086; TCGA UCEC -0.075 |
hsa-miR-193b-5p | SORCS1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.874; TCGA BRCA -0.217; TCGA CESC -0.347; TCGA HNSC -0.406; TCGA KIRP -0.314; TCGA LIHC -0.386; TCGA LUSC -0.317; TCGA PAAD -0.371; TCGA STAD -0.461; TCGA UCEC -0.241 |
hsa-miR-193b-5p | PLEKHH2 | 13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.137; TCGA CESC -0.382; TCGA ESCA -0.326; TCGA HNSC -0.28; TCGA KIRC -0.342; TCGA KIRP -0.518; TCGA LIHC -0.469; TCGA LUAD -0.247; TCGA LUSC -0.513; TCGA PRAD -0.126; TCGA SARC -0.274; TCGA STAD -0.279; TCGA UCEC -0.233 |
hsa-miR-193b-5p | CLIP3 | 9 cancers: BLCA; CESC; HNSC; LIHC; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.427; TCGA CESC -0.168; TCGA HNSC -0.143; TCGA LIHC -0.354; TCGA PAAD -0.184; TCGA SARC -0.155; TCGA THCA -0.148; TCGA STAD -0.226; TCGA UCEC -0.198 |
hsa-miR-193b-5p | ADHFE1 | 11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.329; TCGA CESC -0.199; TCGA HNSC -0.359; TCGA KIRC -0.128; TCGA KIRP -0.094; TCGA LGG -0.144; TCGA LUAD -0.128; TCGA LUSC -0.231; TCGA SARC -0.323; TCGA STAD -0.283; TCGA UCEC -0.18 |
hsa-miR-193b-5p | SLC14A1 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.529; TCGA BRCA -0.102; TCGA CESC -0.34; TCGA ESCA -0.455; TCGA HNSC -0.514; TCGA KIRC -0.485; TCGA LUAD -0.163; TCGA LUSC -0.676; TCGA PRAD -0.217; TCGA SARC -0.535; TCGA STAD -0.163; TCGA UCEC -0.283 |
hsa-miR-193b-5p | VIPR2 | 9 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUSC; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.795; TCGA CESC -0.722; TCGA ESCA -0.58; TCGA HNSC -0.459; TCGA LGG -0.668; TCGA LUSC -0.478; TCGA PRAD -0.211; TCGA SARC -0.641; TCGA STAD -0.437 |
hsa-miR-193b-5p | ZNF793 | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PAAD | MirTarget | TCGA BLCA -0.183; TCGA BRCA -0.072; TCGA HNSC -0.433; TCGA KIRC -0.259; TCGA KIRP -0.186; TCGA LGG -0.06; TCGA LIHC -0.206; TCGA OV -0.116; TCGA PAAD -0.154 |
hsa-miR-193b-5p | KANK2 | 10 cancers: BLCA; CESC; ESCA; KIRC; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.248; TCGA CESC -0.105; TCGA ESCA -0.204; TCGA KIRC -0.115; TCGA LUAD -0.061; TCGA LUSC -0.353; TCGA SARC -0.243; TCGA THCA -0.176; TCGA STAD -0.191; TCGA UCEC -0.161 |
hsa-miR-193b-5p | CHRDL1 | 9 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.854; TCGA CESC -0.446; TCGA HNSC -1.075; TCGA LIHC -0.339; TCGA LUAD -0.386; TCGA LUSC -1.029; TCGA SARC -0.426; TCGA STAD -0.472; TCGA UCEC -0.791 |
hsa-miR-193b-5p | DMD | 10 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.39; TCGA ESCA -0.228; TCGA HNSC -0.211; TCGA KIRC -0.126; TCGA LUAD -0.132; TCGA LUSC -0.348; TCGA SARC -0.424; TCGA THCA -0.138; TCGA STAD -0.474; TCGA UCEC -0.361 |
hsa-miR-193b-5p | ADAM22 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.424; TCGA CESC -0.578; TCGA ESCA -0.548; TCGA HNSC -0.701; TCGA KIRC -0.129; TCGA LIHC -0.403; TCGA LUSC -0.355; TCGA SARC -0.362; TCGA STAD -0.275; TCGA UCEC -0.246 |
hsa-miR-193b-5p | SMPD3 | 9 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD | mirMAP | TCGA BLCA -0.142; TCGA CESC -0.364; TCGA ESCA -0.909; TCGA KIRP -0.122; TCGA LGG -0.139; TCGA LUAD -0.109; TCGA LUSC -0.282; TCGA PAAD -0.273; TCGA PRAD -0.193 |
hsa-miR-193b-5p | MLLT6 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; UCEC | mirMAP | TCGA BLCA -0.08; TCGA BRCA -0.131; TCGA CESC -0.128; TCGA ESCA -0.2; TCGA HNSC -0.206; TCGA KIRC -0.127; TCGA KIRP -0.151; TCGA LGG -0.073; TCGA LIHC -0.155; TCGA LUAD -0.052; TCGA LUSC -0.111; TCGA UCEC -0.092 |
hsa-miR-193b-5p | PER2 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC | mirMAP | TCGA BLCA -0.188; TCGA CESC -0.152; TCGA COAD -0.077; TCGA ESCA -0.185; TCGA HNSC -0.163; TCGA KIRC -0.129; TCGA KIRP -0.138; TCGA PAAD -0.076; TCGA PRAD -0.071; TCGA SARC -0.099 |
hsa-miR-193b-5p | ENTPD1 | 11 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.184; TCGA ESCA -0.216; TCGA HNSC -0.054; TCGA KIRP -0.088; TCGA LGG -0.052; TCGA LIHC -0.218; TCGA LUSC -0.13; TCGA SARC -0.189; TCGA THCA -0.199; TCGA STAD -0.169; TCGA UCEC -0.168 |
hsa-miR-193b-5p | SSBP2 | 11 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.178; TCGA CESC -0.219; TCGA HNSC -0.346; TCGA KIRP -0.137; TCGA LIHC -0.319; TCGA LUAD -0.144; TCGA OV -0.109; TCGA PAAD -0.147; TCGA PRAD -0.073; TCGA SARC -0.125; TCGA STAD -0.184 |
hsa-miR-193b-5p | PTCHD1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.496; TCGA BRCA -0.255; TCGA CESC -0.313; TCGA ESCA -0.284; TCGA HNSC -0.685; TCGA LUAD -0.214; TCGA LUSC -0.436; TCGA SARC -0.574; TCGA STAD -0.544; TCGA UCEC -0.239 |
hsa-miR-193b-5p | BEND7 | 12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.259; TCGA BRCA -0.158; TCGA ESCA -0.665; TCGA HNSC -0.595; TCGA KIRC -0.111; TCGA LGG -0.215; TCGA LUAD -0.133; TCGA LUSC -0.395; TCGA PAAD -0.166; TCGA PRAD -0.182; TCGA SARC -0.137; TCGA STAD -0.181 |
hsa-miR-193b-5p | MECP2 | 9 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BLCA -0.08; TCGA CESC -0.07; TCGA HNSC -0.072; TCGA KIRC -0.072; TCGA LIHC -0.145; TCGA LUSC -0.056; TCGA PAAD -0.068; TCGA SARC -0.079; TCGA UCEC -0.053 |
hsa-miR-193b-5p | TPPP | 10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.301; TCGA ESCA -0.299; TCGA HNSC -0.165; TCGA KIRC -0.217; TCGA KIRP -0.348; TCGA LUAD -0.229; TCGA LUSC -0.297; TCGA PAAD -0.423; TCGA SARC -0.391; TCGA STAD -0.255 |
hsa-miR-193b-5p | KSR2 | 12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD | mirMAP | TCGA BLCA -0.356; TCGA CESC -0.514; TCGA ESCA -0.228; TCGA HNSC -0.587; TCGA KIRC -0.312; TCGA KIRP -0.27; TCGA LIHC -0.32; TCGA LUAD -0.175; TCGA LUSC -0.216; TCGA OV -0.179; TCGA PAAD -0.363; TCGA PRAD -0.236 |
hsa-miR-193b-5p | GNG7 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BLCA -0.51; TCGA BRCA -0.208; TCGA CESC -0.2; TCGA ESCA -0.502; TCGA HNSC -0.443; TCGA KIRC -0.18; TCGA KIRP -0.087; TCGA LUAD -0.135; TCGA LUSC -0.413; TCGA PAAD -0.281; TCGA SARC -0.226; TCGA UCEC -0.154 |
hsa-miR-193b-5p | ZNF514 | 10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; STAD | MirTarget | TCGA CESC -0.122; TCGA ESCA -0.131; TCGA HNSC -0.151; TCGA KIRC -0.058; TCGA KIRP -0.127; TCGA LGG -0.095; TCGA LIHC -0.174; TCGA LUAD -0.058; TCGA OV -0.087; TCGA STAD -0.121 |
Enriched cancer pathways of putative targets