microRNA information: hsa-miR-193b-5p

SectionIDlink
Mature name: hsa-miR-193b-5pmiRbase
Accession: MIMAT0004767miRbase
Precursor name: hsa-mir-193b miRbase
Precursor accession: MI0003137miRbase
Symbol: MIR193BHGNC
RefSeq ID: NR_030177GenBank
Sequence: CGGGGUUUUGAGGGCGAGAUGA



Reported expression in cancers: hsa-miR-193b-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-193b-5p

breast cancerupregulation"In this study expression profiles of microRNAs miR ......"23183268Microarray; qPCR
hsa-miR-193b-5p

gastric cancerderegulation"Association of miR 193b down regulation and miR 19 ......"25374225qPCR; Microarray
hsa-miR-193b-5p

liver cancerdownregulation"The expression profiles of miR-193b were compared ......"20655737qPCR
hsa-miR-193b-5p

lung squamous cell cancerdownregulation"Here we investigated the role of microRNA-193b miR ......"22491710
hsa-miR-193b-5p

lymphomaderegulation"We found miR-34a miR-146a and miR-193b to be up-re ......"25862860
hsa-miR-193b-5p

melanomadownregulation"Notably miR-193b was significantly down-regulated ......"20304954
hsa-miR-193b-5p

melanomadownregulation"Among the miRNAs that were commonly and significan ......"27149382
hsa-miR-193b-5p

ovarian cancerdownregulation"Tissue miR 193b as a Novel Biomarker for Patients ......"26675282
hsa-miR-193b-5p

pancreatic cancerdownregulation"Here we identified miR-193b as a tumor-suppressive ......"25905463
hsa-miR-193b-5p

prostate cancerderegulation"Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......"23781281



Reported cancer pathway affected by hsa-miR-193b-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-193b-5p

bladder cancerApoptosis pathway"Bladder cancer cell lines were exposed to normoxic ......"26196183Flow cytometry
hsa-miR-193b-5p

breast cancerApoptosis pathway"Profiling studies also exposed a rapid metformin-i ......"25213330
hsa-miR-193b-5p

esophageal cancerApoptosis pathway"MiR 193b promotes autophagy and non apoptotic cell ......"26878873Colony formation
hsa-miR-193b-5p

liver cancercell cycle pathway"MicroRNA 193b regulates proliferation migration an ......"20655737Luciferase
hsa-miR-193b-5p

liver cancerApoptosis pathway"Restoration of miR 193b sensitizes Hepatitis B vir ......"25034398Western blot; Luciferase; Flow cytometry
hsa-miR-193b-5p

pancreatic cancercell cycle pathway"Deregulation of the MiR 193b KRAS Axis Contributes ......"25905463
hsa-miR-193b-5p

pancreatic cancerMAPK signaling pathway"In our previous studies we identified four microRN ......"27380024
hsa-miR-193b-5p

prostate cancercell cycle pathway"miR 193b is an epigenetically regulated putative t ......"20073067



Reported cancer prognosis affected by hsa-miR-193b-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-193b-5p

breast cancerprogression; metastasis"Downregulation of miR 193b contributes to enhance ......"19701247
hsa-miR-193b-5p

breast cancermalignant trasformation"In support of these findings in vitro functional s ......"24104550
hsa-miR-193b-5p

breast cancerprogression"Tumor suppressive microRNA 193b promotes breast ca ......"25550792Luciferase
hsa-miR-193b-5p

breast cancerdrug resistance"miR 193b Modulates Resistance to Doxorubicin in Hu ......"26526790
hsa-miR-193b-5p

cervical and endocervical cancertumorigenesis"The methylation status was determined using Human ......"26797462
hsa-miR-193b-5p

gastric cancermetastasis"We detected the expression profiles of miRNA by mi ......"23372348Western blot; Wound Healing Assay
hsa-miR-193b-5p

gastric cancerworse prognosis; staging; metastasis; differentiation; poor survival"Association of miR 193b down regulation and miR 19 ......"25374225
hsa-miR-193b-5p

head and neck cancerpoor survival"Alteration in miR-193b expression level does not s ......"25677760
hsa-miR-193b-5p

melanomapoor survival"Furthermore low expression of miR-191 and high exp ......"20357817
hsa-miR-193b-5p

melanomamalignant trasformation; progression"miR 193b Regulates Mcl 1 in Melanoma; In a previou ......"21893020
hsa-miR-193b-5p

ovarian cancermetastasis"Microenvironment induced downregulation of miR 193 ......"25798837
hsa-miR-193b-5p

ovarian cancerpoor survival; staging; metastasis; tumor size; worse prognosis"Tissue miR 193b as a Novel Biomarker for Patients ......"26675282
hsa-miR-193b-5p

pancreatic cancermetastasis"miR 193b directly targets STMN1 and uPA genes and ......"25215905
hsa-miR-193b-5p

pancreatic cancermalignant trasformation; tumorigenesis"Deregulation of the MiR 193b KRAS Axis Contributes ......"25905463
hsa-miR-193b-5p

prostate cancerprogression; malignant trasformation"CFTR suppresses tumor progression through miR 193b ......"22797075
hsa-miR-193b-5p

prostate cancerstaging"Epigenetically altered miR 193b targets cyclin D1 ......"26129688
hsa-miR-193b-5p

thyroid cancermetastasis"To identify the miRNA signature in PTC with LN met ......"23609190



Reported gene related to hsa-miR-193b-5p

miRNAcancergenereportingPUBMED
hsa-miR-193b-5p

gastric cancerCCND1"MicroRNA 193b inhibits the proliferation migration ......"27071318
hsa-miR-193b-5p

liver cancerCCND1"CCND1 and ETS1 were revealed to be regulated by mi ......"20655737
hsa-miR-193b-5p

melanomaCCND1"MicroRNA 193b represses cell proliferation and reg ......"20304954
hsa-miR-193b-5p

melanomaCCND1"In a previous study we reported that miR-193b repr ......"21893020
hsa-miR-193b-5p

prostate cancerCCND1"Epigenetically altered miR 193b targets cyclin D1 ......"26129688
hsa-miR-193b-5p

gastric cancerPCNA"MicroRNA 193b inhibits the proliferation migration ......"27071318
hsa-miR-193b-5p

melanomaPCNA"MicroRNA 193b represses cell proliferation and reg ......"20304954
hsa-miR-193b-5p

melanomaPCNA"In a previous study we reported that miR-193b repr ......"21893020
hsa-miR-193b-5p

prostate cancerPCNA"Epigenetically altered miR 193b targets cyclin D1 ......"26129688
hsa-miR-193b-5p

breast cancerMCL1"miR 193b Modulates Resistance to Doxorubicin in Hu ......"26526790
hsa-miR-193b-5p

liver cancerMCL1"Expression of miR-193b and myeloid cell leukemia-1 ......"25034398
hsa-miR-193b-5p

melanomaMCL1"miR 193b Regulates Mcl 1 in Melanoma; Herein we de ......"21893020
hsa-miR-193b-5p

breast cancerPLAU"Downregulation of miR 193b contributes to enhance ......"19701247
hsa-miR-193b-5p

gastric cancerPLAU"Among the altered miRNAs TGF-β1 induced the down- ......"23372348
hsa-miR-193b-5p

pancreatic cancerPLAU"miR 193b directly targets STMN1 and uPA genes and ......"25215905
hsa-miR-193b-5p

esophageal cancerSTMN1"The critical mRNA targets of miR-193b are unknown ......"26878873
hsa-miR-193b-5p

pancreatic cancerSTMN1"miR 193b directly targets STMN1 and uPA genes and ......"25215905
hsa-miR-193b-5p

prostate cancerCFTR"Taken together the present study has demonstrated ......"22797075
hsa-miR-193b-5p

lung cancerCYP27A1"Only miR-193 was associated with biochemical marke ......"23142363
hsa-miR-193b-5p

breast cancerDNAJC13"Tumor suppressive microRNA 193b promotes breast ca ......"25550792
hsa-miR-193b-5p

liver cancerETS1"CCND1 and ETS1 were revealed to be regulated by mi ......"20655737
hsa-miR-193b-5p

breast cancerFASN"Profiling studies also exposed a rapid metformin-i ......"25213330
hsa-miR-193b-5p

breast cancerIGFBP5"Experimental and bioinformatics studies have shown ......"25983620
hsa-miR-193b-5p

pancreatic cancerKRAS"Deregulation of the MiR 193b KRAS Axis Contributes ......"25905463
hsa-miR-193b-5p

breast cancerLINC01194"Here we applied a high-throughput strategy using q ......"21512034
hsa-miR-193b-5p

breast cancerPLG"Downregulation of miR 193b contributes to enhance ......"19701247
hsa-miR-193b-5p

breast cancerRAB22A"Tumor suppressive microRNA 193b promotes breast ca ......"25550792
hsa-miR-193b-5p

prostate cancerZNF135"We found reduced miR-193b expression P < 0.05 in s ......"26129688



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-193b-5p
ACVR2A
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; STAD; UCEC
MirTarget
TCGA BLCA -0.142; TCGA CESC -0.127; TCGA COAD -0.067; TCGA ESCA -0.157; TCGA HNSC -0.315; TCGA KIRC -0.063; TCGA LGG -0.061; TCGA STAD -0.114; TCGA UCEC -0.115
hsa-miR-193b-5p
KIAA0232
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUSC; OV; PAAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.135; TCGA CESC -0.121; TCGA ESCA -0.212; TCGA HNSC -0.106; TCGA KIRC -0.061; TCGA LUSC -0.078; TCGA OV -0.096; TCGA PAAD -0.1; TCGA SARC -0.092; TCGA STAD -0.086; TCGA UCEC -0.075
hsa-miR-193b-5p
SORCS1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.874; TCGA BRCA -0.217; TCGA CESC -0.347; TCGA HNSC -0.406; TCGA KIRP -0.314; TCGA LIHC -0.386; TCGA LUSC -0.317; TCGA PAAD -0.371; TCGA STAD -0.461; TCGA UCEC -0.241
hsa-miR-193b-5p
PLEKHH2
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.137; TCGA CESC -0.382; TCGA ESCA -0.326; TCGA HNSC -0.28; TCGA KIRC -0.342; TCGA KIRP -0.518; TCGA LIHC -0.469; TCGA LUAD -0.247; TCGA LUSC -0.513; TCGA PRAD -0.126; TCGA SARC -0.274; TCGA STAD -0.279; TCGA UCEC -0.233
hsa-miR-193b-5p
CLIP3
9 cancers: BLCA; CESC; HNSC; LIHC; PAAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.427; TCGA CESC -0.168; TCGA HNSC -0.143; TCGA LIHC -0.354; TCGA PAAD -0.184; TCGA SARC -0.155; TCGA THCA -0.148; TCGA STAD -0.226; TCGA UCEC -0.198
hsa-miR-193b-5p
ADHFE1
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.329; TCGA CESC -0.199; TCGA HNSC -0.359; TCGA KIRC -0.128; TCGA KIRP -0.094; TCGA LGG -0.144; TCGA LUAD -0.128; TCGA LUSC -0.231; TCGA SARC -0.323; TCGA STAD -0.283; TCGA UCEC -0.18
hsa-miR-193b-5p
SLC14A1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.529; TCGA BRCA -0.102; TCGA CESC -0.34; TCGA ESCA -0.455; TCGA HNSC -0.514; TCGA KIRC -0.485; TCGA LUAD -0.163; TCGA LUSC -0.676; TCGA PRAD -0.217; TCGA SARC -0.535; TCGA STAD -0.163; TCGA UCEC -0.283
hsa-miR-193b-5p
VIPR2
9 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUSC; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.795; TCGA CESC -0.722; TCGA ESCA -0.58; TCGA HNSC -0.459; TCGA LGG -0.668; TCGA LUSC -0.478; TCGA PRAD -0.211; TCGA SARC -0.641; TCGA STAD -0.437
hsa-miR-193b-5p
ZNF793
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PAAD
MirTarget
TCGA BLCA -0.183; TCGA BRCA -0.072; TCGA HNSC -0.433; TCGA KIRC -0.259; TCGA KIRP -0.186; TCGA LGG -0.06; TCGA LIHC -0.206; TCGA OV -0.116; TCGA PAAD -0.154
hsa-miR-193b-5p
KANK2
10 cancers: BLCA; CESC; ESCA; KIRC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.248; TCGA CESC -0.105; TCGA ESCA -0.204; TCGA KIRC -0.115; TCGA LUAD -0.061; TCGA LUSC -0.353; TCGA SARC -0.243; TCGA THCA -0.176; TCGA STAD -0.191; TCGA UCEC -0.161
hsa-miR-193b-5p
CHRDL1
9 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.854; TCGA CESC -0.446; TCGA HNSC -1.075; TCGA LIHC -0.339; TCGA LUAD -0.386; TCGA LUSC -1.029; TCGA SARC -0.426; TCGA STAD -0.472; TCGA UCEC -0.791
hsa-miR-193b-5p
DMD
10 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.39; TCGA ESCA -0.228; TCGA HNSC -0.211; TCGA KIRC -0.126; TCGA LUAD -0.132; TCGA LUSC -0.348; TCGA SARC -0.424; TCGA THCA -0.138; TCGA STAD -0.474; TCGA UCEC -0.361
hsa-miR-193b-5p
ADAM22
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.424; TCGA CESC -0.578; TCGA ESCA -0.548; TCGA HNSC -0.701; TCGA KIRC -0.129; TCGA LIHC -0.403; TCGA LUSC -0.355; TCGA SARC -0.362; TCGA STAD -0.275; TCGA UCEC -0.246
hsa-miR-193b-5p
SMPD3
9 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD
mirMAP
TCGA BLCA -0.142; TCGA CESC -0.364; TCGA ESCA -0.909; TCGA KIRP -0.122; TCGA LGG -0.139; TCGA LUAD -0.109; TCGA LUSC -0.282; TCGA PAAD -0.273; TCGA PRAD -0.193
hsa-miR-193b-5p
MLLT6
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; UCEC
mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.131; TCGA CESC -0.128; TCGA ESCA -0.2; TCGA HNSC -0.206; TCGA KIRC -0.127; TCGA KIRP -0.151; TCGA LGG -0.073; TCGA LIHC -0.155; TCGA LUAD -0.052; TCGA LUSC -0.111; TCGA UCEC -0.092
hsa-miR-193b-5p
PER2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.188; TCGA CESC -0.152; TCGA COAD -0.077; TCGA ESCA -0.185; TCGA HNSC -0.163; TCGA KIRC -0.129; TCGA KIRP -0.138; TCGA PAAD -0.076; TCGA PRAD -0.071; TCGA SARC -0.099
hsa-miR-193b-5p
ENTPD1
11 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.184; TCGA ESCA -0.216; TCGA HNSC -0.054; TCGA KIRP -0.088; TCGA LGG -0.052; TCGA LIHC -0.218; TCGA LUSC -0.13; TCGA SARC -0.189; TCGA THCA -0.199; TCGA STAD -0.169; TCGA UCEC -0.168
hsa-miR-193b-5p
SSBP2
11 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.178; TCGA CESC -0.219; TCGA HNSC -0.346; TCGA KIRP -0.137; TCGA LIHC -0.319; TCGA LUAD -0.144; TCGA OV -0.109; TCGA PAAD -0.147; TCGA PRAD -0.073; TCGA SARC -0.125; TCGA STAD -0.184
hsa-miR-193b-5p
PTCHD1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.496; TCGA BRCA -0.255; TCGA CESC -0.313; TCGA ESCA -0.284; TCGA HNSC -0.685; TCGA LUAD -0.214; TCGA LUSC -0.436; TCGA SARC -0.574; TCGA STAD -0.544; TCGA UCEC -0.239
hsa-miR-193b-5p
BEND7
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.259; TCGA BRCA -0.158; TCGA ESCA -0.665; TCGA HNSC -0.595; TCGA KIRC -0.111; TCGA LGG -0.215; TCGA LUAD -0.133; TCGA LUSC -0.395; TCGA PAAD -0.166; TCGA PRAD -0.182; TCGA SARC -0.137; TCGA STAD -0.181
hsa-miR-193b-5p
MECP2
9 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUSC; PAAD; SARC; UCEC
mirMAP
TCGA BLCA -0.08; TCGA CESC -0.07; TCGA HNSC -0.072; TCGA KIRC -0.072; TCGA LIHC -0.145; TCGA LUSC -0.056; TCGA PAAD -0.068; TCGA SARC -0.079; TCGA UCEC -0.053
hsa-miR-193b-5p
TPPP
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.301; TCGA ESCA -0.299; TCGA HNSC -0.165; TCGA KIRC -0.217; TCGA KIRP -0.348; TCGA LUAD -0.229; TCGA LUSC -0.297; TCGA PAAD -0.423; TCGA SARC -0.391; TCGA STAD -0.255
hsa-miR-193b-5p
KSR2
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD
mirMAP
TCGA BLCA -0.356; TCGA CESC -0.514; TCGA ESCA -0.228; TCGA HNSC -0.587; TCGA KIRC -0.312; TCGA KIRP -0.27; TCGA LIHC -0.32; TCGA LUAD -0.175; TCGA LUSC -0.216; TCGA OV -0.179; TCGA PAAD -0.363; TCGA PRAD -0.236
hsa-miR-193b-5p
GNG7
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC
mirMAP
TCGA BLCA -0.51; TCGA BRCA -0.208; TCGA CESC -0.2; TCGA ESCA -0.502; TCGA HNSC -0.443; TCGA KIRC -0.18; TCGA KIRP -0.087; TCGA LUAD -0.135; TCGA LUSC -0.413; TCGA PAAD -0.281; TCGA SARC -0.226; TCGA UCEC -0.154
hsa-miR-193b-5p
ZNF514
10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; STAD
MirTarget
TCGA CESC -0.122; TCGA ESCA -0.131; TCGA HNSC -0.151; TCGA KIRC -0.058; TCGA KIRP -0.127; TCGA LGG -0.095; TCGA LIHC -0.174; TCGA LUAD -0.058; TCGA OV -0.087; TCGA STAD -0.121





Enriched cancer pathways of putative targets