microRNA information: hsa-miR-196b-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-196b-5p | miRbase |
| Accession: | MIMAT0001080 | miRbase |
| Precursor name: | hsa-mir-196b | miRbase |
| Precursor accession: | MI0001150 | miRbase |
| Symbol: | MIR196B | HGNC |
| RefSeq ID: | NR_029911 | GenBank |
| Sequence: | UAGGUAGUUUCCUGUUGUUGGG |
Reported expression in cancers: hsa-miR-196b-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-196b-5p | cervical and endocervical cancer | downregulation | "The down-regulation of microRNA-196b miR-196b has ......" | 23861821 | |
| hsa-miR-196b-5p | colorectal cancer | upregulation | "Upregulation of microRNA 196a and microRNA 196b co ......" | 25525411 | qPCR |
| hsa-miR-196b-5p | colorectal cancer | upregulation | "Using miRNA microarray analysis we identified 31 m ......" | 25605245 | Microarray |
| hsa-miR-196b-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
| hsa-miR-196b-5p | gastric cancer | upregulation | "Recently we reported that miR-196b is highly expre ......" | 22298639 | |
| hsa-miR-196b-5p | gastric cancer | upregulation | "By integrating CNV and miRNA profiles in the same ......" | 23553990 | qPCR |
| hsa-miR-196b-5p | gastric cancer | upregulation | "miR-196a and/or miR-196b involved in cancer initia ......" | 27420607 | qPCR |
| hsa-miR-196b-5p | liver cancer | upregulation | "Expression levels of three identified miRNAs miR-1 ......" | 22976466 | |
| hsa-miR-196b-5p | lung squamous cell cancer | upregulation | "Here we show that miR-196b is upregulated in mesen ......" | 26586336 |
Reported cancer pathway affected by hsa-miR-196b-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-196b-5p | colorectal cancer | Apoptosis pathway | "MicroRNA 196B regulates FAS mediated apoptosis in ......" | 25605245 | |
| hsa-miR-196b-5p | gastric cancer | Epithelial mesenchymal transition pathway | "Transcriptional regulation of miR 196b by ETS2 in ......" | 22298639 | |
| hsa-miR-196b-5p | gastric cancer | mTOR signaling pathway | "miR 196b regulates gastric cancer cell proliferati ......" | 26998071 | Flow cytometry |
| hsa-miR-196b-5p | glioblastoma | cell cycle pathway | "Upregulation of miR 196b confers a poor prognosis ......" | 22723849 | |
| hsa-miR-196b-5p | lymphoma | Apoptosis pathway | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 |
Reported cancer prognosis affected by hsa-miR-196b-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-196b-5p | acute myeloid leukemia | differentiation | "We studied miRNA expression of leukemic blasts of ......" | 20425795 | |
| hsa-miR-196b-5p | acute myeloid leukemia | differentiation | "The role of microRNA 196a and microRNA 196b as ERG ......" | 20570349 | Luciferase |
| hsa-miR-196b-5p | acute myeloid leukemia | poor survival | "High levels of miR-196b and miR-644 were independe ......" | 24072101 | |
| hsa-miR-196b-5p | breast cancer | metastasis; cell migration | "Among 486 miRNAs screened 14 were identified that ......" | 20736365 | |
| hsa-miR-196b-5p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-196b-5p | cervical and endocervical cancer | progression; poor survival | "MicroRNA 196b regulates the homeobox B7 vascular e ......" | 23861821 | |
| hsa-miR-196b-5p | colon cancer | staging | "A validation study was done to corroborate a subse ......" | 26626874 | |
| hsa-miR-196b-5p | colorectal cancer | progression; worse prognosis; tumorigenesis; differentiation; staging; metastasis; poor survival | "Upregulation of microRNA 196a and microRNA 196b co ......" | 25525411 | |
| hsa-miR-196b-5p | colorectal cancer | poor survival | "A total of 1893 carcinoma samples were run on the ......" | 27198570 | |
| hsa-miR-196b-5p | gastric cancer | poor survival | "Epigenetic regulation of miR 196b expression in ga ......" | 20662076 | |
| hsa-miR-196b-5p | gastric cancer | worse prognosis | "Overexpression of miR 196b and HOXA10 characterize ......" | 24222951 | |
| hsa-miR-196b-5p | gastric cancer | metastasis; progression; staging | "miR 196b regulates gastric cancer cell proliferati ......" | 26998071 | Flow cytometry |
| hsa-miR-196b-5p | gastric cancer | poor survival | "Then we further investigated these GC specific miR ......" | 27173517 | |
| hsa-miR-196b-5p | gastric cancer | progression | "miR-196a and/or miR-196b involved in cancer initia ......" | 27420607 | |
| hsa-miR-196b-5p | glioblastoma | malignant trasformation; poor survival; progression | "In this study we examined the expression levels of ......" | 20601442 | |
| hsa-miR-196b-5p | glioblastoma | poor survival | "MiR 195 miR 196b miR 181c miR 21 expression levels ......" | 21895872 | |
| hsa-miR-196b-5p | glioblastoma | worse prognosis; poor survival | "Upregulation of miR 196b confers a poor prognosis ......" | 22723849 | |
| hsa-miR-196b-5p | lung cancer | progression; poor survival; drug resistance | "Microarray-based screening of 904 miRNAs followed ......" | 25142144 | |
| hsa-miR-196b-5p | lymphoma | differentiation | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
| hsa-miR-196b-5p | sarcoma | worse prognosis; metastasis; recurrence; poor survival | "Combined elevation of microRNA 196a and microRNA 1 ......" | 24747591 |
Reported gene related to hsa-miR-196b-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-196b-5p | acute myeloid leukemia | CD33 | "In T-ALL patients miR-196a and miR-196b expression ......" | 20570349 |
| hsa-miR-196b-5p | acute myeloid leukemia | CD34 | "In T-ALL patients miR-196a and miR-196b expression ......" | 20570349 |
| hsa-miR-196b-5p | cervical and endocervical cancer | CD80 | "MicroRNA 196b regulates the homeobox B7 vascular e ......" | 23861821 |
| hsa-miR-196b-5p | acute myeloid leukemia | ERG | "The role of microRNA 196a and microRNA 196b as ERG ......" | 20570349 |
| hsa-miR-196b-5p | gastric cancer | ETS2 | "Transcriptional regulation of miR 196b by ETS2 in ......" | 22298639 |
| hsa-miR-196b-5p | colorectal cancer | FAS | "MicroRNA 196B regulates FAS mediated apoptosis in ......" | 25605245 |
| hsa-miR-196b-5p | acute myeloid leukemia | HOTAIRM1 | "Moreover HOTAIRM1 expression was associated with a ......" | 26436590 |
| hsa-miR-196b-5p | gastric cancer | HOXA10 | "Overexpression of miR 196b and HOXA10 characterize ......" | 24222951 |
| hsa-miR-196b-5p | lung squamous cell cancer | HOXA9 | "HOXA9 expression is inversely correlated with miR- ......" | 26586336 |
| hsa-miR-196b-5p | cervical and endocervical cancer | HOXB7 | "MicroRNA 196b regulates the homeobox B7 vascular e ......" | 23861821 |
| hsa-miR-196b-5p | breast cancer | HOXC8 | "We found that miR-196 inhibited the expression of ......" | 20736365 |
| hsa-miR-196b-5p | cervical and endocervical cancer | VEGFA | "Concordantly siRNA knockdown of HOXB7 or VEGF phen ......" | 23861821 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-196b-5p | LAMB2 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.204; TCGA BRCA -0.088; TCGA COAD -0.127; TCGA ESCA -0.149; TCGA HNSC -0.118; TCGA LIHC -0.059; TCGA LUAD -0.075; TCGA LUSC -0.187; TCGA PRAD -0.111; TCGA SARC -0.131; TCGA STAD -0.079; TCGA UCEC -0.063 |
hsa-miR-196b-5p | PTGS1 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.915; TCGA CESC -0.349; TCGA COAD -0.26; TCGA ESCA -0.286; TCGA HNSC -0.15; TCGA KIRP -0.164; TCGA LUAD -0.056; TCGA LUSC -0.177; TCGA OV -0.093; TCGA PAAD -0.105; TCGA PRAD -0.561; TCGA STAD -0.205; TCGA UCEC -0.325 |
hsa-miR-196b-5p | EPHA3 | 9 cancers: BLCA; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.368; TCGA ESCA -0.273; TCGA HNSC -0.121; TCGA KIRP -0.192; TCGA LUAD -0.175; TCGA LUSC -0.186; TCGA PAAD -0.162; TCGA PRAD -0.29; TCGA STAD -0.155 |
hsa-miR-196b-5p | DNM3 | 9 cancers: BLCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.122; TCGA HNSC -0.07; TCGA KIRP -0.128; TCGA LGG -0.132; TCGA LUAD -0.063; TCGA LUSC -0.27; TCGA PAAD -0.069; TCGA PRAD -0.236; TCGA STAD -0.12 |
hsa-miR-196b-5p | KCNQ5 | 9 cancers: BLCA; COAD; ESCA; LGG; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.56; TCGA COAD -0.362; TCGA ESCA -0.442; TCGA LGG -0.086; TCGA PAAD -0.103; TCGA PRAD -0.437; TCGA SARC -0.398; TCGA STAD -0.302; TCGA UCEC -0.117 |
hsa-miR-196b-5p | PLN | 9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -1.047; TCGA COAD -0.428; TCGA ESCA -0.61; TCGA HNSC -0.563; TCGA LUSC -0.388; TCGA PAAD -0.165; TCGA PRAD -0.55; TCGA SARC -0.355; TCGA STAD -0.436 |
hsa-miR-196b-5p | RBMS3 | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.437; TCGA COAD -0.197; TCGA ESCA -0.253; TCGA HNSC -0.143; TCGA LIHC -0.071; TCGA LUAD -0.141; TCGA LUSC -0.209; TCGA PAAD -0.096; TCGA PRAD -0.437; TCGA STAD -0.201 |
hsa-miR-196b-5p | GPRASP1 | 10 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.287; TCGA ESCA -0.264; TCGA HNSC -0.157; TCGA KIRC -0.122; TCGA LUAD -0.104; TCGA LUSC -0.138; TCGA PAAD -0.287; TCGA PRAD -0.414; TCGA SARC -0.166; TCGA STAD -0.275 |
hsa-miR-196b-5p | CBFA2T3 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.248; TCGA BRCA -0.115; TCGA COAD -0.235; TCGA ESCA -0.198; TCGA HNSC -0.079; TCGA LGG -0.077; TCGA LIHC -0.103; TCGA LUAD -0.112; TCGA LUSC -0.142; TCGA PAAD -0.096; TCGA SARC -0.108; TCGA STAD -0.158 |
hsa-miR-196b-5p | CREBL2 | 11 cancers: BLCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.09; TCGA COAD -0.054; TCGA ESCA -0.066; TCGA KIRP -0.055; TCGA LIHC -0.069; TCGA LUAD -0.069; TCGA LUSC -0.114; TCGA PAAD -0.108; TCGA SARC -0.06; TCGA STAD -0.068; TCGA UCEC -0.075 |
hsa-miR-196b-5p | RET | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.176; TCGA BRCA -0.206; TCGA COAD -0.185; TCGA ESCA -0.304; TCGA KIRC -0.136; TCGA KIRP -0.206; TCGA LGG -0.092; TCGA PAAD -0.247; TCGA STAD -0.09; TCGA UCEC -0.128 |
hsa-miR-196b-5p | SNX29 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD | mirMAP | TCGA BLCA -0.137; TCGA CESC -0.085; TCGA COAD -0.087; TCGA ESCA -0.162; TCGA HNSC -0.111; TCGA LUAD -0.077; TCGA LUSC -0.117; TCGA PAAD -0.066; TCGA STAD -0.092 |
hsa-miR-196b-5p | TEF | 13 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.091; TCGA ESCA -0.129; TCGA HNSC -0.074; TCGA KIRC -0.124; TCGA KIRP -0.121; TCGA LGG -0.13; TCGA LUAD -0.127; TCGA PAAD -0.091; TCGA PRAD -0.197; TCGA SARC -0.158; TCGA THCA -0.085; TCGA STAD -0.141; TCGA UCEC -0.126 |
hsa-miR-196b-5p | TMOD2 | 9 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUSC; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.079; TCGA CESC -0.146; TCGA ESCA -0.08; TCGA KIRP -0.118; TCGA LGG -0.088; TCGA LUSC -0.104; TCGA PAAD -0.178; TCGA PRAD -0.156; TCGA STAD -0.114 |
hsa-miR-196b-5p | DOK6 | 9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD | miRNATAP | TCGA BLCA -0.485; TCGA COAD -0.122; TCGA ESCA -0.119; TCGA HNSC -0.089; TCGA LGG -0.155; TCGA LUAD -0.139; TCGA LUSC -0.206; TCGA PAAD -0.175; TCGA STAD -0.156 |
hsa-miR-196b-5p | GAS7 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.62; TCGA COAD -0.216; TCGA ESCA -0.293; TCGA HNSC -0.292; TCGA KIRP -0.108; TCGA LUAD -0.058; TCGA LUSC -0.274; TCGA PAAD -0.126; TCGA PRAD -0.314; TCGA STAD -0.168 |
hsa-miR-196b-5p | CALM1 | 9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.121; TCGA CESC -0.06; TCGA ESCA -0.082; TCGA HNSC -0.082; TCGA LUSC -0.084; TCGA PAAD -0.086; TCGA PRAD -0.179; TCGA SARC -0.116; TCGA STAD -0.066 |
hsa-miR-196b-5p | PBX3 | 9 cancers: BLCA; COAD; ESCA; KIRP; LUSC; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.152; TCGA COAD -0.119; TCGA ESCA -0.145; TCGA KIRP -0.121; TCGA LUSC -0.083; TCGA PAAD -0.17; TCGA THCA -0.133; TCGA STAD -0.141; TCGA UCEC -0.145 |
hsa-miR-196b-5p | HLF | 12 cancers: BLCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.639; TCGA ESCA -0.293; TCGA HNSC -0.186; TCGA LGG -0.118; TCGA LIHC -0.123; TCGA LUAD -0.315; TCGA LUSC -0.123; TCGA OV -0.118; TCGA PAAD -0.372; TCGA PRAD -0.417; TCGA SARC -0.207; TCGA STAD -0.386 |
hsa-miR-196b-5p | SORCS1 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.652; TCGA BRCA -0.157; TCGA COAD -0.378; TCGA ESCA -0.705; TCGA HNSC -0.454; TCGA LUAD -0.162; TCGA LUSC -0.136; TCGA OV -0.154; TCGA PAAD -0.392; TCGA PRAD -0.533; TCGA STAD -0.452 |
hsa-miR-196b-5p | PPP1R16B | 13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.296; TCGA COAD -0.257; TCGA ESCA -0.156; TCGA HNSC -0.1; TCGA KIRC -0.101; TCGA KIRP -0.143; TCGA LGG -0.065; TCGA LUAD -0.057; TCGA LUSC -0.311; TCGA OV -0.069; TCGA PAAD -0.112; TCGA PRAD -0.253; TCGA STAD -0.123 |
hsa-miR-196b-5p | ERG | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD | miRNATAP | TCGA BLCA -0.282; TCGA COAD -0.23; TCGA ESCA -0.154; TCGA HNSC -0.055; TCGA KIRP -0.188; TCGA LIHC -0.075; TCGA LUAD -0.097; TCGA LUSC -0.278; TCGA PAAD -0.156; TCGA STAD -0.098 |
hsa-miR-196b-5p | ZNF516 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.155; TCGA BRCA -0.082; TCGA COAD -0.063; TCGA ESCA -0.078; TCGA KIRC -0.085; TCGA LUAD -0.051; TCGA PAAD -0.168; TCGA PRAD -0.469; TCGA STAD -0.078 |
hsa-miR-196b-5p | CPEB3 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; STAD | miRNATAP | TCGA BLCA -0.13; TCGA CESC -0.112; TCGA COAD -0.061; TCGA ESCA -0.141; TCGA HNSC -0.216; TCGA KIRC -0.119; TCGA LGG -0.14; TCGA LIHC -0.153; TCGA LUAD -0.068; TCGA LUSC -0.143; TCGA PAAD -0.082; TCGA STAD -0.054 |
hsa-miR-196b-5p | CPEB4 | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.238; TCGA CESC -0.113; TCGA COAD -0.067; TCGA ESCA -0.118; TCGA HNSC -0.224; TCGA KIRP -0.134; TCGA LGG -0.052; TCGA LIHC -0.072; TCGA LUAD -0.067; TCGA LUSC -0.2; TCGA PAAD -0.104; TCGA SARC -0.103; TCGA THCA -0.051; TCGA STAD -0.073 |
hsa-miR-196b-5p | CPM | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.161; TCGA COAD -0.222; TCGA ESCA -0.129; TCGA HNSC -0.103; TCGA LIHC -0.07; TCGA LUAD -0.121; TCGA LUSC -0.437; TCGA PAAD -0.075; TCGA PRAD -0.353; TCGA STAD -0.065 |
hsa-miR-196b-5p | EYA4 | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; UCEC | miRNATAP | TCGA BLCA -0.189; TCGA COAD -0.274; TCGA ESCA -0.28; TCGA HNSC -0.23; TCGA KIRC -0.239; TCGA KIRP -0.23; TCGA LUSC -0.143; TCGA PRAD -0.584; TCGA UCEC -0.484 |
hsa-miR-196b-5p | CACNB4 | 12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.366; TCGA COAD -0.177; TCGA ESCA -0.227; TCGA HNSC -0.241; TCGA KIRC -0.23; TCGA KIRP -0.186; TCGA LGG -0.056; TCGA LUAD -0.112; TCGA LUSC -0.122; TCGA PAAD -0.107; TCGA PRAD -0.271; TCGA STAD -0.123 |
hsa-miR-196b-5p | PPP1R12B | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.438; TCGA COAD -0.201; TCGA ESCA -0.298; TCGA HNSC -0.233; TCGA KIRC -0.095; TCGA LUAD -0.125; TCGA LUSC -0.193; TCGA PAAD -0.111; TCGA PRAD -0.447; TCGA SARC -0.233; TCGA STAD -0.268 |
hsa-miR-196b-5p | ADCY9 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.253; TCGA BRCA -0.069; TCGA CESC -0.123; TCGA COAD -0.098; TCGA ESCA -0.091; TCGA HNSC -0.068; TCGA LIHC -0.081; TCGA LUAD -0.12; TCGA LUSC -0.144; TCGA PAAD -0.068; TCGA PRAD -0.171; TCGA THCA -0.053; TCGA STAD -0.072; TCGA UCEC -0.187 |
hsa-miR-196b-5p | KSR2 | 9 cancers: BRCA; KIRC; LGG; LUAD; LUSC; OV; PAAD; SARC; UCEC | mirMAP | TCGA BRCA -0.089; TCGA KIRC -0.228; TCGA LGG -0.369; TCGA LUAD -0.094; TCGA LUSC -0.114; TCGA OV -0.075; TCGA PAAD -0.238; TCGA SARC -0.313; TCGA UCEC -0.094 |
hsa-miR-196b-5p | WDR37 | 9 cancers: CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.116; TCGA ESCA -0.081; TCGA HNSC -0.052; TCGA KIRC -0.051; TCGA LGG -0.06; TCGA LUAD -0.051; TCGA LUSC -0.052; TCGA PAAD -0.065; TCGA UCEC -0.053 |
hsa-miR-196b-5p | NPAS3 | 9 cancers: COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNATAP | TCGA COAD -0.253; TCGA ESCA -0.269; TCGA HNSC -0.131; TCGA LUAD -0.123; TCGA LUSC -0.091; TCGA OV -0.108; TCGA PAAD -0.186; TCGA PRAD -0.232; TCGA STAD -0.22 |
hsa-miR-196b-5p | NTN4 | 9 cancers: ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA ESCA -0.188; TCGA HNSC -0.144; TCGA LGG -0.103; TCGA LIHC -0.064; TCGA LUAD -0.094; TCGA LUSC -0.298; TCGA PRAD -0.381; TCGA STAD -0.167; TCGA UCEC -0.106 |
hsa-miR-196b-5p | DOCK3 | 9 cancers: ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA ESCA -0.22; TCGA HNSC -0.185; TCGA KIRC -0.287; TCGA LGG -0.101; TCGA PAAD -0.137; TCGA PRAD -0.386; TCGA SARC -0.34; TCGA STAD -0.197; TCGA UCEC -0.184 |
Enriched cancer pathways of putative targets