microRNA information: hsa-miR-198
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-198 | miRbase |
Accession: | MIMAT0000228 | miRbase |
Precursor name: | hsa-mir-198 | miRbase |
Precursor accession: | MI0000240 | miRbase |
Symbol: | MIR198 | HGNC |
RefSeq ID: | NR_029584 | GenBank |
Sequence: | GGUCCAGAGGGGAGAUAGGUUC |
Reported expression in cancers: hsa-miR-198
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-198 | gastric cancer | downregulation | "Decreased miR 198 expression and its prognostic si ......" | 26852230 | qPCR |
hsa-miR-198 | liver cancer | downregulation | "Because understanding the pathogenesis of viral-as ......" | 18307259 | qPCR |
hsa-miR-198 | lung cancer | downregulation | "Downregulation of cell free miR 198 as a diagnosti ......" | 23354517 | Microarray; qPCR |
hsa-miR-198 | prostate cancer | deregulation | "Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......" | 23781281 | |
hsa-miR-198 | retinoblastoma | upregulation | "Identification of miRNAs associated with tumorigen ......" | 18818933 | Microarray; Northern blot; in situ hybridization |
Reported cancer pathway affected by hsa-miR-198
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-198 | lung cancer | Apoptosis pathway | "MicroRNA 198 inhibits proliferation and induces ap ......" | 24357456 |
Reported cancer prognosis affected by hsa-miR-198
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-198 | colorectal cancer | metastasis; poor survival | "MiR 198 represses tumor growth and metastasis in c ......" | 25174450 | Luciferase; Western blot |
hsa-miR-198 | esophageal cancer | worse prognosis; poor survival | "Involvement of microRNA 198 overexpression in the ......" | 24175778 | |
hsa-miR-198 | gastric cancer | poor survival; staging; metastasis; tumor size; progression | "Decreased miR 198 expression and its prognostic si ......" | 26852230 | |
hsa-miR-198 | kidney renal cell cancer | poor survival | "miR 29b and miR 198 overexpression in CD8+ T cells ......" | 27063186 | |
hsa-miR-198 | liver cancer | malignant trasformation; worse prognosis | "Because understanding the pathogenesis of viral-as ......" | 18307259 | |
hsa-miR-198 | liver cancer | cell migration | "miR 198 inhibits migration and invasion of hepatoc ......" | 21658389 | |
hsa-miR-198 | liver cancer | progression; tumorigenesis; staging; metastasis; cell migration; motility | "Lower expressed miR 198 and its potential targets ......" | 27578984 | |
hsa-miR-198 | lung cancer | malignant trasformation | "Downregulation of cell free miR 198 as a diagnosti ......" | 23354517 | |
hsa-miR-198 | lung cancer | tumorigenesis | "MicroRNA 198 inhibits proliferation and induces ap ......" | 24357456 | |
hsa-miR-198 | pancreatic cancer | metastasis; poor survival; worse prognosis | "A tumorigenic factor interactome connected through ......" | 23989979 | |
hsa-miR-198 | retinoblastoma | tumorigenesis | "Identification of miRNAs associated with tumorigen ......" | 18818933 | |
hsa-miR-198 | sarcoma | staging; metastasis | "MicroRNA 198 inhibited tumorous behaviors of human ......" | 26970302 | Cell proliferation assay; Cell Proliferation Assay |
Reported gene related to hsa-miR-198
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-198 | prostate cancer | BIRC7 | "Livin expression may be regulated by miR 198 in hu ......" | 23069480 |
hsa-miR-198 | lung cancer | FGFR1 | "MicroRNA 198 inhibits proliferation and induces ap ......" | 24357456 |
hsa-miR-198 | colorectal cancer | FUT8 | "fucosyl transferase 8 FUT8 was identified as a pot ......" | 25174450 |
hsa-miR-198 | liver cancer | HGF | "Forced expression of miR-198 decreased c-MET expre ......" | 21658389 |
hsa-miR-198 | kidney renal cell cancer | JAK3 | "miR 29b and miR 198 overexpression in CD8+ T cells ......" | 27063186 |
hsa-miR-198 | kidney renal cell cancer | MCL1 | "miR 29b and miR 198 overexpression in CD8+ T cells ......" | 27063186 |
hsa-miR-198 | liver cancer | MET | "Herein we show that miR-198 directly targets c-MET ......" | 21658389 |
hsa-miR-198 | pancreatic cancer | MSLN | "We found that miR-198 is downregulated in pancreat ......" | 23989979 |
hsa-miR-198 | pancreatic cancer | POU2F2 | "We found that miR-198 is downregulated in pancreat ......" | 23989979 |
hsa-miR-198 | sarcoma | ROCK1 | "MicroRNA 198 inhibited tumorous behaviors of human ......" | 26970302 |
hsa-miR-198 | pancreatic cancer | VCP | "Furthermore miR-198 repression leads to overexpres ......" | 23989979 |