microRNA information: hsa-miR-199b-3p

SectionIDlink
Mature name: hsa-miR-199b-3pmiRbase
Accession: MIMAT0004563miRbase
Precursor name: hsa-mir-199b miRbase
Precursor accession: MI0000282miRbase
Symbol: MIR199BHGNC
RefSeq ID: NR_029619GenBank
Sequence: ACAGUAGUCUGCACAUUGGUUA



Reported expression in cancers: hsa-miR-199b-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-199b-3p

acute myeloid leukemiadownregulation"miR 199b a novel tumor suppressor miRNA in acute m ......"26848406
hsa-miR-199b-3p

bladder cancerderegulation"Expression levels of miRNAs were assessed by quant ......"23169479qPCR
hsa-miR-199b-3p

colorectal cancerderegulation"In the present study by comparing the miRNA expres ......"27145368
hsa-miR-199b-3p

colorectal cancerderegulation"Downregulation of microRNA 199b predicts unfavorab ......"27517624
hsa-miR-199b-3p

liver cancerderegulation"Underexpressed microRNA 199b 5p targets hypoxia in ......"21557766
hsa-miR-199b-3p

thyroid cancerderegulation"A miR-microarray study was conducted to identify m ......"24631480Microarray; qPCR
hsa-miR-199b-3p

thyroid cancerderegulation"Serum miRNA was quantified in 31 female thyroidect ......"26341226qPCR



Reported cancer pathway affected by hsa-miR-199b-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-199b-3p

acute myeloid leukemiaApoptosis pathway"miR 199b a novel tumor suppressor miRNA in acute m ......"26848406
hsa-miR-199b-3p

sarcomaNotch signaling pathway"MicroRNA 199b 5p is involved in the Notch signalin ......"23574781
hsa-miR-199b-3p

thyroid cancercell cycle pathway; Apoptosis pathway"A miR-microarray study was conducted to identify m ......"24631480



Reported cancer prognosis affected by hsa-miR-199b-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-199b-3p

acute myeloid leukemiapoor survival"miR 199b a novel tumor suppressor miRNA in acute m ......"26848406
hsa-miR-199b-3p

bladder cancerstaging"Expression levels of miRNAs were assessed by quant ......"23169479
hsa-miR-199b-3p

colorectal cancermetastasis; staging; poor survival; worse prognosis"Downregulation of miR 199b is associated with dist ......"27145368Luciferase
hsa-miR-199b-3p

colorectal cancerworse prognosis; metastasis; progression; poor survival"Downregulation of microRNA 199b predicts unfavorab ......"27517624
hsa-miR-199b-3p

liver cancerworse prognosis; progression; poor survival; malignant trasformation"Underexpressed microRNA 199b 5p targets hypoxia in ......"21557766Western blot; Luciferase
hsa-miR-199b-3p

ovarian cancerdrug resistance"Epigenetic silencing of microRNA 199b 5p is associ ......"24659709



Reported gene related to hsa-miR-199b-3p

miRNAcancergenereportingPUBMED
hsa-miR-199b-3p

breast cancerERBB2"MiR 199b 5p targets HER2 in breast cancer cells ......"23296799
hsa-miR-199b-3p

acute myeloid leukemiaHDAC9"Treatment of THP-1 cells represents M5-subtype wit ......"26848406
hsa-miR-199b-3p

acute myeloid leukemiaHOXA7"Furthermore significant inverse correlation of Hox ......"26848406
hsa-miR-199b-3p

acute myeloid leukemiaHOXB6"Furthermore significant inverse correlation of Hox ......"26848406
hsa-miR-199b-3p

colorectal cancerKRAS"The miR-199b prognostic impact was particularly ev ......"27517624
hsa-miR-199b-3p

ovarian cancerNOTCH1"Epigenetic silencing of microRNA 199b 5p is associ ......"24659709
hsa-miR-199b-3p

acute myeloid leukemiaPODXL"Previously we demonstrated that miR-199b was signi ......"26848406
hsa-miR-199b-3p

colorectal cancerSIRT1"Downregulation of miR 199b is associated with dist ......"27145368



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-199b-3p
YWHAE
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA
MirTarget; PITA; miRNATAP
TCGA BLCA -0.061; TCGA BRCA -0.07; TCGA CESC -0.064; TCGA COAD -0.109; TCGA HNSC -0.081; TCGA KIRP -0.076; TCGA LGG -0.068; TCGA LUAD -0.091; TCGA OV -0.108; TCGA PAAD -0.199; TCGA PRAD -0.121; TCGA THCA -0.074
hsa-miR-199b-3p
FAM199X
10 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.054; TCGA ESCA -0.145; TCGA HNSC -0.143; TCGA LUAD -0.065; TCGA LUSC -0.125; TCGA PRAD -0.11; TCGA SARC -0.172; TCGA THCA -0.058; TCGA STAD -0.127; TCGA UCEC -0.096
hsa-miR-199b-3p
PPP1R9A
10 cancers: BLCA; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget; PITA; miRNATAP
TCGA BLCA -0.589; TCGA ESCA -0.691; TCGA KIRP -0.109; TCGA LGG -0.113; TCGA LUAD -0.13; TCGA LUSC -0.759; TCGA PAAD -0.471; TCGA PRAD -0.139; TCGA THCA -0.062; TCGA STAD -0.362
hsa-miR-199b-3p
KIAA0141
12 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.171; TCGA BRCA -0.069; TCGA COAD -0.099; TCGA ESCA -0.205; TCGA LIHC -0.052; TCGA LUAD -0.117; TCGA LUSC -0.105; TCGA PAAD -0.092; TCGA PRAD -0.077; TCGA SARC -0.053; TCGA THCA -0.076; TCGA STAD -0.093
hsa-miR-199b-3p
NRBP2
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; SARC; STAD
MirTarget
TCGA BLCA -0.097; TCGA BRCA -0.085; TCGA KIRC -0.351; TCGA KIRP -0.25; TCGA LGG -0.12; TCGA LIHC -0.128; TCGA LUSC -0.221; TCGA SARC -0.305; TCGA STAD -0.137
hsa-miR-199b-3p
NLK
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.079; TCGA CESC -0.059; TCGA COAD -0.099; TCGA ESCA -0.209; TCGA LIHC -0.068; TCGA LUAD -0.063; TCGA LUSC -0.217; TCGA PAAD -0.307; TCGA SARC -0.088; TCGA THCA -0.055; TCGA UCEC -0.076
hsa-miR-199b-3p
CETN3
9 cancers: BLCA; HNSC; KIRC; LIHC; LUSC; OV; PAAD; PRAD; UCEC
MirTarget; PITA
TCGA BLCA -0.122; TCGA HNSC -0.094; TCGA KIRC -0.057; TCGA LIHC -0.082; TCGA LUSC -0.171; TCGA OV -0.125; TCGA PAAD -0.133; TCGA PRAD -0.082; TCGA UCEC -0.071
hsa-miR-199b-3p
FAM60A
9 cancers: BLCA; CESC; COAD; KIRP; LGG; OV; PRAD; SARC; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.122; TCGA CESC -0.097; TCGA COAD -0.175; TCGA KIRP -0.052; TCGA LGG -0.123; TCGA OV -0.118; TCGA PRAD -0.086; TCGA SARC -0.101; TCGA UCEC -0.068
hsa-miR-199b-3p
KDM3A
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; SARC
MirTarget; miRNATAP
TCGA BLCA -0.128; TCGA CESC -0.073; TCGA COAD -0.143; TCGA HNSC -0.096; TCGA KIRC -0.191; TCGA KIRP -0.08; TCGA LGG -0.054; TCGA LIHC -0.077; TCGA LUSC -0.097; TCGA SARC -0.115
hsa-miR-199b-3p
KIAA0907
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; UCEC
MirTarget; PITA
TCGA BLCA -0.167; TCGA BRCA -0.143; TCGA KIRC -0.25; TCGA KIRP -0.096; TCGA LGG -0.051; TCGA LIHC -0.116; TCGA LUSC -0.203; TCGA OV -0.057; TCGA UCEC -0.143
hsa-miR-199b-3p
ZC3H14
10 cancers: BLCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.088; TCGA COAD -0.126; TCGA LUAD -0.124; TCGA LUSC -0.09; TCGA OV -0.065; TCGA PAAD -0.174; TCGA PRAD -0.098; TCGA SARC -0.106; TCGA THCA -0.066; TCGA STAD -0.102
hsa-miR-199b-3p
RHOT1
10 cancers: BLCA; CESC; COAD; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD
MirTarget; PITA
TCGA BLCA -0.076; TCGA CESC -0.07; TCGA COAD -0.086; TCGA LUAD -0.104; TCGA LUSC -0.113; TCGA OV -0.058; TCGA PAAD -0.101; TCGA SARC -0.122; TCGA THCA -0.077; TCGA STAD -0.212
hsa-miR-199b-3p
ARG2
9 cancers: BLCA; COAD; HNSC; LIHC; OV; PAAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.223; TCGA COAD -0.132; TCGA HNSC -0.209; TCGA LIHC -0.088; TCGA OV -0.076; TCGA PAAD -0.337; TCGA SARC -0.218; TCGA THCA -0.104; TCGA STAD -0.145
hsa-miR-199b-3p
KIAA0319L
10 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.068; TCGA BRCA -0.161; TCGA ESCA -0.244; TCGA LUAD -0.068; TCGA LUSC -0.094; TCGA PAAD -0.103; TCGA PRAD -0.153; TCGA THCA -0.081; TCGA STAD -0.086; TCGA UCEC -0.073
hsa-miR-199b-3p
SLC38A1
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; SARC; UCEC
PITA
TCGA BLCA -0.156; TCGA CESC -0.142; TCGA COAD -0.129; TCGA HNSC -0.111; TCGA KIRC -0.181; TCGA KIRP -0.077; TCGA LGG -0.1; TCGA SARC -0.431; TCGA UCEC -0.174
hsa-miR-199b-3p
ACVR2B
13 cancers: BLCA; ESCA; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.159; TCGA ESCA -0.137; TCGA KIRP -0.078; TCGA LGG -0.22; TCGA LUAD -0.109; TCGA LUSC -0.153; TCGA OV -0.082; TCGA PAAD -0.304; TCGA PRAD -0.116; TCGA SARC -0.079; TCGA THCA -0.07; TCGA STAD -0.161; TCGA UCEC -0.06
hsa-miR-199b-3p
OXSR1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; STAD
PITA; miRNATAP
TCGA BLCA -0.062; TCGA CESC -0.104; TCGA COAD -0.079; TCGA ESCA -0.174; TCGA HNSC -0.061; TCGA LUAD -0.061; TCGA LUSC -0.062; TCGA SARC -0.092; TCGA STAD -0.129
hsa-miR-199b-3p
TACC2
10 cancers: BLCA; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.148; TCGA ESCA -0.256; TCGA LGG -0.064; TCGA LIHC -0.07; TCGA LUAD -0.366; TCGA LUSC -0.155; TCGA PAAD -0.293; TCGA SARC -0.431; TCGA THCA -0.072; TCGA STAD -0.206
hsa-miR-199b-3p
UBL3
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; PAAD; PRAD; THCA; STAD
PITA
TCGA BLCA -0.081; TCGA COAD -0.129; TCGA ESCA -0.386; TCGA LGG -0.073; TCGA LUAD -0.173; TCGA PAAD -0.168; TCGA PRAD -0.094; TCGA THCA -0.052; TCGA STAD -0.298
hsa-miR-199b-3p
MKRN1
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.095; TCGA BRCA -0.071; TCGA ESCA -0.126; TCGA HNSC -0.093; TCGA KIRP -0.058; TCGA LGG -0.052; TCGA LUAD -0.056; TCGA LUSC -0.144; TCGA PAAD -0.136; TCGA PRAD -0.057; TCGA SARC -0.094; TCGA STAD -0.066; TCGA UCEC -0.053
hsa-miR-199b-3p
PLEKHH1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA
PITA; miRNATAP
TCGA BLCA -0.388; TCGA BRCA -0.1; TCGA CESC -0.178; TCGA ESCA -0.889; TCGA HNSC -0.3; TCGA KIRC -0.135; TCGA KIRP -0.212; TCGA LIHC -0.111; TCGA LUSC -0.316; TCGA PAAD -0.351; TCGA PRAD -0.249; TCGA THCA -0.062
hsa-miR-199b-3p
ANKRD52
9 cancers: BLCA; CESC; ESCA; KIRP; LIHC; LUAD; PAAD; PRAD; SARC
PITA; miRNATAP
TCGA BLCA -0.07; TCGA CESC -0.104; TCGA ESCA -0.121; TCGA KIRP -0.06; TCGA LIHC -0.109; TCGA LUAD -0.065; TCGA PAAD -0.14; TCGA PRAD -0.084; TCGA SARC -0.064
hsa-miR-199b-3p
SLC45A4
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.103; TCGA BRCA -0.093; TCGA ESCA -0.355; TCGA HNSC -0.122; TCGA LUAD -0.132; TCGA PAAD -0.152; TCGA PRAD -0.057; TCGA THCA -0.096; TCGA UCEC -0.127
hsa-miR-199b-3p
LYRM2
10 cancers: BLCA; COAD; ESCA; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.089; TCGA COAD -0.084; TCGA ESCA -0.099; TCGA LUAD -0.087; TCGA OV -0.137; TCGA PAAD -0.164; TCGA PRAD -0.128; TCGA SARC -0.056; TCGA STAD -0.137; TCGA UCEC -0.053
hsa-miR-199b-3p
MLLT6
9 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUSC; PAAD; PRAD; SARC
mirMAP; miRNATAP
TCGA BLCA -0.149; TCGA BRCA -0.108; TCGA ESCA -0.231; TCGA LGG -0.082; TCGA LIHC -0.066; TCGA LUSC -0.171; TCGA PAAD -0.138; TCGA PRAD -0.074; TCGA SARC -0.123
hsa-miR-199b-3p
PGPEP1
9 cancers: BLCA; BRCA; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.24; TCGA BRCA -0.153; TCGA ESCA -0.614; TCGA LIHC -0.117; TCGA LUSC -0.127; TCGA PAAD -0.232; TCGA PRAD -0.059; TCGA SARC -0.212; TCGA THCA -0.113
hsa-miR-199b-3p
MBD1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUSC; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.131; TCGA BRCA -0.08; TCGA CESC -0.06; TCGA HNSC -0.073; TCGA KIRC -0.066; TCGA LUSC -0.064; TCGA PAAD -0.121; TCGA SARC -0.067; TCGA STAD -0.076
hsa-miR-199b-3p
LIMD1
11 cancers: BLCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.183; TCGA CESC -0.094; TCGA ESCA -0.304; TCGA KIRP -0.064; TCGA LIHC -0.076; TCGA LUAD -0.269; TCGA LUSC -0.21; TCGA PRAD -0.084; TCGA SARC -0.084; TCGA THCA -0.068; TCGA STAD -0.15
hsa-miR-199b-3p
RBM47
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.141; TCGA COAD -0.189; TCGA ESCA -0.691; TCGA HNSC -0.247; TCGA LUAD -0.16; TCGA LUSC -0.21; TCGA PRAD -0.114; TCGA THCA -0.064; TCGA UCEC -0.163
hsa-miR-199b-3p
LUC7L3
10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.184; TCGA BRCA -0.058; TCGA KIRC -0.175; TCGA KIRP -0.137; TCGA LGG -0.13; TCGA LIHC -0.065; TCGA LUSC -0.227; TCGA PAAD -0.104; TCGA SARC -0.055; TCGA UCEC -0.074
hsa-miR-199b-3p
SCAI
12 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.092; TCGA COAD -0.091; TCGA HNSC -0.091; TCGA LGG -0.055; TCGA LIHC -0.06; TCGA LUAD -0.185; TCGA LUSC -0.207; TCGA OV -0.071; TCGA PAAD -0.157; TCGA PRAD -0.103; TCGA SARC -0.105; TCGA STAD -0.134
hsa-miR-199b-3p
MFSD6
12 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.144; TCGA COAD -0.141; TCGA ESCA -0.151; TCGA HNSC -0.092; TCGA LGG -0.052; TCGA LUAD -0.087; TCGA LUSC -0.106; TCGA PAAD -0.198; TCGA PRAD -0.1; TCGA SARC -0.327; TCGA THCA -0.087; TCGA STAD -0.184
hsa-miR-199b-3p
ITPK1
9 cancers: BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; THCA
MirTarget; PITA; miRNATAP
TCGA BRCA -0.209; TCGA ESCA -0.379; TCGA HNSC -0.061; TCGA LGG -0.08; TCGA LUAD -0.133; TCGA LUSC -0.128; TCGA PAAD -0.133; TCGA SARC -0.343; TCGA THCA -0.059
hsa-miR-199b-3p
CCDC85C
11 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.163; TCGA CESC -0.15; TCGA HNSC -0.183; TCGA LGG -0.08; TCGA LIHC -0.114; TCGA LUAD -0.119; TCGA PAAD -0.257; TCGA PRAD -0.192; TCGA SARC -0.197; TCGA THCA -0.115; TCGA STAD -0.186
hsa-miR-199b-3p
LLGL2
9 cancers: BRCA; ESCA; HNSC; LIHC; LUSC; PAAD; SARC; THCA; UCEC
PITA; miRNATAP
TCGA BRCA -0.274; TCGA ESCA -0.707; TCGA HNSC -0.286; TCGA LIHC -0.07; TCGA LUSC -0.264; TCGA PAAD -0.473; TCGA SARC -0.19; TCGA THCA -0.077; TCGA UCEC -0.099
hsa-miR-199b-3p
MMAB
11 cancers: BRCA; HNSC; LGG; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
PITA
TCGA BRCA -0.107; TCGA HNSC -0.147; TCGA LGG -0.087; TCGA LIHC -0.117; TCGA LUAD -0.121; TCGA OV -0.082; TCGA PAAD -0.402; TCGA PRAD -0.091; TCGA THCA -0.077; TCGA STAD -0.147; TCGA UCEC -0.072
hsa-miR-199b-3p
IMMT
10 cancers: CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
PITA
TCGA CESC -0.071; TCGA COAD -0.075; TCGA ESCA -0.086; TCGA HNSC -0.059; TCGA LUAD -0.072; TCGA PAAD -0.064; TCGA PRAD -0.067; TCGA SARC -0.089; TCGA STAD -0.074; TCGA UCEC -0.066
hsa-miR-199b-3p
SUZ12
10 cancers: COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRNATAP
TCGA COAD -0.155; TCGA ESCA -0.11; TCGA HNSC -0.106; TCGA LIHC -0.066; TCGA LUAD -0.054; TCGA LUSC -0.087; TCGA PRAD -0.094; TCGA SARC -0.154; TCGA STAD -0.101; TCGA UCEC -0.086





Enriched cancer pathways of putative targets