microRNA information: hsa-miR-19b-3p

SectionIDlink
Mature name: hsa-miR-19b-3pmiRbase
Accession: MIMAT0000074miRbase
Precursor name: hsa-mir-19b-1 miRbase
Precursor accession: MI0000074miRbase
Symbol: MIR19B1HGNC
RefSeq ID: NR_029490GenBank
Sequence: UGUGCAAAUCCAUGCAAAACUGA



Reported expression in cancers: hsa-miR-19b-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-19b-3p

cervical and endocervical cancerupregulation"Up-regulation of miR-19a and miR-19b promoted cell ......"22561557
hsa-miR-19b-3p

colon cancerupregulation"The expressions of microRNAs were profiled with a ......"22382630qPCR; Microarray
hsa-miR-19b-3p

gastric cancerdownregulation"Compared with the expression levels in the normal ......"25013480
hsa-miR-19b-3p

gastric cancerdownregulation"Real-time quantitative PCR RTQ-PCR was employed to ......"25270964qPCR
hsa-miR-19b-3p

gastric cancerdownregulation"Circulating MiR 16 5p and MiR 19b 3p as Two Novel ......"25897338Reverse transcription PCR; Microarray
hsa-miR-19b-3p

lung cancerupregulation"Overexpression of miR-19 is strongly associated wi ......"26098000
hsa-miR-19b-3p

lymphomaupregulation"Using quantitative real-time reverse transcription ......"26231295Reverse transcription PCR; qPCR
hsa-miR-19b-3p

lymphomadownregulation"Previous studies reported that the aberrant expres ......"27572553
hsa-miR-19b-3p

prostate cancerupregulation"miR 19 miR 345 miR 519c 5p serum levels predict ad ......"24893170in situ hybridization



Reported cancer pathway affected by hsa-miR-19b-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-19b-3p

breast cancerApoptosis pathway"MiR 19b suppresses PTPRG to promote breast tumorig ......"27602768
hsa-miR-19b-3p

colon cancercell cycle pathway"Role of miR 19b and its target mRNAs in 5 fluorour ......"22382630RNA Immunoprecipitation; RNA immunoprecipitation
hsa-miR-19b-3p

colon cancerEpithelial mesenchymal transition pathway"miR-19 in the context of the miR-17~92 cluster at ......"24681249
hsa-miR-19b-3p

lung cancerEpithelial mesenchymal transition pathway; Apoptosis pathway"The miR-19 family miR-19a and miR-19b-1 are key on ......"26098000
hsa-miR-19b-3p

lymphomacell cycle pathway"Previous studies reported that the aberrant expres ......"27572553Luciferase
hsa-miR-19b-3p

sarcomacell cycle pathway; Apoptosis pathway"In our study we detected the six members of miR-17 ......"24824927Flow cytometry; Transwell assay



Reported cancer prognosis affected by hsa-miR-19b-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-19b-3p

B cell lymphomapoor survival"Furthermore we show that among the six miRNAs that ......"20008931
hsa-miR-19b-3p

breast cancerdrug resistance"Regulation of miR 19 to breast cancer chemoresista ......"21853360
hsa-miR-19b-3p

breast cancertumorigenesis; cell migration"MiR 19b suppresses PTPRG to promote breast tumorig ......"27602768
hsa-miR-19b-3p

breast cancerdrug resistance"Post transcriptional Regulation of BRCA2 through I ......"27630665Luciferase
hsa-miR-19b-3p

cervical and endocervical cancertumorigenesis"Up-regulation of miR-19a and miR-19b promoted cell ......"22561557
hsa-miR-19b-3p

colon cancerdrug resistance"Role of miR 19b and its target mRNAs in 5 fluorour ......"22382630RNA Immunoprecipitation; RNA immunoprecipitation
hsa-miR-19b-3p

colon cancermetastasis"miR-19 in the context of the miR-17~92 cluster at ......"24681249
hsa-miR-19b-3p

colorectal cancermetastasis; staging"miR 19 Mediated Inhibition of Transglutaminase 2 L ......"25934693
hsa-miR-19b-3p

esophageal cancerstaging; metastasis; tumor size"Using SYBR green real-time quantitative reverse tr ......"24360091
hsa-miR-19b-3p

gastric cancerdifferentiation"We found that the miR-17-92 cluster members miR-19 ......"23868977
hsa-miR-19b-3p

gastric cancermetastasis"Real-time quantitative PCR RTQ-PCR was employed to ......"25270964
hsa-miR-19b-3p

gastric cancerprogression; staging; differentiation"Circulating MiR 16 5p and MiR 19b 3p as Two Novel ......"25897338
hsa-miR-19b-3p

liver cancerpoor survival"Consequently we examined the expression pattern an ......"26453548
hsa-miR-19b-3p

lung cancermetastasis; worse prognosis; drug resistance"The miR-19 family miR-19a and miR-19b-1 are key on ......"26098000
hsa-miR-19b-3p

lung cancerprogression; drug resistance"Expression levels of miR-19b miR-126 miR-25 miR-20 ......"26986825
hsa-miR-19b-3p

lung cancerpoor survival"High levels of expression of miR-19 family members ......"27197183
hsa-miR-19b-3p

lung squamous cell cancerstaging; metastasis; poor survival; drug resistance"Serum levels of miR 19b and miR 146a as prognostic ......"24531034
hsa-miR-19b-3p

lymphomapoor survival"Using quantitative real-time reverse transcription ......"26231295
hsa-miR-19b-3p

lymphomaprogression; staging; metastasis; differentiation; tumor size; poor survival"Previous studies reported that the aberrant expres ......"27572553Luciferase
hsa-miR-19b-3p

prostate cancerstaging; progression"miR 19 miR 345 miR 519c 5p serum levels predict ad ......"24893170
hsa-miR-19b-3p

retinoblastomatumorigenesis"Using qRT-PCR we verified the expression level of ......"25520758
hsa-miR-19b-3p

sarcomadifferentiation"In order to investigate the involvement of miRNAs ......"23133552



Reported gene related to hsa-miR-19b-3p

miRNAcancergenereportingPUBMED
hsa-miR-19b-3p

breast cancerPTEN"Meanwhile BPA-induced upregulation of oncogenic mi ......"24831732
hsa-miR-19b-3p

breast cancerPTEN"Regulation of miR 19 to breast cancer chemoresista ......"21853360
hsa-miR-19b-3p

colon cancerPTEN"miR-19 in the context of the miR-17~92 cluster at ......"24681249
hsa-miR-19b-3p

lung cancerPTEN"Moreover siRNA-mediated knockdown of PTEN a target ......"26098000
hsa-miR-19b-3p

breast cancerAGO2"RT-PCR analysis using cDNA made from Ago2-immunopr ......"21059650
hsa-miR-19b-3p

colon cancerAGO2"After transfection of miR-19b specific mRNAs were ......"22382630
hsa-miR-19b-3p

colorectal cancerACAD8"Data analysis of miRNA from the training set showe ......"27135244
hsa-miR-19b-3p

acute myeloid leukemiaBARD1"We show that the HDACi histone deacetylase inhibit ......"24349422
hsa-miR-19b-3p

lymphomaBCL3"Notably miR-19b inversely regulated B-cell CLL/lym ......"27572553
hsa-miR-19b-3p

breast cancerBRCA2"Post transcriptional Regulation of BRCA2 through I ......"27630665
hsa-miR-19b-3p

gastric cancerCALM2"Among all nodes in the network focal adhesion/extr ......"27284247
hsa-miR-19b-3p

cervical and endocervical cancerCUL5"CUL5 was identified as a novel target gene of both ......"22561557
hsa-miR-19b-3p

gastric cancerMEF2D"Finally MEF2D is a direct target of miR-19 which w ......"26762410
hsa-miR-19b-3p

sarcomaMFN1"Further studies have found that Mfn1 was one of th ......"24824927
hsa-miR-19b-3p

lymphomaMYC"Statistical analysis showed that higher expression ......"26231295
hsa-miR-19b-3p

lung cancerNOVA2"Repeated Measures ANOVA demonstrated that miR-19b ......"26986825
hsa-miR-19b-3p

melanomaPITX1"miR 19b regulates hTERT mRNA expression through ta ......"25643913
hsa-miR-19b-3p

lung cancerPRB4"Repeated Measures ANOVA demonstrated that miR-19b ......"26986825
hsa-miR-19b-3p

breast cancerPTPRG"MiR 19b suppresses PTPRG to promote breast tumorig ......"27602768
hsa-miR-19b-3p

colorectal cancerTGM2"miR 19 Mediated Inhibition of Transglutaminase 2 L ......"25934693
hsa-miR-19b-3p

breast cancerTP53"Meanwhile BPA-induced upregulation of oncogenic mi ......"24831732



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-19b-3p
ACVR1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.274; TCGA BRCA -0.12; TCGA CESC -0.163; TCGA COAD -0.148; TCGA ESCA -0.117; TCGA HNSC -0.251; TCGA KIRC -0.101; TCGA KIRP -0.181; TCGA LIHC -0.07; TCGA LUAD -0.114; TCGA LUSC -0.183; TCGA PAAD -0.239; TCGA PRAD -0.214; TCGA SARC -0.188; TCGA STAD -0.142; TCGA UCEC -0.137
hsa-miR-19b-3p
ALAD
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.106; TCGA BRCA -0.161; TCGA CESC -0.095; TCGA ESCA -0.165; TCGA HNSC -0.107; TCGA KIRC -0.232; TCGA KIRP -0.2; TCGA LGG -0.166; TCGA LIHC -0.127; TCGA LUSC -0.076; TCGA PAAD -0.087; TCGA PRAD -0.14; TCGA SARC -0.116; TCGA THCA -0.062; TCGA STAD -0.151; TCGA UCEC -0.129
hsa-miR-19b-3p
AP3S2
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA
miRNAWalker2 validate
TCGA BLCA -0.057; TCGA BRCA -0.092; TCGA HNSC -0.081; TCGA KIRC -0.199; TCGA KIRP -0.095; TCGA LGG -0.074; TCGA LIHC -0.073; TCGA LUAD -0.059; TCGA LUSC -0.054; TCGA PAAD -0.131; TCGA SARC -0.06; TCGA THCA -0.059
hsa-miR-19b-3p
ARHGAP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.267; TCGA BRCA -0.112; TCGA CESC -0.067; TCGA COAD -0.145; TCGA ESCA -0.241; TCGA HNSC -0.178; TCGA LUSC -0.136; TCGA PRAD -0.094; TCGA SARC -0.219; TCGA STAD -0.198; TCGA UCEC -0.234
hsa-miR-19b-3p
ARRDC3
11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.217; TCGA COAD -0.131; TCGA ESCA -0.202; TCGA HNSC -0.328; TCGA KIRP -0.197; TCGA LUAD -0.131; TCGA LUSC -0.287; TCGA PRAD -0.279; TCGA SARC -0.092; TCGA STAD -0.247; TCGA UCEC -0.112
hsa-miR-19b-3p
ATF2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.159; TCGA BRCA -0.071; TCGA COAD -0.079; TCGA HNSC -0.362; TCGA KIRC -0.172; TCGA KIRP -0.468; TCGA LGG -0.173; TCGA LUAD -0.1; TCGA LUSC -0.053; TCGA PAAD -0.328; TCGA PRAD -0.36; TCGA THCA -0.147; TCGA STAD -0.093
hsa-miR-19b-3p
ATXN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA BLCA -0.478; TCGA BRCA -0.222; TCGA CESC -0.21; TCGA COAD -0.186; TCGA ESCA -0.144; TCGA HNSC -0.314; TCGA KIRP -0.194; TCGA LGG -0.109; TCGA LUAD -0.12; TCGA LUSC -0.156; TCGA PAAD -0.296; TCGA PRAD -0.257; TCGA STAD -0.353; TCGA UCEC -0.254
hsa-miR-19b-3p
ATXN7L1
9 cancers: BLCA; CESC; HNSC; KIRP; LGG; LIHC; PRAD; SARC; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.148; TCGA CESC -0.18; TCGA HNSC -0.165; TCGA KIRP -0.116; TCGA LGG -0.173; TCGA LIHC -0.252; TCGA PRAD -0.11; TCGA SARC -0.092; TCGA STAD -0.073
hsa-miR-19b-3p
BACE1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.226; TCGA BRCA -0.079; TCGA CESC -0.096; TCGA COAD -0.253; TCGA ESCA -0.254; TCGA HNSC -0.211; TCGA KIRP -0.255; TCGA LIHC -0.075; TCGA LUAD -0.213; TCGA LUSC -0.167; TCGA PAAD -0.326; TCGA PRAD -0.097; TCGA STAD -0.31; TCGA UCEC -0.097
hsa-miR-19b-3p
BMPR2
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.278; TCGA BRCA -0.135; TCGA CESC -0.151; TCGA COAD -0.153; TCGA ESCA -0.128; TCGA HNSC -0.323; TCGA KIRC -0.124; TCGA KIRP -0.29; TCGA LGG -0.1; TCGA LIHC -0.213; TCGA LUAD -0.187; TCGA LUSC -0.284; TCGA PAAD -0.325; TCGA PRAD -0.264; TCGA SARC -0.133; TCGA THCA -0.122; TCGA STAD -0.199; TCGA UCEC -0.214
hsa-miR-19b-3p
CEP350
9 cancers: BLCA; CESC; HNSC; KIRP; LGG; PAAD; PRAD; SARC; THCA
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.063; TCGA CESC -0.074; TCGA HNSC -0.178; TCGA KIRP -0.179; TCGA LGG -0.141; TCGA PAAD -0.182; TCGA PRAD -0.201; TCGA SARC -0.067; TCGA THCA -0.057
hsa-miR-19b-3p
CLIP1
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.259; TCGA CESC -0.148; TCGA COAD -0.173; TCGA ESCA -0.175; TCGA HNSC -0.209; TCGA KIRC -0.134; TCGA KIRP -0.239; TCGA LGG -0.207; TCGA LUSC -0.085; TCGA PAAD -0.21; TCGA PRAD -0.172; TCGA SARC -0.274; TCGA THCA -0.169; TCGA STAD -0.254; TCGA UCEC -0.217
hsa-miR-19b-3p
CPPED1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.28; TCGA BRCA -0.195; TCGA CESC -0.204; TCGA HNSC -0.185; TCGA KIRC -0.137; TCGA KIRP -0.134; TCGA LIHC -0.117; TCGA LUAD -0.163; TCGA LUSC -0.19; TCGA PAAD -0.194; TCGA PRAD -0.204; TCGA THCA -0.104; TCGA STAD -0.096
hsa-miR-19b-3p
CREB3L2
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.24; TCGA COAD -0.168; TCGA ESCA -0.122; TCGA HNSC -0.354; TCGA KIRC -0.147; TCGA KIRP -0.222; TCGA LUSC -0.247; TCGA PAAD -0.308; TCGA PRAD -0.137; TCGA THCA -0.132; TCGA STAD -0.223; TCGA UCEC -0.242
hsa-miR-19b-3p
CREBL2
16 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.132; TCGA BRCA -0.12; TCGA CESC -0.081; TCGA HNSC -0.171; TCGA KIRC -0.141; TCGA KIRP -0.157; TCGA LGG -0.074; TCGA LIHC -0.229; TCGA LUAD -0.16; TCGA LUSC -0.167; TCGA PAAD -0.206; TCGA PRAD -0.065; TCGA SARC -0.078; TCGA THCA -0.097; TCGA STAD -0.176; TCGA UCEC -0.19
hsa-miR-19b-3p
CYP2U1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.275; TCGA BRCA -0.113; TCGA CESC -0.158; TCGA COAD -0.276; TCGA ESCA -0.29; TCGA HNSC -0.383; TCGA KIRC -0.218; TCGA KIRP -0.245; TCGA LGG -0.206; TCGA LIHC -0.298; TCGA LUAD -0.275; TCGA LUSC -0.257; TCGA PAAD -0.403; TCGA SARC -0.229; TCGA THCA -0.173; TCGA STAD -0.501; TCGA UCEC -0.199
hsa-miR-19b-3p
DAAM2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.603; TCGA BRCA -0.131; TCGA CESC -0.231; TCGA COAD -0.591; TCGA ESCA -0.793; TCGA HNSC -0.649; TCGA KIRP -0.393; TCGA LGG -0.456; TCGA LIHC -0.245; TCGA LUSC -0.612; TCGA PAAD -0.494; TCGA PRAD -0.58; TCGA THCA -0.218; TCGA STAD -0.868; TCGA UCEC -0.247
hsa-miR-19b-3p
DEGS1
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.184; TCGA COAD -0.242; TCGA ESCA -0.134; TCGA LGG -0.07; TCGA LUAD -0.088; TCGA PAAD -0.168; TCGA SARC -0.193; TCGA STAD -0.172; TCGA UCEC -0.104
hsa-miR-19b-3p
DNAJA2
9 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; THCA; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.056; TCGA KIRC -0.08; TCGA KIRP -0.053; TCGA LGG -0.053; TCGA LIHC -0.164; TCGA LUAD -0.08; TCGA PAAD -0.077; TCGA THCA -0.089; TCGA UCEC -0.056
hsa-miR-19b-3p
DYNLL2
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.081; TCGA BRCA -0.057; TCGA HNSC -0.109; TCGA KIRC -0.315; TCGA KIRP -0.294; TCGA LIHC -0.152; TCGA PAAD -0.115; TCGA PRAD -0.109; TCGA SARC -0.106; TCGA THCA -0.2; TCGA STAD -0.086
hsa-miR-19b-3p
ENPP5
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.317; TCGA BRCA -0.376; TCGA HNSC -0.383; TCGA KIRC -0.523; TCGA KIRP -0.332; TCGA LGG -0.571; TCGA LUSC -0.311; TCGA PAAD -0.369; TCGA PRAD -0.262; TCGA THCA -0.174; TCGA STAD -0.292
hsa-miR-19b-3p
ESR1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA BLCA -0.586; TCGA BRCA -0.956; TCGA CESC -0.601; TCGA COAD -0.859; TCGA ESCA -0.393; TCGA HNSC -0.324; TCGA KIRC -0.307; TCGA KIRP -0.399; TCGA LGG -0.167; TCGA LIHC -0.879; TCGA LUAD -0.242; TCGA LUSC -0.475; TCGA PAAD -0.464; TCGA PRAD -0.361; TCGA SARC -0.39; TCGA STAD -0.578
hsa-miR-19b-3p
FAT3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRNAWalker2 validate; mirMAP; miRNATAP
TCGA BLCA -0.551; TCGA BRCA -0.487; TCGA CESC -0.464; TCGA COAD -0.587; TCGA ESCA -0.677; TCGA HNSC -0.41; TCGA KIRP -0.406; TCGA LGG -0.453; TCGA LUAD -0.224; TCGA LUSC -0.289; TCGA PAAD -0.427; TCGA PRAD -0.802; TCGA SARC -0.608; TCGA STAD -1.255
hsa-miR-19b-3p
FBXO8
17 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.096; TCGA CESC -0.074; TCGA ESCA -0.141; TCGA HNSC -0.07; TCGA KIRC -0.157; TCGA KIRP -0.175; TCGA LGG -0.109; TCGA LIHC -0.118; TCGA LUAD -0.134; TCGA LUSC -0.133; TCGA PAAD -0.177; TCGA PRAD -0.078; TCGA SARC -0.159; TCGA THCA -0.065; TCGA STAD -0.169; TCGA UCEC -0.257
hsa-miR-19b-3p
FYCO1
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.437; TCGA BRCA -0.279; TCGA CESC -0.211; TCGA COAD -0.171; TCGA ESCA -0.384; TCGA HNSC -0.431; TCGA KIRC -0.313; TCGA KIRP -0.232; TCGA LGG -0.08; TCGA LIHC -0.196; TCGA LUAD -0.148; TCGA LUSC -0.274; TCGA PAAD -0.201; TCGA PRAD -0.296; TCGA SARC -0.403; TCGA THCA -0.143; TCGA STAD -0.488; TCGA UCEC -0.409
hsa-miR-19b-3p
GFOD1
12 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA BLCA -0.289; TCGA ESCA -0.287; TCGA HNSC -0.132; TCGA KIRP -0.286; TCGA LGG -0.165; TCGA LIHC -0.103; TCGA LUAD -0.192; TCGA LUSC -0.147; TCGA PRAD -0.28; TCGA SARC -0.311; TCGA THCA -0.179; TCGA STAD -0.518
hsa-miR-19b-3p
HBP1
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.089; TCGA BRCA -0.081; TCGA CESC -0.08; TCGA ESCA -0.084; TCGA HNSC -0.154; TCGA KIRC -0.113; TCGA KIRP -0.135; TCGA LIHC -0.118; TCGA LUAD -0.124; TCGA LUSC -0.106; TCGA PAAD -0.12; TCGA PRAD -0.096; TCGA SARC -0.129; TCGA STAD -0.119; TCGA UCEC -0.151
hsa-miR-19b-3p
HEG1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; mirMAP; miRNATAP
TCGA BLCA -0.443; TCGA BRCA -0.263; TCGA CESC -0.345; TCGA COAD -0.596; TCGA ESCA -0.368; TCGA HNSC -0.497; TCGA KIRP -0.415; TCGA LGG -0.222; TCGA LIHC -0.12; TCGA LUAD -0.301; TCGA LUSC -0.451; TCGA PAAD -0.471; TCGA PRAD -0.363; TCGA SARC -0.116; TCGA THCA -0.166; TCGA STAD -0.413; TCGA UCEC -0.326
hsa-miR-19b-3p
HIPK1
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.16; TCGA BRCA -0.082; TCGA COAD -0.09; TCGA ESCA -0.122; TCGA HNSC -0.263; TCGA KIRC -0.101; TCGA KIRP -0.33; TCGA LGG -0.109; TCGA LIHC -0.068; TCGA LUAD -0.133; TCGA LUSC -0.167; TCGA PAAD -0.253; TCGA PRAD -0.22; TCGA SARC -0.098; TCGA THCA -0.085; TCGA STAD -0.097; TCGA UCEC -0.109
hsa-miR-19b-3p
HIPK3
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.457; TCGA BRCA -0.194; TCGA COAD -0.241; TCGA ESCA -0.253; TCGA HNSC -0.689; TCGA KIRC -0.358; TCGA KIRP -0.914; TCGA LGG -0.308; TCGA LIHC -0.256; TCGA LUAD -0.258; TCGA LUSC -0.231; TCGA PAAD -0.557; TCGA PRAD -0.652; TCGA SARC -0.343; TCGA THCA -0.243; TCGA STAD -0.343; TCGA UCEC -0.311
hsa-miR-19b-3p
KAT2B
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.163; TCGA BRCA -0.124; TCGA CESC -0.2; TCGA COAD -0.327; TCGA ESCA -0.277; TCGA HNSC -0.284; TCGA KIRC -0.182; TCGA KIRP -0.289; TCGA LGG -0.11; TCGA LIHC -0.301; TCGA LUAD -0.238; TCGA LUSC -0.276; TCGA PAAD -0.147; TCGA PRAD -0.174; TCGA SARC -0.344; TCGA THCA -0.17; TCGA STAD -0.384; TCGA UCEC -0.239
hsa-miR-19b-3p
KATNAL1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.332; TCGA CESC -0.136; TCGA COAD -0.262; TCGA ESCA -0.192; TCGA HNSC -0.201; TCGA KIRP -0.102; TCGA LGG -0.067; TCGA LIHC -0.211; TCGA LUSC -0.126; TCGA PAAD -0.3; TCGA PRAD -0.332; TCGA THCA -0.058; TCGA STAD -0.448; TCGA UCEC -0.334
hsa-miR-19b-3p
KCTD10
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.197; TCGA CESC -0.06; TCGA COAD -0.105; TCGA ESCA -0.24; TCGA HNSC -0.095; TCGA KIRC -0.085; TCGA KIRP -0.119; TCGA LUAD -0.107; TCGA LUSC -0.145; TCGA PAAD -0.158; TCGA PRAD -0.17; TCGA SARC -0.119; TCGA THCA -0.1; TCGA STAD -0.3; TCGA UCEC -0.169
hsa-miR-19b-3p
KCTD20
11 cancers: BLCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.184; TCGA HNSC -0.289; TCGA KIRP -0.343; TCGA LGG -0.077; TCGA LUAD -0.066; TCGA LUSC -0.106; TCGA PAAD -0.369; TCGA PRAD -0.199; TCGA THCA -0.146; TCGA STAD -0.177; TCGA UCEC -0.139
hsa-miR-19b-3p
KLF10
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.196; TCGA BRCA -0.093; TCGA ESCA -0.175; TCGA HNSC -0.202; TCGA KIRP -0.164; TCGA LUAD -0.153; TCGA LUSC -0.269; TCGA PAAD -0.243; TCGA PRAD -0.298; TCGA STAD -0.367; TCGA UCEC -0.204
hsa-miR-19b-3p
LDLR
10 cancers: BLCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
miRNAWalker2 validate
TCGA BLCA -0.283; TCGA COAD -0.118; TCGA HNSC -0.117; TCGA KIRP -0.381; TCGA LIHC -0.208; TCGA LUAD -0.168; TCGA LUSC -0.194; TCGA PRAD -0.206; TCGA SARC -0.294; TCGA UCEC -0.139
hsa-miR-19b-3p
MBNL1
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.247; TCGA CESC -0.102; TCGA COAD -0.137; TCGA ESCA -0.106; TCGA HNSC -0.13; TCGA KIRP -0.095; TCGA LGG -0.084; TCGA LIHC -0.075; TCGA LUAD -0.148; TCGA LUSC -0.053; TCGA PAAD -0.183; TCGA PRAD -0.195; TCGA SARC -0.3; TCGA STAD -0.258; TCGA UCEC -0.238
hsa-miR-19b-3p
MEF2D
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; mirMAP
TCGA BLCA -0.217; TCGA BRCA -0.125; TCGA COAD -0.143; TCGA ESCA -0.15; TCGA HNSC -0.188; TCGA KIRP -0.156; TCGA LUSC -0.124; TCGA PRAD -0.088; TCGA SARC -0.16; TCGA THCA -0.056; TCGA STAD -0.239; TCGA UCEC -0.271
hsa-miR-19b-3p
MOSPD2
11 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.077; TCGA BRCA -0.06; TCGA HNSC -0.189; TCGA KIRP -0.422; TCGA LGG -0.137; TCGA LUAD -0.169; TCGA LUSC -0.101; TCGA PAAD -0.252; TCGA PRAD -0.236; TCGA THCA -0.154; TCGA UCEC -0.164
hsa-miR-19b-3p
MYLIP
10 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget
TCGA BLCA -0.135; TCGA BRCA -0.185; TCGA HNSC -0.172; TCGA KIRP -0.195; TCGA LIHC -0.11; TCGA PAAD -0.143; TCGA PRAD -0.083; TCGA SARC -0.177; TCGA STAD -0.18; TCGA UCEC -0.245
hsa-miR-19b-3p
NACC2
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.309; TCGA BRCA -0.121; TCGA COAD -0.185; TCGA ESCA -0.391; TCGA HNSC -0.166; TCGA KIRC -0.242; TCGA KIRP -0.465; TCGA LGG -0.326; TCGA LUSC -0.144; TCGA PRAD -0.397; TCGA SARC -0.351; TCGA THCA -0.218; TCGA STAD -0.448; TCGA UCEC -0.253
hsa-miR-19b-3p
NCKAP5
9 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.235; TCGA BRCA -0.158; TCGA HNSC -0.207; TCGA KIRC -0.374; TCGA LIHC -0.298; TCGA LUAD -0.359; TCGA LUSC -0.439; TCGA PAAD -0.324; TCGA THCA -0.158
hsa-miR-19b-3p
NFIB
9 cancers: BLCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.202; TCGA HNSC -0.144; TCGA LIHC -0.233; TCGA LUAD -0.091; TCGA PAAD -0.256; TCGA PRAD -0.072; TCGA SARC -0.278; TCGA THCA -0.076; TCGA STAD -0.23
hsa-miR-19b-3p
NR3C1
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.305; TCGA BRCA -0.136; TCGA COAD -0.618; TCGA ESCA -0.292; TCGA HNSC -0.216; TCGA KIRP -0.133; TCGA LGG -0.101; TCGA LIHC -0.147; TCGA LUAD -0.198; TCGA LUSC -0.154; TCGA PAAD -0.365; TCGA PRAD -0.442; TCGA SARC -0.149; TCGA THCA -0.075; TCGA STAD -0.406; TCGA UCEC -0.31
hsa-miR-19b-3p
NR3C2
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.664; TCGA BRCA -0.109; TCGA CESC -0.539; TCGA HNSC -0.458; TCGA KIRC -0.652; TCGA KIRP -0.384; TCGA LGG -0.441; TCGA LIHC -0.25; TCGA LUAD -0.184; TCGA LUSC -0.356; TCGA PAAD -0.307; TCGA PRAD -0.262; TCGA SARC -0.391; TCGA STAD -0.419; TCGA UCEC -0.423
hsa-miR-19b-3p
OTUD1
9 cancers: BLCA; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.18; TCGA COAD -0.08; TCGA KIRC -0.15; TCGA KIRP -0.196; TCGA LUAD -0.176; TCGA LUSC -0.209; TCGA PRAD -0.072; TCGA STAD -0.119; TCGA UCEC -0.191
hsa-miR-19b-3p
PALLD
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.753; TCGA BRCA -0.18; TCGA CESC -0.262; TCGA COAD -0.638; TCGA ESCA -0.522; TCGA HNSC -0.272; TCGA KIRP -0.161; TCGA LGG -0.102; TCGA LIHC -0.247; TCGA LUAD -0.268; TCGA LUSC -0.187; TCGA PAAD -0.455; TCGA PRAD -0.444; TCGA SARC -0.407; TCGA STAD -0.713; TCGA UCEC -0.394
hsa-miR-19b-3p
PDE4D
15 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.438; TCGA COAD -0.402; TCGA ESCA -0.246; TCGA HNSC -0.254; TCGA KIRC -0.196; TCGA KIRP -0.167; TCGA LGG -0.156; TCGA LIHC -0.157; TCGA LUSC -0.246; TCGA PAAD -0.234; TCGA PRAD -0.284; TCGA SARC -0.523; TCGA THCA -0.14; TCGA STAD -0.361; TCGA UCEC -0.39
hsa-miR-19b-3p
PRKACB
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.267; TCGA BRCA -0.135; TCGA CESC -0.191; TCGA COAD -0.188; TCGA HNSC -0.336; TCGA KIRC -0.151; TCGA KIRP -0.212; TCGA LGG -0.139; TCGA LIHC -0.116; TCGA LUAD -0.197; TCGA LUSC -0.166; TCGA PAAD -0.317; TCGA PRAD -0.136; TCGA SARC -0.124; TCGA STAD -0.347; TCGA UCEC -0.206
hsa-miR-19b-3p
PRUNE2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -1.267; TCGA BRCA -0.136; TCGA COAD -0.335; TCGA ESCA -1.171; TCGA HNSC -0.791; TCGA LGG -0.32; TCGA LUSC -0.497; TCGA PAAD -0.507; TCGA PRAD -0.557; TCGA SARC -0.962; TCGA THCA -0.224; TCGA STAD -1.281; TCGA UCEC -0.629
hsa-miR-19b-3p
PSAP
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.14; TCGA BRCA -0.064; TCGA COAD -0.189; TCGA ESCA -0.099; TCGA HNSC -0.164; TCGA KIRP -0.157; TCGA LGG -0.062; TCGA LUAD -0.128; TCGA LUSC -0.265; TCGA PAAD -0.127; TCGA THCA -0.062; TCGA STAD -0.114; TCGA UCEC -0.085
hsa-miR-19b-3p
PTEN
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.108; TCGA ESCA -0.084; TCGA HNSC -0.142; TCGA KIRP -0.158; TCGA LIHC -0.066; TCGA LUAD -0.144; TCGA LUSC -0.225; TCGA PAAD -0.168; TCGA PRAD -0.074; TCGA THCA -0.061; TCGA STAD -0.132; TCGA UCEC -0.196
hsa-miR-19b-3p
PTPRG
14 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.348; TCGA BRCA -0.307; TCGA COAD -0.127; TCGA HNSC -0.49; TCGA KIRC -0.281; TCGA KIRP -0.55; TCGA LGG -0.212; TCGA LIHC -0.216; TCGA LUAD -0.294; TCGA LUSC -0.275; TCGA PAAD -0.448; TCGA PRAD -0.438; TCGA THCA -0.271; TCGA STAD -0.104
hsa-miR-19b-3p
RAB21
15 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.079; TCGA HNSC -0.077; TCGA KIRC -0.106; TCGA KIRP -0.102; TCGA LGG -0.076; TCGA LIHC -0.087; TCGA LUAD -0.105; TCGA LUSC -0.07; TCGA PAAD -0.101; TCGA PRAD -0.096; TCGA SARC -0.086; TCGA THCA -0.074; TCGA STAD -0.062; TCGA UCEC -0.101
hsa-miR-19b-3p
RAB5B
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.092; TCGA CESC -0.067; TCGA ESCA -0.076; TCGA HNSC -0.092; TCGA KIRC -0.094; TCGA KIRP -0.061; TCGA LGG -0.088; TCGA LIHC -0.056; TCGA LUAD -0.054; TCGA PAAD -0.054; TCGA SARC -0.088; TCGA STAD -0.137; TCGA UCEC -0.062
hsa-miR-19b-3p
RASSF2
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.236; TCGA CESC -0.26; TCGA COAD -0.606; TCGA ESCA -0.231; TCGA HNSC -0.362; TCGA LGG -0.128; TCGA LIHC -0.122; TCGA LUAD -0.226; TCGA LUSC -0.44; TCGA PAAD -0.359; TCGA PRAD -0.208; TCGA SARC -0.189; TCGA STAD -0.383; TCGA UCEC -0.354
hsa-miR-19b-3p
RNF11
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.191; TCGA BRCA -0.107; TCGA CESC -0.153; TCGA COAD -0.189; TCGA ESCA -0.168; TCGA HNSC -0.14; TCGA KIRC -0.113; TCGA KIRP -0.253; TCGA LIHC -0.266; TCGA LUAD -0.171; TCGA LUSC -0.181; TCGA PAAD -0.256; TCGA PRAD -0.16; TCGA SARC -0.104; TCGA THCA -0.091; TCGA STAD -0.221; TCGA UCEC -0.24
hsa-miR-19b-3p
RNF111
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.091; TCGA BRCA -0.11; TCGA CESC -0.094; TCGA COAD -0.115; TCGA HNSC -0.214; TCGA KIRC -0.121; TCGA KIRP -0.277; TCGA LIHC -0.085; TCGA LUAD -0.116; TCGA LUSC -0.071; TCGA PAAD -0.189; TCGA PRAD -0.245; TCGA SARC -0.071; TCGA THCA -0.068; TCGA UCEC -0.09
hsa-miR-19b-3p
ROR1
16 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.857; TCGA CESC -0.374; TCGA COAD -0.9; TCGA ESCA -0.469; TCGA HNSC -0.914; TCGA KIRC -0.351; TCGA KIRP -0.861; TCGA LGG -0.232; TCGA LIHC -0.388; TCGA LUAD -0.442; TCGA LUSC -0.728; TCGA PAAD -0.69; TCGA PRAD -0.713; TCGA SARC -0.332; TCGA STAD -0.533; TCGA UCEC -0.27
hsa-miR-19b-3p
SAMD8
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.189; TCGA BRCA -0.144; TCGA COAD -0.14; TCGA ESCA -0.173; TCGA HNSC -0.245; TCGA KIRC -0.182; TCGA KIRP -0.4; TCGA LGG -0.245; TCGA LIHC -0.196; TCGA LUAD -0.149; TCGA LUSC -0.078; TCGA PAAD -0.318; TCGA PRAD -0.347; TCGA THCA -0.133; TCGA STAD -0.146; TCGA UCEC -0.094
hsa-miR-19b-3p
SECISBP2L
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.24; TCGA BRCA -0.103; TCGA CESC -0.135; TCGA COAD -0.18; TCGA ESCA -0.16; TCGA HNSC -0.345; TCGA KIRC -0.299; TCGA KIRP -0.298; TCGA LGG -0.103; TCGA LIHC -0.161; TCGA LUAD -0.137; TCGA LUSC -0.277; TCGA PAAD -0.285; TCGA PRAD -0.199; TCGA SARC -0.142; TCGA STAD -0.222; TCGA UCEC -0.238
hsa-miR-19b-3p
SEMA6B
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.187; TCGA BRCA -0.308; TCGA COAD -0.446; TCGA ESCA -0.3; TCGA HNSC -0.225; TCGA LUSC -0.384; TCGA THCA -0.144; TCGA STAD -0.188; TCGA UCEC -0.333
hsa-miR-19b-3p
SERINC3
17 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.09; TCGA BRCA -0.095; TCGA CESC -0.076; TCGA ESCA -0.093; TCGA HNSC -0.209; TCGA KIRC -0.091; TCGA KIRP -0.266; TCGA LGG -0.158; TCGA LIHC -0.11; TCGA LUAD -0.158; TCGA LUSC -0.138; TCGA PAAD -0.197; TCGA PRAD -0.198; TCGA SARC -0.095; TCGA THCA -0.145; TCGA STAD -0.055; TCGA UCEC -0.121
hsa-miR-19b-3p
SESTD1
13 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.252; TCGA CESC -0.132; TCGA COAD -0.12; TCGA HNSC -0.251; TCGA KIRC -0.164; TCGA KIRP -0.215; TCGA LGG -0.059; TCGA LUSC -0.114; TCGA PAAD -0.191; TCGA PRAD -0.225; TCGA SARC -0.234; TCGA STAD -0.187; TCGA UCEC -0.114
hsa-miR-19b-3p
SGTB
13 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.183; TCGA COAD -0.21; TCGA HNSC -0.142; TCGA KIRP -0.215; TCGA LGG -0.211; TCGA LUAD -0.167; TCGA LUSC -0.16; TCGA PAAD -0.286; TCGA PRAD -0.207; TCGA SARC -0.108; TCGA THCA -0.088; TCGA STAD -0.213; TCGA UCEC -0.129
hsa-miR-19b-3p
SLC35D1
10 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.079; TCGA BRCA -0.115; TCGA HNSC -0.155; TCGA KIRP -0.248; TCGA LIHC -0.113; TCGA LUAD -0.078; TCGA PAAD -0.125; TCGA PRAD -0.19; TCGA THCA -0.113; TCGA UCEC -0.115
hsa-miR-19b-3p
SLMAP
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.43; TCGA BRCA -0.085; TCGA CESC -0.119; TCGA COAD -0.166; TCGA ESCA -0.236; TCGA HNSC -0.124; TCGA KIRC -0.183; TCGA KIRP -0.222; TCGA LGG -0.069; TCGA LUAD -0.071; TCGA LUSC -0.072; TCGA PAAD -0.157; TCGA PRAD -0.303; TCGA SARC -0.622; TCGA THCA -0.128; TCGA STAD -0.433; TCGA UCEC -0.376
hsa-miR-19b-3p
SMARCA2
14 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.217; TCGA ESCA -0.153; TCGA HNSC -0.231; TCGA KIRC -0.195; TCGA KIRP -0.28; TCGA LGG -0.199; TCGA LIHC -0.307; TCGA LUAD -0.124; TCGA PAAD -0.174; TCGA PRAD -0.196; TCGA SARC -0.138; TCGA THCA -0.095; TCGA STAD -0.202; TCGA UCEC -0.293
hsa-miR-19b-3p
SON
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA
miRNAWalker2 validate
TCGA BLCA -0.122; TCGA BRCA -0.059; TCGA CESC -0.091; TCGA HNSC -0.228; TCGA KIRC -0.093; TCGA KIRP -0.251; TCGA LGG -0.09; TCGA LUSC -0.054; TCGA PAAD -0.158; TCGA PRAD -0.168; TCGA SARC -0.064; TCGA THCA -0.065
hsa-miR-19b-3p
SPG20
11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.251; TCGA COAD -0.623; TCGA ESCA -0.277; TCGA HNSC -0.146; TCGA KIRP -0.166; TCGA LIHC -0.267; TCGA LUAD -0.068; TCGA PAAD -0.271; TCGA PRAD -0.321; TCGA STAD -0.576; TCGA UCEC -0.129
hsa-miR-19b-3p
STEAP2
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; PAAD; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.192; TCGA BRCA -0.318; TCGA CESC -0.317; TCGA COAD -0.224; TCGA HNSC -0.212; TCGA KIRC -0.377; TCGA LGG -0.436; TCGA PAAD -0.174; TCGA STAD -0.178
hsa-miR-19b-3p
SYBU
9 cancers: BLCA; BRCA; LGG; LIHC; LUSC; PAAD; SARC; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.298; TCGA BRCA -0.377; TCGA LGG -0.336; TCGA LIHC -0.379; TCGA LUSC -0.205; TCGA PAAD -0.258; TCGA SARC -0.558; TCGA THCA -0.174; TCGA STAD -0.16
hsa-miR-19b-3p
TCF4
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate; mirMAP
TCGA BLCA -0.459; TCGA BRCA -0.292; TCGA CESC -0.394; TCGA COAD -0.533; TCGA HNSC -0.384; TCGA KIRP -0.273; TCGA LIHC -0.172; TCGA LUAD -0.249; TCGA LUSC -0.206; TCGA PAAD -0.441; TCGA PRAD -0.31; TCGA THCA -0.134; TCGA STAD -0.344; TCGA UCEC -0.254
hsa-miR-19b-3p
TES
9 cancers: BLCA; CESC; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.217; TCGA CESC -0.116; TCGA HNSC -0.153; TCGA LUAD -0.093; TCGA LUSC -0.072; TCGA PRAD -0.273; TCGA SARC -0.414; TCGA STAD -0.187; TCGA UCEC -0.178
hsa-miR-19b-3p
TGFBR2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.352; TCGA BRCA -0.235; TCGA CESC -0.235; TCGA COAD -0.17; TCGA ESCA -0.245; TCGA HNSC -0.466; TCGA KIRC -0.149; TCGA KIRP -0.384; TCGA LIHC -0.161; TCGA LUAD -0.328; TCGA LUSC -0.593; TCGA PAAD -0.253; TCGA PRAD -0.37; TCGA SARC -0.169; TCGA THCA -0.183; TCGA STAD -0.303; TCGA UCEC -0.448
hsa-miR-19b-3p
TMEM45A
9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.347; TCGA COAD -0.791; TCGA ESCA -0.315; TCGA LIHC -0.265; TCGA LUAD -0.223; TCGA LUSC -0.291; TCGA PAAD -0.445; TCGA PRAD -0.252; TCGA STAD -0.236
hsa-miR-19b-3p
TNRC6B
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.097; TCGA ESCA -0.09; TCGA HNSC -0.245; TCGA KIRC -0.101; TCGA KIRP -0.136; TCGA LGG -0.081; TCGA PAAD -0.138; TCGA PRAD -0.164; TCGA SARC -0.108; TCGA STAD -0.076; TCGA UCEC -0.063
hsa-miR-19b-3p
TOM1L2
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.194; TCGA ESCA -0.32; TCGA HNSC -0.122; TCGA KIRC -0.214; TCGA LGG -0.151; TCGA LUSC -0.147; TCGA SARC -0.225; TCGA STAD -0.28; TCGA UCEC -0.297
hsa-miR-19b-3p
TRIM2
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
miRNAWalker2 validate
TCGA BLCA -0.303; TCGA CESC -0.295; TCGA HNSC -0.34; TCGA KIRC -0.554; TCGA KIRP -0.35; TCGA LGG -0.21; TCGA LIHC -0.344; TCGA LUAD -0.104; TCGA PAAD -0.215; TCGA PRAD -0.431; TCGA THCA -0.142
hsa-miR-19b-3p
TSC22D3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.396; TCGA BRCA -0.295; TCGA CESC -0.38; TCGA COAD -0.452; TCGA ESCA -0.319; TCGA LIHC -0.252; TCGA LUAD -0.202; TCGA LUSC -0.328; TCGA PRAD -0.093; TCGA STAD -0.56; TCGA UCEC -0.181
hsa-miR-19b-3p
VAMP3
11 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.068; TCGA BRCA -0.08; TCGA ESCA -0.092; TCGA KIRP -0.086; TCGA LIHC -0.136; TCGA LUAD -0.146; TCGA LUSC -0.173; TCGA PAAD -0.144; TCGA PRAD -0.131; TCGA STAD -0.055; TCGA UCEC -0.167
hsa-miR-19b-3p
WDR26
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; PRAD; THCA; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.088; TCGA BRCA -0.072; TCGA CESC -0.061; TCGA COAD -0.052; TCGA HNSC -0.1; TCGA KIRP -0.11; TCGA PRAD -0.094; TCGA THCA -0.052; TCGA STAD -0.084
hsa-miR-19b-3p
ZBTB4
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.254; TCGA BRCA -0.166; TCGA CESC -0.147; TCGA COAD -0.233; TCGA ESCA -0.347; TCGA HNSC -0.236; TCGA KIRC -0.181; TCGA KIRP -0.133; TCGA LGG -0.106; TCGA LIHC -0.174; TCGA LUAD -0.085; TCGA LUSC -0.234; TCGA PAAD -0.099; TCGA PRAD -0.16; TCGA SARC -0.196; TCGA STAD -0.448; TCGA UCEC -0.357
hsa-miR-19b-3p
ZFAND5
10 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.051; TCGA CESC -0.082; TCGA ESCA -0.101; TCGA HNSC -0.058; TCGA LGG -0.108; TCGA LIHC -0.185; TCGA PAAD -0.089; TCGA PRAD -0.176; TCGA STAD -0.169; TCGA UCEC -0.098
hsa-miR-19b-3p
ZFHX4
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; STAD
miRNAWalker2 validate
TCGA BLCA -0.655; TCGA BRCA -0.373; TCGA CESC -0.569; TCGA COAD -1.099; TCGA ESCA -0.392; TCGA HNSC -0.492; TCGA LGG -0.202; TCGA PAAD -0.705; TCGA PRAD -0.277; TCGA STAD -0.758
hsa-miR-19b-3p
ZNF521
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.719; TCGA CESC -0.434; TCGA COAD -0.699; TCGA ESCA -0.309; TCGA HNSC -0.586; TCGA KIRP -0.502; TCGA LGG -0.264; TCGA LIHC -0.243; TCGA LUAD -0.288; TCGA LUSC -0.516; TCGA PAAD -0.522; TCGA PRAD -0.367; TCGA STAD -0.474; TCGA UCEC -0.376
hsa-miR-19b-3p
PPP2R5E
13 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRTarBase; MirTarget
TCGA BLCA -0.075; TCGA COAD -0.098; TCGA HNSC -0.14; TCGA KIRC -0.156; TCGA KIRP -0.316; TCGA LGG -0.084; TCGA LIHC -0.106; TCGA LUAD -0.064; TCGA PAAD -0.218; TCGA PRAD -0.197; TCGA SARC -0.081; TCGA THCA -0.134; TCGA STAD -0.063
hsa-miR-19b-3p
CD84
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.375; TCGA BRCA -0.194; TCGA CESC -0.278; TCGA COAD -0.803; TCGA HNSC -0.781; TCGA KIRP -0.491; TCGA LGG -0.374; TCGA LIHC -0.216; TCGA LUAD -0.331; TCGA LUSC -0.604; TCGA PAAD -0.632; TCGA PRAD -0.427; TCGA THCA -0.204; TCGA STAD -0.139
hsa-miR-19b-3p
COL1A2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.616; TCGA BRCA -0.455; TCGA CESC -0.418; TCGA COAD -0.681; TCGA ESCA -0.311; TCGA HNSC -0.592; TCGA KIRP -0.322; TCGA LIHC -0.171; TCGA LUAD -0.149; TCGA LUSC -0.525; TCGA PAAD -0.498; TCGA PRAD -0.18; TCGA STAD -0.158; TCGA UCEC -0.263
hsa-miR-19b-3p
SULF1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.65; TCGA BRCA -0.228; TCGA CESC -0.429; TCGA COAD -0.851; TCGA ESCA -0.32; TCGA HNSC -0.557; TCGA KIRP -0.416; TCGA LUAD -0.162; TCGA LUSC -0.278; TCGA PAAD -0.594; TCGA PRAD -0.365; TCGA SARC -0.445; TCGA STAD -0.239
hsa-miR-19b-3p
CDC42BPA
13 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.34; TCGA COAD -0.126; TCGA HNSC -0.26; TCGA KIRC -0.188; TCGA KIRP -0.2; TCGA LGG -0.058; TCGA LIHC -0.187; TCGA PAAD -0.161; TCGA PRAD -0.17; TCGA SARC -0.117; TCGA THCA -0.152; TCGA STAD -0.18; TCGA UCEC -0.22
hsa-miR-19b-3p
BNC2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.884; TCGA BRCA -0.44; TCGA CESC -0.576; TCGA COAD -0.919; TCGA ESCA -0.741; TCGA HNSC -0.685; TCGA LGG -0.26; TCGA LIHC -0.303; TCGA LUAD -0.273; TCGA LUSC -0.43; TCGA PAAD -0.687; TCGA PRAD -0.498; TCGA STAD -0.833; TCGA UCEC -0.755
hsa-miR-19b-3p
NBEA
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.681; TCGA BRCA -0.387; TCGA CESC -0.624; TCGA COAD -0.869; TCGA ESCA -0.522; TCGA HNSC -0.573; TCGA KIRC -0.32; TCGA KIRP -0.361; TCGA LGG -0.142; TCGA LUSC -0.17; TCGA PAAD -0.486; TCGA PRAD -0.34; TCGA SARC -0.314; TCGA THCA -0.183; TCGA STAD -1.047; TCGA UCEC -0.485
hsa-miR-19b-3p
MAP3K12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.275; TCGA BRCA -0.258; TCGA CESC -0.145; TCGA COAD -0.461; TCGA ESCA -0.256; TCGA HNSC -0.159; TCGA LUSC -0.17; TCGA PAAD -0.182; TCGA PRAD -0.187; TCGA SARC -0.138; TCGA STAD -0.113; TCGA UCEC -0.149
hsa-miR-19b-3p
LBH
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.158; TCGA CESC -0.277; TCGA COAD -0.402; TCGA ESCA -0.24; TCGA HNSC -0.237; TCGA LUAD -0.179; TCGA LUSC -0.227; TCGA STAD -0.242; TCGA UCEC -0.232
hsa-miR-19b-3p
KLHL20
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.176; TCGA BRCA -0.091; TCGA CESC -0.138; TCGA COAD -0.15; TCGA HNSC -0.162; TCGA KIRP -0.231; TCGA LIHC -0.133; TCGA LUAD -0.064; TCGA PAAD -0.211; TCGA PRAD -0.282; TCGA SARC -0.144; TCGA THCA -0.095; TCGA STAD -0.112; TCGA UCEC -0.167
hsa-miR-19b-3p
MPPED2
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.305; TCGA CESC -0.63; TCGA COAD -0.686; TCGA HNSC -0.45; TCGA KIRC -0.557; TCGA LIHC -0.215; TCGA PAAD -0.361; TCGA PRAD -0.196; TCGA STAD -0.751
hsa-miR-19b-3p
BBX
14 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.148; TCGA COAD -0.14; TCGA HNSC -0.272; TCGA KIRC -0.287; TCGA KIRP -0.33; TCGA LGG -0.147; TCGA LIHC -0.173; TCGA LUAD -0.129; TCGA PAAD -0.245; TCGA PRAD -0.333; TCGA SARC -0.114; TCGA THCA -0.087; TCGA STAD -0.165; TCGA UCEC -0.136
hsa-miR-19b-3p
FLT1
13 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.182; TCGA BRCA -0.153; TCGA COAD -0.224; TCGA HNSC -0.318; TCGA KIRP -0.404; TCGA LIHC -0.107; TCGA LUAD -0.13; TCGA LUSC -0.302; TCGA PAAD -0.289; TCGA PRAD -0.202; TCGA THCA -0.265; TCGA STAD -0.11; TCGA UCEC -0.3
hsa-miR-19b-3p
CCPG1
17 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.356; TCGA BRCA -0.205; TCGA CESC -0.221; TCGA COAD -0.245; TCGA HNSC -0.329; TCGA KIRC -0.207; TCGA KIRP -0.257; TCGA LGG -0.195; TCGA LIHC -0.185; TCGA LUAD -0.162; TCGA LUSC -0.343; TCGA PAAD -0.367; TCGA PRAD -0.191; TCGA SARC -0.209; TCGA THCA -0.096; TCGA STAD -0.122; TCGA UCEC -0.265
hsa-miR-19b-3p
UBL3
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.244; TCGA BRCA -0.165; TCGA CESC -0.178; TCGA HNSC -0.255; TCGA KIRC -0.212; TCGA KIRP -0.194; TCGA LGG -0.074; TCGA LUAD -0.174; TCGA LUSC -0.277; TCGA PAAD -0.224; TCGA PRAD -0.147; TCGA STAD -0.082; TCGA UCEC -0.301
hsa-miR-19b-3p
SH3D19
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.358; TCGA BRCA -0.219; TCGA CESC -0.157; TCGA ESCA -0.113; TCGA HNSC -0.263; TCGA KIRC -0.212; TCGA KIRP -0.24; TCGA LIHC -0.242; TCGA LUAD -0.191; TCGA LUSC -0.343; TCGA PAAD -0.375; TCGA PRAD -0.18; TCGA SARC -0.329; TCGA THCA -0.137; TCGA STAD -0.247; TCGA UCEC -0.217
hsa-miR-19b-3p
RBMS1
10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.097; TCGA CESC -0.136; TCGA COAD -0.438; TCGA ESCA -0.145; TCGA LUAD -0.085; TCGA LUSC -0.103; TCGA PAAD -0.255; TCGA PRAD -0.358; TCGA STAD -0.29; TCGA UCEC -0.169
hsa-miR-19b-3p
VPS37A
11 cancers: BLCA; CESC; COAD; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.137; TCGA CESC -0.098; TCGA COAD -0.089; TCGA KIRP -0.21; TCGA LGG -0.055; TCGA PAAD -0.1; TCGA PRAD -0.186; TCGA SARC -0.114; TCGA THCA -0.055; TCGA STAD -0.083; TCGA UCEC -0.169
hsa-miR-19b-3p
FAM149A
10 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.403; TCGA BRCA -0.119; TCGA HNSC -0.276; TCGA LGG -0.098; TCGA LIHC -0.237; TCGA LUSC -0.252; TCGA PAAD -0.192; TCGA PRAD -0.198; TCGA SARC -0.471; TCGA STAD -0.462
hsa-miR-19b-3p
PTPN14
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.129; TCGA COAD -0.253; TCGA ESCA -0.191; TCGA HNSC -0.373; TCGA KIRC -0.325; TCGA KIRP -0.469; TCGA LGG -0.282; TCGA LUAD -0.1; TCGA PAAD -0.285; TCGA PRAD -0.378; TCGA STAD -0.273
hsa-miR-19b-3p
STARD8
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.439; TCGA BRCA -0.242; TCGA CESC -0.303; TCGA COAD -0.503; TCGA ESCA -0.245; TCGA HNSC -0.513; TCGA KIRC -0.174; TCGA KIRP -0.224; TCGA LUAD -0.251; TCGA LUSC -0.565; TCGA PAAD -0.324; TCGA PRAD -0.413; TCGA THCA -0.235; TCGA STAD -0.345; TCGA UCEC -0.441
hsa-miR-19b-3p
RHOB
11 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.32; TCGA BRCA -0.345; TCGA ESCA -0.306; TCGA LGG -0.174; TCGA LIHC -0.252; TCGA LUSC -0.211; TCGA PRAD -0.289; TCGA SARC -0.391; TCGA THCA -0.126; TCGA STAD -0.619; TCGA UCEC -0.328
hsa-miR-19b-3p
FAM114A1
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.281; TCGA BRCA -0.217; TCGA COAD -0.382; TCGA ESCA -0.177; TCGA HNSC -0.436; TCGA KIRP -0.404; TCGA LGG -0.176; TCGA LIHC -0.169; TCGA LUAD -0.155; TCGA LUSC -0.225; TCGA PAAD -0.344; TCGA PRAD -0.366; TCGA SARC -0.184; TCGA THCA -0.209; TCGA STAD -0.21; TCGA UCEC -0.225
hsa-miR-19b-3p
WDR47
13 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.135; TCGA COAD -0.166; TCGA ESCA -0.244; TCGA HNSC -0.075; TCGA KIRP -0.246; TCGA LGG -0.104; TCGA LUAD -0.124; TCGA PAAD -0.303; TCGA PRAD -0.233; TCGA SARC -0.124; TCGA THCA -0.103; TCGA STAD -0.199; TCGA UCEC -0.118
hsa-miR-19b-3p
MAP3K2
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.207; TCGA BRCA -0.125; TCGA CESC -0.121; TCGA COAD -0.082; TCGA HNSC -0.356; TCGA KIRC -0.166; TCGA KIRP -0.448; TCGA LGG -0.175; TCGA LIHC -0.23; TCGA LUAD -0.139; TCGA LUSC -0.061; TCGA PAAD -0.377; TCGA PRAD -0.346; TCGA SARC -0.116; TCGA THCA -0.184; TCGA UCEC -0.1
hsa-miR-19b-3p
SCN3A
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.409; TCGA BRCA -0.306; TCGA CESC -0.421; TCGA COAD -0.543; TCGA HNSC -0.503; TCGA KIRC -0.613; TCGA LUSC -0.175; TCGA PAAD -0.379; TCGA PRAD -0.277; TCGA SARC -0.715; TCGA STAD -0.342; TCGA UCEC -0.495
hsa-miR-19b-3p
TMEM132B
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.456; TCGA BRCA -0.238; TCGA COAD -0.603; TCGA ESCA -0.463; TCGA HNSC -0.347; TCGA LUAD -0.228; TCGA PAAD -0.517; TCGA PRAD -0.315; TCGA STAD -0.557
hsa-miR-19b-3p
HCFC2
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.25; TCGA BRCA -0.121; TCGA CESC -0.142; TCGA COAD -0.333; TCGA ESCA -0.199; TCGA HNSC -0.191; TCGA KIRC -0.088; TCGA KIRP -0.269; TCGA LGG -0.077; TCGA LIHC -0.1; TCGA LUAD -0.177; TCGA LUSC -0.148; TCGA PAAD -0.31; TCGA PRAD -0.235; TCGA SARC -0.165; TCGA THCA -0.087; TCGA STAD -0.362; TCGA UCEC -0.247
hsa-miR-19b-3p
AFF1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.217; TCGA CESC -0.138; TCGA COAD -0.114; TCGA ESCA -0.187; TCGA HNSC -0.233; TCGA KIRC -0.126; TCGA KIRP -0.21; TCGA LGG -0.122; TCGA LIHC -0.097; TCGA LUAD -0.05; TCGA LUSC -0.157; TCGA PAAD -0.238; TCGA PRAD -0.107; TCGA SARC -0.245; TCGA STAD -0.216; TCGA UCEC -0.208
hsa-miR-19b-3p
PRICKLE2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.584; TCGA BRCA -0.4; TCGA CESC -0.187; TCGA COAD -0.518; TCGA ESCA -0.566; TCGA HNSC -0.191; TCGA KIRP -0.095; TCGA LGG -0.253; TCGA LUAD -0.176; TCGA LUSC -0.352; TCGA PAAD -0.477; TCGA PRAD -0.512; TCGA SARC -0.202; TCGA THCA -0.089; TCGA STAD -0.894; TCGA UCEC -0.453
hsa-miR-19b-3p
ABCA1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.149; TCGA COAD -0.364; TCGA ESCA -0.25; TCGA HNSC -0.417; TCGA KIRP -0.192; TCGA LGG -0.308; TCGA LUAD -0.199; TCGA LUSC -0.225; TCGA PAAD -0.392; TCGA PRAD -0.24; TCGA STAD -0.281
hsa-miR-19b-3p
GZMK
9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.439; TCGA CESC -0.485; TCGA COAD -1.044; TCGA HNSC -0.296; TCGA LUAD -0.217; TCGA LUSC -0.419; TCGA PAAD -0.329; TCGA STAD -0.241; TCGA UCEC -0.326
hsa-miR-19b-3p
CNKSR2
9 cancers: BLCA; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.302; TCGA ESCA -0.93; TCGA HNSC -0.438; TCGA LGG -0.397; TCGA LUAD -0.29; TCGA PAAD -0.73; TCGA PRAD -0.154; TCGA SARC -0.488; TCGA STAD -1.45
hsa-miR-19b-3p
ELK3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.297; TCGA BRCA -0.248; TCGA CESC -0.317; TCGA COAD -0.459; TCGA ESCA -0.2; TCGA HNSC -0.477; TCGA KIRP -0.583; TCGA LGG -0.189; TCGA LIHC -0.198; TCGA LUAD -0.273; TCGA LUSC -0.367; TCGA PAAD -0.346; TCGA PRAD -0.466; TCGA THCA -0.208; TCGA STAD -0.256; TCGA UCEC -0.417
hsa-miR-19b-3p
RAB18
12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.082; TCGA COAD -0.077; TCGA HNSC -0.051; TCGA KIRC -0.119; TCGA KIRP -0.211; TCGA LIHC -0.101; TCGA LUAD -0.057; TCGA PAAD -0.154; TCGA PRAD -0.097; TCGA THCA -0.094; TCGA STAD -0.099; TCGA UCEC -0.157
hsa-miR-19b-3p
IGF2R
10 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.092; TCGA HNSC -0.292; TCGA KIRC -0.189; TCGA KIRP -0.308; TCGA LUAD -0.06; TCGA LUSC -0.149; TCGA PAAD -0.228; TCGA PRAD -0.156; TCGA SARC -0.069; TCGA THCA -0.181
hsa-miR-19b-3p
RPS6KA5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.241; TCGA BRCA -0.2; TCGA CESC -0.207; TCGA COAD -0.144; TCGA ESCA -0.197; TCGA HNSC -0.17; TCGA KIRP -0.306; TCGA LGG -0.194; TCGA LUAD -0.115; TCGA PAAD -0.212; TCGA PRAD -0.383; TCGA SARC -0.345; TCGA STAD -0.268; TCGA UCEC -0.201
hsa-miR-19b-3p
STK32B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.595; TCGA BRCA -0.588; TCGA CESC -0.253; TCGA COAD -0.577; TCGA ESCA -0.437; TCGA HNSC -0.43; TCGA LIHC -0.204; TCGA LUAD -0.184; TCGA PAAD -0.357; TCGA PRAD -0.276; TCGA STAD -0.424; TCGA UCEC -0.221
hsa-miR-19b-3p
OSBPL11
10 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.079; TCGA HNSC -0.182; TCGA KIRP -0.19; TCGA LGG -0.251; TCGA LIHC -0.126; TCGA LUAD -0.15; TCGA PAAD -0.175; TCGA PRAD -0.204; TCGA THCA -0.129; TCGA STAD -0.05
hsa-miR-19b-3p
MTMR6
11 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.118; TCGA HNSC -0.157; TCGA KIRC -0.095; TCGA KIRP -0.213; TCGA LIHC -0.101; TCGA LUAD -0.187; TCGA LUSC -0.164; TCGA PAAD -0.176; TCGA PRAD -0.144; TCGA THCA -0.053; TCGA UCEC -0.194
hsa-miR-19b-3p
KLF7
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.167; TCGA ESCA -0.399; TCGA HNSC -0.296; TCGA KIRP -0.484; TCGA LGG -0.206; TCGA LIHC -0.178; TCGA LUAD -0.146; TCGA LUSC -0.229; TCGA PAAD -0.306; TCGA PRAD -0.382; TCGA SARC -0.215; TCGA STAD -0.418; TCGA UCEC -0.186
hsa-miR-19b-3p
PNRC1
11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.203; TCGA COAD -0.073; TCGA ESCA -0.225; TCGA HNSC -0.074; TCGA LIHC -0.092; TCGA LUAD -0.12; TCGA LUSC -0.082; TCGA PRAD -0.078; TCGA SARC -0.169; TCGA STAD -0.232; TCGA UCEC -0.189
hsa-miR-19b-3p
RORA
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.356; TCGA BRCA -0.122; TCGA CESC -0.253; TCGA COAD -0.464; TCGA ESCA -0.358; TCGA HNSC -0.321; TCGA KIRP -0.214; TCGA LGG -0.257; TCGA LIHC -0.209; TCGA LUAD -0.121; TCGA LUSC -0.18; TCGA PAAD -0.379; TCGA PRAD -0.256; TCGA STAD -0.424; TCGA UCEC -0.291
hsa-miR-19b-3p
GJA1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.313; TCGA BRCA -0.312; TCGA COAD -0.436; TCGA ESCA -0.487; TCGA HNSC -0.242; TCGA KIRP -0.223; TCGA LGG -0.555; TCGA LIHC -0.15; TCGA LUAD -0.272; TCGA LUSC -0.188; TCGA PAAD -0.397; TCGA PRAD -0.488; TCGA STAD -0.475; TCGA UCEC -0.18
hsa-miR-19b-3p
ERCC4
15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.106; TCGA BRCA -0.109; TCGA COAD -0.085; TCGA HNSC -0.229; TCGA KIRC -0.137; TCGA KIRP -0.24; TCGA LGG -0.08; TCGA LIHC -0.182; TCGA LUAD -0.078; TCGA PAAD -0.296; TCGA PRAD -0.229; TCGA SARC -0.126; TCGA THCA -0.102; TCGA STAD -0.105; TCGA UCEC -0.131
hsa-miR-19b-3p
LONRF3
9 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD
MirTarget
TCGA BLCA -0.22; TCGA HNSC -0.483; TCGA KIRP -0.406; TCGA LGG -0.395; TCGA LIHC -0.226; TCGA LUAD -0.109; TCGA LUSC -0.632; TCGA PAAD -0.246; TCGA PRAD -0.615
hsa-miR-19b-3p
CPEB3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.294; TCGA BRCA -0.162; TCGA CESC -0.189; TCGA COAD -0.119; TCGA ESCA -0.225; TCGA HNSC -0.175; TCGA KIRC -0.276; TCGA KIRP -0.261; TCGA LGG -0.13; TCGA LIHC -0.39; TCGA LUAD -0.084; TCGA LUSC -0.18; TCGA SARC -0.154; TCGA THCA -0.105; TCGA STAD -0.152; TCGA UCEC -0.13
hsa-miR-19b-3p
LRIG1
9 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.574; TCGA BRCA -0.257; TCGA HNSC -0.252; TCGA KIRP -0.109; TCGA LGG -0.219; TCGA LIHC -0.111; TCGA PAAD -0.215; TCGA SARC -0.25; TCGA STAD -0.365
hsa-miR-19b-3p
CLIP4
12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.404; TCGA COAD -0.887; TCGA ESCA -0.447; TCGA HNSC -0.153; TCGA KIRP -0.239; TCGA LGG -0.101; TCGA LIHC -0.298; TCGA LUAD -0.143; TCGA PAAD -0.164; TCGA PRAD -0.406; TCGA STAD -0.757; TCGA UCEC -0.295
hsa-miR-19b-3p
ANXA7
13 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.106; TCGA ESCA -0.076; TCGA HNSC -0.071; TCGA KIRC -0.125; TCGA KIRP -0.142; TCGA LGG -0.122; TCGA LIHC -0.079; TCGA LUAD -0.078; TCGA LUSC -0.061; TCGA PAAD -0.109; TCGA PRAD -0.088; TCGA THCA -0.085; TCGA UCEC -0.091
hsa-miR-19b-3p
RGL1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.386; TCGA CESC -0.235; TCGA COAD -0.33; TCGA ESCA -0.205; TCGA HNSC -0.287; TCGA KIRP -0.217; TCGA LGG -0.188; TCGA LIHC -0.347; TCGA LUAD -0.207; TCGA LUSC -0.273; TCGA PAAD -0.402; TCGA PRAD -0.377; TCGA STAD -0.429; TCGA UCEC -0.202
hsa-miR-19b-3p
PMEPA1
9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.285; TCGA BRCA -0.18; TCGA CESC -0.193; TCGA HNSC -0.218; TCGA LGG -0.092; TCGA LIHC -0.168; TCGA LUAD -0.15; TCGA LUSC -0.371; TCGA UCEC -0.267
hsa-miR-19b-3p
SMAD5
10 cancers: BLCA; BRCA; HNSC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.099; TCGA HNSC -0.13; TCGA KIRP -0.158; TCGA PAAD -0.214; TCGA PRAD -0.181; TCGA SARC -0.065; TCGA THCA -0.053; TCGA STAD -0.063; TCGA UCEC -0.166
hsa-miR-19b-3p
LNPEP
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.204; TCGA BRCA -0.257; TCGA COAD -0.163; TCGA ESCA -0.225; TCGA HNSC -0.491; TCGA KIRC -0.378; TCGA KIRP -0.632; TCGA LGG -0.325; TCGA LIHC -0.271; TCGA LUAD -0.25; TCGA LUSC -0.194; TCGA PAAD -0.413; TCGA PRAD -0.469; TCGA SARC -0.181; TCGA THCA -0.219; TCGA STAD -0.261
hsa-miR-19b-3p
ATXN7
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.079; TCGA CESC -0.091; TCGA HNSC -0.157; TCGA KIRC -0.084; TCGA KIRP -0.178; TCGA LGG -0.092; TCGA LIHC -0.059; TCGA PRAD -0.103; TCGA SARC -0.087; TCGA UCEC -0.103
hsa-miR-19b-3p
EPB41L5
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD
MirTarget; mirMAP
TCGA BLCA -0.08; TCGA BRCA -0.233; TCGA HNSC -0.13; TCGA KIRC -0.292; TCGA KIRP -0.188; TCGA LGG -0.095; TCGA LUSC -0.167; TCGA PAAD -0.22; TCGA PRAD -0.1
hsa-miR-19b-3p
PPARA
11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.175; TCGA HNSC -0.274; TCGA KIRC -0.259; TCGA KIRP -0.18; TCGA LGG -0.222; TCGA PAAD -0.12; TCGA PRAD -0.204; TCGA SARC -0.184; TCGA THCA -0.067; TCGA STAD -0.085; TCGA UCEC -0.169
hsa-miR-19b-3p
RBMS3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.671; TCGA BRCA -0.362; TCGA CESC -0.34; TCGA COAD -0.677; TCGA ESCA -0.436; TCGA HNSC -0.559; TCGA KIRP -0.421; TCGA LGG -0.152; TCGA LIHC -0.316; TCGA LUAD -0.414; TCGA LUSC -0.467; TCGA PAAD -0.713; TCGA PRAD -0.7; TCGA SARC -0.131; TCGA STAD -0.713; TCGA UCEC -0.362
hsa-miR-19b-3p
EVC2
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.436; TCGA BRCA -0.136; TCGA COAD -0.764; TCGA HNSC -0.128; TCGA LGG -0.246; TCGA LUSC -0.19; TCGA PAAD -0.331; TCGA PRAD -0.427; TCGA STAD -0.485
hsa-miR-19b-3p
PCDHAC2
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.417; TCGA BRCA -0.143; TCGA CESC -0.517; TCGA COAD -0.475; TCGA HNSC -0.7; TCGA KIRP -0.912; TCGA LGG -0.367; TCGA LIHC -0.53; TCGA LUAD -0.371; TCGA LUSC -0.476; TCGA PAAD -0.554; TCGA PRAD -0.664; TCGA THCA -0.276; TCGA STAD -0.612; TCGA UCEC -0.397
hsa-miR-19b-3p
RRAGD
13 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.266; TCGA CESC -0.202; TCGA COAD -0.21; TCGA HNSC -0.268; TCGA KIRC -0.235; TCGA KIRP -0.209; TCGA LGG -0.106; TCGA LUAD -0.134; TCGA PAAD -0.272; TCGA PRAD -0.067; TCGA SARC -0.218; TCGA THCA -0.224; TCGA STAD -0.305
hsa-miR-19b-3p
DSEL
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.363; TCGA BRCA -0.26; TCGA COAD -0.654; TCGA ESCA -0.394; TCGA HNSC -0.368; TCGA LUAD -0.104; TCGA LUSC -0.348; TCGA PAAD -0.441; TCGA STAD -0.577; TCGA UCEC -0.282
hsa-miR-19b-3p
EFR3A
15 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.196; TCGA BRCA -0.09; TCGA CESC -0.116; TCGA HNSC -0.193; TCGA KIRP -0.221; TCGA LGG -0.212; TCGA LIHC -0.271; TCGA LUAD -0.117; TCGA LUSC -0.134; TCGA PAAD -0.234; TCGA PRAD -0.262; TCGA SARC -0.123; TCGA THCA -0.082; TCGA STAD -0.052; TCGA UCEC -0.236
hsa-miR-19b-3p
ATP6V1B2
12 cancers: BLCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.092; TCGA COAD -0.171; TCGA KIRC -0.107; TCGA KIRP -0.135; TCGA LGG -0.12; TCGA LIHC -0.142; TCGA LUAD -0.165; TCGA LUSC -0.197; TCGA PAAD -0.139; TCGA PRAD -0.062; TCGA THCA -0.083; TCGA UCEC -0.079
hsa-miR-19b-3p
RAPGEF2
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.072; TCGA CESC -0.106; TCGA HNSC -0.303; TCGA KIRC -0.22; TCGA KIRP -0.226; TCGA LGG -0.12; TCGA LIHC -0.18; TCGA LUAD -0.075; TCGA LUSC -0.299; TCGA PAAD -0.17; TCGA PRAD -0.136; TCGA THCA -0.128; TCGA STAD -0.125; TCGA UCEC -0.104
hsa-miR-19b-3p
CLTC
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; THCA
MirTarget; miRNATAP
TCGA BLCA -0.059; TCGA BRCA -0.104; TCGA HNSC -0.176; TCGA KIRC -0.15; TCGA KIRP -0.248; TCGA LGG -0.116; TCGA LIHC -0.06; TCGA LUSC -0.06; TCGA PAAD -0.201; TCGA PRAD -0.13; TCGA THCA -0.201
hsa-miR-19b-3p
G3BP2
12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA BLCA -0.051; TCGA COAD -0.086; TCGA HNSC -0.146; TCGA KIRC -0.253; TCGA KIRP -0.323; TCGA LGG -0.094; TCGA LIHC -0.111; TCGA LUAD -0.1; TCGA PAAD -0.193; TCGA PRAD -0.105; TCGA SARC -0.109; TCGA THCA -0.155
hsa-miR-19b-3p
GTF2A1
14 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.232; TCGA BRCA -0.18; TCGA COAD -0.159; TCGA HNSC -0.553; TCGA KIRC -0.385; TCGA KIRP -0.832; TCGA LGG -0.297; TCGA LIHC -0.193; TCGA LUAD -0.216; TCGA LUSC -0.113; TCGA PAAD -0.484; TCGA PRAD -0.55; TCGA THCA -0.309; TCGA STAD -0.065
hsa-miR-19b-3p
MBNL3
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.402; TCGA CESC -0.219; TCGA COAD -0.213; TCGA HNSC -0.531; TCGA KIRC -0.532; TCGA KIRP -0.729; TCGA LGG -0.257; TCGA LUAD -0.322; TCGA PAAD -0.477; TCGA PRAD -0.63; TCGA THCA -0.26
hsa-miR-19b-3p
SLC9A6
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
MirTarget; miRNATAP
TCGA BLCA -0.05; TCGA CESC -0.092; TCGA COAD -0.067; TCGA HNSC -0.1; TCGA KIRC -0.097; TCGA KIRP -0.157; TCGA LGG -0.187; TCGA LIHC -0.109; TCGA LUAD -0.129; TCGA PAAD -0.133; TCGA PRAD -0.211; TCGA THCA -0.077
hsa-miR-19b-3p
CDH13
13 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.175; TCGA BRCA -0.202; TCGA COAD -0.229; TCGA HNSC -0.247; TCGA KIRP -0.269; TCGA LUAD -0.323; TCGA LUSC -0.265; TCGA PAAD -0.33; TCGA PRAD -0.213; TCGA SARC -0.161; TCGA THCA -0.322; TCGA STAD -0.214; TCGA UCEC -0.732
hsa-miR-19b-3p
FOXP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.245; TCGA CESC -0.199; TCGA COAD -0.11; TCGA ESCA -0.154; TCGA HNSC -0.168; TCGA LUAD -0.098; TCGA LUSC -0.321; TCGA SARC -0.141; TCGA STAD -0.149; TCGA UCEC -0.269
hsa-miR-19b-3p
GIT2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.118; TCGA BRCA -0.078; TCGA CESC -0.063; TCGA COAD -0.14; TCGA ESCA -0.107; TCGA HNSC -0.153; TCGA LUAD -0.054; TCGA LUSC -0.11; TCGA PAAD -0.094; TCGA PRAD -0.111; TCGA THCA -0.058; TCGA STAD -0.18; TCGA UCEC -0.113
hsa-miR-19b-3p
PI15
9 cancers: BLCA; CESC; COAD; HNSC; LIHC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.451; TCGA CESC -0.334; TCGA COAD -0.555; TCGA HNSC -0.332; TCGA LIHC -0.254; TCGA PRAD -0.374; TCGA SARC -0.754; TCGA STAD -0.302; TCGA UCEC -0.758
hsa-miR-19b-3p
GPR137B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.14; TCGA BRCA -0.132; TCGA CESC -0.204; TCGA COAD -0.261; TCGA ESCA -0.122; TCGA HNSC -0.181; TCGA KIRP -0.177; TCGA LGG -0.157; TCGA LIHC -0.15; TCGA LUAD -0.137; TCGA LUSC -0.085; TCGA PAAD -0.202; TCGA PRAD -0.228; TCGA THCA -0.153; TCGA UCEC -0.262
hsa-miR-19b-3p
ANTXR1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.474; TCGA BRCA -0.257; TCGA CESC -0.292; TCGA COAD -0.794; TCGA ESCA -0.372; TCGA HNSC -0.461; TCGA KIRP -0.328; TCGA LGG -0.096; TCGA LIHC -0.284; TCGA LUAD -0.341; TCGA LUSC -0.42; TCGA PAAD -0.553; TCGA PRAD -0.496; TCGA STAD -0.463; TCGA UCEC -0.305
hsa-miR-19b-3p
MAN1C1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.426; TCGA BRCA -0.381; TCGA CESC -0.39; TCGA COAD -0.566; TCGA ESCA -0.6; TCGA HNSC -0.389; TCGA KIRC -0.395; TCGA KIRP -0.491; TCGA LIHC -0.405; TCGA LUAD -0.187; TCGA LUSC -0.351; TCGA PAAD -0.463; TCGA PRAD -0.101; TCGA SARC -0.353; TCGA STAD -0.561; TCGA UCEC -0.341
hsa-miR-19b-3p
PCDHAC1
11 cancers: BLCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
MirTarget
TCGA BLCA -0.232; TCGA COAD -0.64; TCGA KIRC -0.281; TCGA KIRP -0.589; TCGA LGG -0.388; TCGA LIHC -0.379; TCGA LUAD -0.236; TCGA LUSC -0.408; TCGA PAAD -0.56; TCGA PRAD -0.171; TCGA THCA -0.307
hsa-miR-19b-3p
ATP1A2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.54; TCGA BRCA -0.698; TCGA CESC -0.506; TCGA COAD -1.416; TCGA ESCA -1.491; TCGA HNSC -0.946; TCGA KIRC -0.307; TCGA LGG -0.512; TCGA LIHC -0.331; TCGA LUAD -0.259; TCGA LUSC -0.878; TCGA PAAD -0.434; TCGA PRAD -0.621; TCGA SARC -0.495; TCGA STAD -1.811; TCGA UCEC -0.363
hsa-miR-19b-3p
NRK
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.548; TCGA BRCA -0.588; TCGA CESC -0.833; TCGA COAD -0.902; TCGA ESCA -0.75; TCGA HNSC -0.711; TCGA KIRC -0.845; TCGA PAAD -1.021; TCGA PRAD -0.482; TCGA SARC -0.544; TCGA STAD -1.056; TCGA UCEC -0.409
hsa-miR-19b-3p
PCDHA10
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUSC; PAAD; UCEC
MirTarget
TCGA BLCA -0.283; TCGA BRCA -0.245; TCGA CESC -0.76; TCGA COAD -0.519; TCGA ESCA -0.565; TCGA KIRP -0.449; TCGA LIHC -0.54; TCGA LUSC -0.463; TCGA PAAD -0.698; TCGA UCEC -0.702
hsa-miR-19b-3p
SLC24A3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.855; TCGA BRCA -0.1; TCGA CESC -0.54; TCGA COAD -0.735; TCGA ESCA -0.601; TCGA HNSC -0.375; TCGA KIRP -0.293; TCGA LGG -0.133; TCGA LIHC -0.376; TCGA LUAD -0.281; TCGA LUSC -0.453; TCGA PAAD -0.266; TCGA PRAD -0.43; TCGA SARC -1.082; TCGA THCA -0.198; TCGA STAD -0.53; TCGA UCEC -0.741
hsa-miR-19b-3p
FIBIN
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.79; TCGA BRCA -0.341; TCGA CESC -0.653; TCGA COAD -0.675; TCGA ESCA -0.675; TCGA HNSC -0.747; TCGA KIRC -0.366; TCGA KIRP -0.424; TCGA LGG -0.325; TCGA LIHC -0.241; TCGA LUAD -0.38; TCGA LUSC -0.709; TCGA PAAD -0.584; TCGA PRAD -0.232; TCGA SARC -0.319; TCGA STAD -0.561; TCGA UCEC -0.497
hsa-miR-19b-3p
NCOA4
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.183; TCGA BRCA -0.055; TCGA COAD -0.066; TCGA ESCA -0.105; TCGA HNSC -0.215; TCGA KIRC -0.182; TCGA KIRP -0.261; TCGA LGG -0.052; TCGA LIHC -0.08; TCGA LUAD -0.181; TCGA LUSC -0.188; TCGA PAAD -0.213; TCGA PRAD -0.179; TCGA SARC -0.062; TCGA THCA -0.152; TCGA STAD -0.083; TCGA UCEC -0.129
hsa-miR-19b-3p
RAP1A
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.215; TCGA CESC -0.104; TCGA COAD -0.119; TCGA ESCA -0.094; TCGA HNSC -0.07; TCGA KIRP -0.143; TCGA LIHC -0.076; TCGA LUAD -0.175; TCGA LUSC -0.175; TCGA PAAD -0.139; TCGA PRAD -0.179; TCGA SARC -0.245; TCGA STAD -0.242; TCGA UCEC -0.151
hsa-miR-19b-3p
TSHZ3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.715; TCGA BRCA -0.313; TCGA CESC -0.374; TCGA COAD -0.64; TCGA ESCA -0.53; TCGA HNSC -0.458; TCGA KIRP -0.232; TCGA LGG -0.076; TCGA LIHC -0.242; TCGA LUAD -0.281; TCGA LUSC -0.289; TCGA PAAD -0.398; TCGA PRAD -0.344; TCGA STAD -0.658; TCGA UCEC -0.58
hsa-miR-19b-3p
TRIM23
15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.164; TCGA BRCA -0.159; TCGA COAD -0.106; TCGA HNSC -0.142; TCGA KIRC -0.093; TCGA KIRP -0.166; TCGA LGG -0.102; TCGA LIHC -0.096; TCGA LUAD -0.146; TCGA LUSC -0.106; TCGA PAAD -0.203; TCGA PRAD -0.176; TCGA SARC -0.127; TCGA STAD -0.203; TCGA UCEC -0.192
hsa-miR-19b-3p
GULP1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.51; TCGA BRCA -0.165; TCGA CESC -0.558; TCGA COAD -0.635; TCGA HNSC -0.412; TCGA KIRC -0.228; TCGA KIRP -0.28; TCGA LUSC -0.268; TCGA PAAD -0.277; TCGA PRAD -0.187; TCGA STAD -0.336; TCGA UCEC -0.247
hsa-miR-19b-3p
ELL2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.245; TCGA BRCA -0.117; TCGA COAD -0.24; TCGA ESCA -0.219; TCGA HNSC -0.091; TCGA KIRP -0.17; TCGA LUSC -0.203; TCGA PAAD -0.181; TCGA SARC -0.177; TCGA STAD -0.282; TCGA UCEC -0.251
hsa-miR-19b-3p
FBXW11
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.127; TCGA BRCA -0.086; TCGA COAD -0.063; TCGA ESCA -0.082; TCGA HNSC -0.136; TCGA KIRC -0.176; TCGA KIRP -0.223; TCGA LGG -0.079; TCGA LIHC -0.096; TCGA LUAD -0.12; TCGA LUSC -0.074; TCGA PAAD -0.201; TCGA PRAD -0.11; TCGA SARC -0.103; TCGA THCA -0.115; TCGA STAD -0.103; TCGA UCEC -0.056
hsa-miR-19b-3p
NPTN
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.279; TCGA BRCA -0.128; TCGA CESC -0.126; TCGA COAD -0.2; TCGA ESCA -0.147; TCGA HNSC -0.087; TCGA KIRC -0.151; TCGA KIRP -0.198; TCGA LGG -0.113; TCGA LIHC -0.07; TCGA LUAD -0.129; TCGA LUSC -0.118; TCGA PAAD -0.218; TCGA PRAD -0.254; TCGA SARC -0.259; TCGA STAD -0.185; TCGA UCEC -0.22
hsa-miR-19b-3p
FAM69A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.331; TCGA BRCA -0.215; TCGA CESC -0.186; TCGA COAD -0.083; TCGA ESCA -0.197; TCGA HNSC -0.124; TCGA LUAD -0.121; TCGA PAAD -0.292; TCGA PRAD -0.269; TCGA SARC -0.283; TCGA THCA -0.084; TCGA STAD -0.266; TCGA UCEC -0.372
hsa-miR-19b-3p
RNF38
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.15; TCGA ESCA -0.11; TCGA HNSC -0.177; TCGA KIRC -0.149; TCGA KIRP -0.199; TCGA LGG -0.077; TCGA PAAD -0.105; TCGA PRAD -0.169; TCGA SARC -0.275; TCGA STAD -0.215; TCGA UCEC -0.178
hsa-miR-19b-3p
ATP6V0E1
9 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.064; TCGA BRCA -0.078; TCGA ESCA -0.165; TCGA LIHC -0.129; TCGA LUAD -0.092; TCGA LUSC -0.15; TCGA THCA -0.073; TCGA STAD -0.066; TCGA UCEC -0.082
hsa-miR-19b-3p
THBS1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.632; TCGA BRCA -0.254; TCGA CESC -0.333; TCGA COAD -0.501; TCGA ESCA -0.476; TCGA HNSC -0.58; TCGA KIRP -0.56; TCGA LIHC -0.259; TCGA LUAD -0.394; TCGA LUSC -0.632; TCGA PAAD -0.726; TCGA PRAD -0.401; TCGA SARC -0.247; TCGA STAD -0.501; TCGA UCEC -0.568
hsa-miR-19b-3p
FAM46B
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.728; TCGA BRCA -0.111; TCGA COAD -0.776; TCGA ESCA -0.62; TCGA LUAD -0.177; TCGA LUSC -0.47; TCGA PRAD -0.454; TCGA SARC -0.721; TCGA STAD -0.96; TCGA UCEC -0.165
hsa-miR-19b-3p
RPS6KA2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.319; TCGA BRCA -0.161; TCGA CESC -0.275; TCGA COAD -0.236; TCGA ESCA -0.175; TCGA HNSC -0.381; TCGA KIRC -0.161; TCGA KIRP -0.263; TCGA LGG -0.108; TCGA LIHC -0.236; TCGA LUSC -0.418; TCGA PAAD -0.173; TCGA THCA -0.084; TCGA STAD -0.338; TCGA UCEC -0.369
hsa-miR-19b-3p
ZNF385B
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUSC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.471; TCGA BRCA -0.462; TCGA COAD -0.964; TCGA ESCA -0.667; TCGA HNSC -0.539; TCGA KIRC -0.625; TCGA LGG -0.304; TCGA LUSC -0.623; TCGA STAD -0.798
hsa-miR-19b-3p
CACNA1C
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.806; TCGA BRCA -0.252; TCGA CESC -0.473; TCGA COAD -0.447; TCGA ESCA -0.588; TCGA HNSC -0.48; TCGA KIRP -0.305; TCGA LUAD -0.185; TCGA LUSC -0.472; TCGA PAAD -0.208; TCGA PRAD -0.431; TCGA SARC -0.478; TCGA THCA -0.195; TCGA STAD -0.754; TCGA UCEC -0.638
hsa-miR-19b-3p
MPP7
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.333; TCGA BRCA -0.364; TCGA CESC -0.233; TCGA ESCA -0.228; TCGA HNSC -0.26; TCGA KIRC -0.643; TCGA KIRP -0.287; TCGA LGG -0.252; TCGA LUSC -0.185; TCGA PRAD -0.264; TCGA SARC -0.698; TCGA THCA -0.197; TCGA STAD -0.399; TCGA UCEC -0.217
hsa-miR-19b-3p
HECW2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.16; TCGA BRCA -0.124; TCGA CESC -0.439; TCGA COAD -0.305; TCGA HNSC -0.448; TCGA KIRP -0.582; TCGA LIHC -0.171; TCGA LUSC -0.396; TCGA PAAD -0.327; TCGA PRAD -0.282; TCGA THCA -0.212; TCGA UCEC -0.293
hsa-miR-19b-3p
ASXL2
13 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA BLCA -0.185; TCGA BRCA -0.107; TCGA HNSC -0.581; TCGA KIRC -0.387; TCGA KIRP -0.78; TCGA LGG -0.29; TCGA LIHC -0.156; TCGA LUAD -0.153; TCGA LUSC -0.118; TCGA PAAD -0.478; TCGA PRAD -0.577; TCGA SARC -0.174; TCGA THCA -0.304
hsa-miR-19b-3p
TIPARP
12 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.169; TCGA BRCA -0.132; TCGA COAD -0.12; TCGA ESCA -0.208; TCGA LGG -0.146; TCGA LUAD -0.242; TCGA LUSC -0.145; TCGA PAAD -0.199; TCGA PRAD -0.352; TCGA SARC -0.136; TCGA STAD -0.123; TCGA UCEC -0.207
hsa-miR-19b-3p
IGF1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -1.037; TCGA BRCA -0.447; TCGA CESC -0.832; TCGA COAD -1.185; TCGA ESCA -0.818; TCGA HNSC -0.75; TCGA KIRP -0.292; TCGA LIHC -0.484; TCGA LUAD -0.333; TCGA LUSC -0.589; TCGA PAAD -0.92; TCGA PRAD -0.179; TCGA STAD -0.811
hsa-miR-19b-3p
MMGT1
11 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.097; TCGA HNSC -0.07; TCGA KIRC -0.154; TCGA KIRP -0.241; TCGA LIHC -0.108; TCGA LUAD -0.153; TCGA PAAD -0.178; TCGA PRAD -0.135; TCGA SARC -0.087; TCGA THCA -0.097; TCGA UCEC -0.097
hsa-miR-19b-3p
NAALADL2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; STAD
MirTarget
TCGA BLCA -0.226; TCGA BRCA -0.202; TCGA CESC -0.461; TCGA HNSC -0.623; TCGA KIRC -0.403; TCGA KIRP -0.332; TCGA LGG -0.189; TCGA LIHC -0.415; TCGA PAAD -0.267; TCGA STAD -0.152
hsa-miR-19b-3p
BTBD7
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.077; TCGA BRCA -0.103; TCGA COAD -0.093; TCGA HNSC -0.172; TCGA KIRC -0.079; TCGA KIRP -0.105; TCGA LGG -0.116; TCGA PAAD -0.169; TCGA PRAD -0.17; TCGA STAD -0.077; TCGA UCEC -0.102
hsa-miR-19b-3p
ATP10A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; STAD
MirTarget
TCGA BLCA -0.467; TCGA BRCA -0.178; TCGA CESC -0.322; TCGA COAD -0.663; TCGA ESCA -0.5; TCGA HNSC -0.525; TCGA LIHC -0.295; TCGA LUAD -0.345; TCGA LUSC -0.665; TCGA PAAD -0.172; TCGA SARC -0.166; TCGA STAD -0.381
hsa-miR-19b-3p
ANKRD42
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; THCA
MirTarget
TCGA BLCA -0.051; TCGA BRCA -0.189; TCGA COAD -0.087; TCGA KIRC -0.098; TCGA KIRP -0.091; TCGA LGG -0.147; TCGA LIHC -0.186; TCGA PAAD -0.076; TCGA PRAD -0.091; TCGA THCA -0.067
hsa-miR-19b-3p
LPP
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.631; TCGA BRCA -0.17; TCGA CESC -0.306; TCGA COAD -0.349; TCGA ESCA -0.349; TCGA HNSC -0.476; TCGA KIRP -0.523; TCGA LGG -0.249; TCGA LIHC -0.215; TCGA LUAD -0.171; TCGA LUSC -0.097; TCGA PAAD -0.46; TCGA PRAD -0.598; TCGA SARC -0.514; TCGA THCA -0.232; TCGA STAD -0.618; TCGA UCEC -0.361
hsa-miR-19b-3p
SLC8A1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.573; TCGA BRCA -0.147; TCGA CESC -0.436; TCGA COAD -0.487; TCGA ESCA -0.359; TCGA HNSC -0.552; TCGA KIRP -0.496; TCGA LGG -0.235; TCGA LIHC -0.301; TCGA LUAD -0.274; TCGA LUSC -0.303; TCGA PAAD -0.553; TCGA PRAD -0.661; TCGA SARC -0.556; TCGA THCA -0.184; TCGA STAD -0.624; TCGA UCEC -0.477
hsa-miR-19b-3p
ETV1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.42; TCGA BRCA -0.206; TCGA CESC -0.482; TCGA COAD -0.396; TCGA HNSC -0.448; TCGA KIRP -0.342; TCGA LIHC -0.211; TCGA LUAD -0.415; TCGA LUSC -0.449; TCGA PAAD -0.353; TCGA PRAD -0.351; TCGA STAD -0.311; TCGA UCEC -0.232
hsa-miR-19b-3p
ARHGEF12
17 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.174; TCGA BRCA -0.151; TCGA CESC -0.105; TCGA COAD -0.063; TCGA HNSC -0.265; TCGA KIRC -0.213; TCGA KIRP -0.37; TCGA LGG -0.159; TCGA LIHC -0.201; TCGA LUAD -0.07; TCGA LUSC -0.121; TCGA PAAD -0.227; TCGA PRAD -0.206; TCGA SARC -0.155; TCGA THCA -0.141; TCGA STAD -0.07; TCGA UCEC -0.135
hsa-miR-19b-3p
RAB8B
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.11; TCGA CESC -0.164; TCGA COAD -0.329; TCGA HNSC -0.229; TCGA KIRP -0.147; TCGA LGG -0.068; TCGA LIHC -0.091; TCGA LUAD -0.269; TCGA LUSC -0.316; TCGA PAAD -0.247; TCGA PRAD -0.185; TCGA THCA -0.139; TCGA STAD -0.13; TCGA UCEC -0.3
hsa-miR-19b-3p
DYNC1LI2
9 cancers: BLCA; HNSC; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.125; TCGA HNSC -0.1; TCGA LGG -0.072; TCGA LIHC -0.117; TCGA PAAD -0.138; TCGA PRAD -0.132; TCGA SARC -0.108; TCGA STAD -0.174; TCGA UCEC -0.133
hsa-miR-19b-3p
HIP1
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.14; TCGA BRCA -0.189; TCGA COAD -0.186; TCGA HNSC -0.431; TCGA KIRP -0.471; TCGA LIHC -0.142; TCGA LUAD -0.206; TCGA LUSC -0.148; TCGA PAAD -0.441; TCGA PRAD -0.35; TCGA THCA -0.225; TCGA STAD -0.17
hsa-miR-19b-3p
CSF2RB
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.34; TCGA BRCA -0.082; TCGA CESC -0.25; TCGA COAD -0.674; TCGA HNSC -0.359; TCGA KIRP -0.213; TCGA LIHC -0.155; TCGA LUAD -0.25; TCGA LUSC -0.446; TCGA PAAD -0.357; TCGA PRAD -0.289; TCGA STAD -0.193; TCGA UCEC -0.312
hsa-miR-19b-3p
MICAL2
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.193; TCGA BRCA -0.23; TCGA CESC -0.192; TCGA HNSC -0.34; TCGA KIRP -0.252; TCGA LIHC -0.222; TCGA LUAD -0.203; TCGA LUSC -0.421; TCGA PAAD -0.308; TCGA STAD -0.289; TCGA UCEC -0.37
hsa-miR-19b-3p
RSPO3
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.004; TCGA CESC -0.899; TCGA COAD -1.115; TCGA ESCA -1.196; TCGA HNSC -0.64; TCGA KIRC -0.35; TCGA LIHC -0.655; TCGA LUAD -0.191; TCGA LUSC -0.559; TCGA PAAD -0.697; TCGA PRAD -0.496; TCGA SARC -0.793; TCGA STAD -0.934; TCGA UCEC -0.609
hsa-miR-19b-3p
MYH11
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -1.726; TCGA BRCA -0.478; TCGA CESC -0.654; TCGA COAD -1.356; TCGA ESCA -1.516; TCGA HNSC -0.784; TCGA KIRP -0.345; TCGA LIHC -0.251; TCGA LUAD -0.402; TCGA LUSC -0.693; TCGA PAAD -0.503; TCGA PRAD -0.659; TCGA SARC -1.761; TCGA STAD -1.826; TCGA UCEC -1.366
hsa-miR-19b-3p
SYT11
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.504; TCGA BRCA -0.129; TCGA CESC -0.169; TCGA COAD -0.62; TCGA ESCA -0.328; TCGA HNSC -0.415; TCGA KIRP -0.351; TCGA LGG -0.155; TCGA LUAD -0.22; TCGA LUSC -0.327; TCGA PAAD -0.468; TCGA PRAD -0.38; TCGA SARC -0.237; TCGA STAD -0.528
hsa-miR-19b-3p
FAM168A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget; mirMAP
TCGA BLCA -0.185; TCGA BRCA -0.107; TCGA CESC -0.147; TCGA COAD -0.241; TCGA ESCA -0.226; TCGA HNSC -0.413; TCGA KIRC -0.345; TCGA KIRP -0.697; TCGA LGG -0.296; TCGA LUAD -0.161; TCGA LUSC -0.097; TCGA PAAD -0.521; TCGA PRAD -0.458; TCGA THCA -0.275; TCGA STAD -0.202
hsa-miR-19b-3p
OCRL
11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.085; TCGA HNSC -0.104; TCGA KIRC -0.074; TCGA KIRP -0.136; TCGA LGG -0.071; TCGA PAAD -0.163; TCGA PRAD -0.085; TCGA SARC -0.119; TCGA THCA -0.123; TCGA STAD -0.125; TCGA UCEC -0.096
hsa-miR-19b-3p
FAM155A
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.461; TCGA BRCA -0.268; TCGA CESC -0.526; TCGA COAD -0.611; TCGA HNSC -0.457; TCGA LIHC -0.263; TCGA LUAD -0.256; TCGA LUSC -0.479; TCGA PAAD -0.297; TCGA PRAD -0.345; TCGA STAD -0.161; TCGA UCEC -0.482
hsa-miR-19b-3p
PIK3R3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; PAAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.109; TCGA CESC -0.133; TCGA COAD -0.195; TCGA HNSC -0.13; TCGA KIRC -0.163; TCGA KIRP -0.198; TCGA LIHC -0.157; TCGA PAAD -0.244; TCGA SARC -0.148; TCGA THCA -0.238; TCGA STAD -0.109
hsa-miR-19b-3p
SBF2
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.103; TCGA CESC -0.128; TCGA HNSC -0.282; TCGA KIRC -0.159; TCGA KIRP -0.289; TCGA LGG -0.179; TCGA LIHC -0.114; TCGA LUAD -0.101; TCGA PAAD -0.239; TCGA PRAD -0.231; TCGA SARC -0.104; TCGA THCA -0.153; TCGA STAD -0.171; TCGA UCEC -0.183
hsa-miR-19b-3p
ZFYVE9
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.088; TCGA COAD -0.083; TCGA ESCA -0.136; TCGA HNSC -0.13; TCGA KIRC -0.206; TCGA KIRP -0.284; TCGA LIHC -0.123; TCGA LUAD -0.14; TCGA PAAD -0.234; TCGA PRAD -0.089; TCGA THCA -0.169; TCGA STAD -0.143
hsa-miR-19b-3p
RBM20
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.441; TCGA BRCA -0.148; TCGA CESC -0.333; TCGA COAD -0.477; TCGA ESCA -0.344; TCGA HNSC -0.195; TCGA LUSC -0.173; TCGA PRAD -0.248; TCGA SARC -0.224; TCGA STAD -0.715; TCGA UCEC -0.257
hsa-miR-19b-3p
EPS15
13 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.064; TCGA HNSC -0.102; TCGA KIRC -0.061; TCGA KIRP -0.139; TCGA LGG -0.171; TCGA LIHC -0.145; TCGA LUAD -0.082; TCGA LUSC -0.088; TCGA PAAD -0.13; TCGA PRAD -0.086; TCGA THCA -0.07; TCGA STAD -0.065; TCGA UCEC -0.162
hsa-miR-19b-3p
KPNA6
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.051; TCGA COAD -0.058; TCGA ESCA -0.075; TCGA HNSC -0.129; TCGA KIRC -0.089; TCGA KIRP -0.244; TCGA LIHC -0.108; TCGA PAAD -0.149; TCGA PRAD -0.153; TCGA THCA -0.095; TCGA STAD -0.069; TCGA UCEC -0.062
hsa-miR-19b-3p
PDCD1LG2
16 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.338; TCGA CESC -0.305; TCGA COAD -0.757; TCGA ESCA -0.325; TCGA HNSC -0.29; TCGA KIRP -0.287; TCGA LGG -0.428; TCGA LIHC -0.343; TCGA LUAD -0.381; TCGA LUSC -0.458; TCGA PAAD -0.485; TCGA PRAD -0.316; TCGA SARC -0.35; TCGA THCA -0.176; TCGA STAD -0.191; TCGA UCEC -0.33
hsa-miR-19b-3p
WDFY3
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.13; TCGA CESC -0.135; TCGA COAD -0.141; TCGA ESCA -0.134; TCGA HNSC -0.277; TCGA KIRC -0.219; TCGA KIRP -0.272; TCGA LGG -0.224; TCGA LIHC -0.203; TCGA LUAD -0.054; TCGA LUSC -0.093; TCGA PAAD -0.292; TCGA PRAD -0.186; TCGA SARC -0.065; TCGA THCA -0.065; TCGA STAD -0.204; TCGA UCEC -0.084
hsa-miR-19b-3p
MKL2
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.236; TCGA COAD -0.075; TCGA ESCA -0.127; TCGA HNSC -0.28; TCGA KIRC -0.092; TCGA KIRP -0.196; TCGA LGG -0.159; TCGA LIHC -0.155; TCGA LUAD -0.068; TCGA LUSC -0.092; TCGA PAAD -0.303; TCGA PRAD -0.19; TCGA THCA -0.082; TCGA STAD -0.167; TCGA UCEC -0.179
hsa-miR-19b-3p
ATRX
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.092; TCGA CESC -0.1; TCGA HNSC -0.229; TCGA KIRC -0.152; TCGA KIRP -0.263; TCGA LGG -0.209; TCGA LIHC -0.1; TCGA LUAD -0.073; TCGA PAAD -0.265; TCGA PRAD -0.229; TCGA SARC -0.119; TCGA THCA -0.105
hsa-miR-19b-3p
RAPGEF4
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.193; TCGA CESC -0.188; TCGA HNSC -0.211; TCGA KIRP -0.324; TCGA LUAD -0.144; TCGA LUSC -0.182; TCGA PAAD -0.325; TCGA SARC -0.228; TCGA THCA -0.238; TCGA UCEC -0.361
hsa-miR-19b-3p
ARFIP1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.069; TCGA BRCA -0.1; TCGA CESC -0.072; TCGA HNSC -0.054; TCGA KIRC -0.107; TCGA KIRP -0.099; TCGA LGG -0.061; TCGA LIHC -0.152; TCGA LUAD -0.084; TCGA LUSC -0.089; TCGA PRAD -0.09; TCGA SARC -0.06; TCGA UCEC -0.115
hsa-miR-19b-3p
PCDH10
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.744; TCGA BRCA -0.377; TCGA CESC -0.344; TCGA ESCA -0.873; TCGA HNSC -0.554; TCGA LGG -0.248; TCGA LUAD -0.354; TCGA LUSC -0.623; TCGA PAAD -0.435; TCGA PRAD -0.636; TCGA STAD -1.844
hsa-miR-19b-3p
MAPK6
10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; THCA
MirTarget
TCGA BLCA -0.076; TCGA CESC -0.134; TCGA COAD -0.091; TCGA HNSC -0.152; TCGA KIRP -0.239; TCGA LGG -0.07; TCGA LUAD -0.073; TCGA PAAD -0.162; TCGA PRAD -0.126; TCGA THCA -0.145
hsa-miR-19b-3p
DTNA
10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BLCA -0.868; TCGA COAD -0.681; TCGA ESCA -0.715; TCGA HNSC -0.477; TCGA LGG -0.354; TCGA LUSC -0.271; TCGA PAAD -0.366; TCGA PRAD -0.375; TCGA SARC -0.611; TCGA STAD -0.91
hsa-miR-19b-3p
TMEM159
9 cancers: BLCA; CESC; ESCA; LIHC; LUAD; PAAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.146; TCGA CESC -0.12; TCGA ESCA -0.205; TCGA LIHC -0.244; TCGA LUAD -0.115; TCGA PAAD -0.157; TCGA SARC -0.397; TCGA STAD -0.262; TCGA UCEC -0.244
hsa-miR-19b-3p
COQ10B
16 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.169; TCGA BRCA -0.102; TCGA CESC -0.076; TCGA COAD -0.072; TCGA KIRC -0.095; TCGA KIRP -0.074; TCGA LGG -0.137; TCGA LIHC -0.119; TCGA LUAD -0.084; TCGA LUSC -0.092; TCGA PAAD -0.113; TCGA PRAD -0.105; TCGA SARC -0.123; TCGA THCA -0.089; TCGA STAD -0.075; TCGA UCEC -0.133
hsa-miR-19b-3p
TGOLN2
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.102; TCGA BRCA -0.088; TCGA CESC -0.088; TCGA HNSC -0.236; TCGA KIRC -0.178; TCGA KIRP -0.352; TCGA LGG -0.063; TCGA LIHC -0.118; TCGA LUAD -0.085; TCGA LUSC -0.132; TCGA PAAD -0.155; TCGA PRAD -0.214; TCGA SARC -0.082; TCGA THCA -0.06; TCGA UCEC -0.125
hsa-miR-19b-3p
ZMYND11
14 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.168; TCGA COAD -0.066; TCGA HNSC -0.148; TCGA KIRC -0.154; TCGA KIRP -0.191; TCGA LIHC -0.123; TCGA LUAD -0.064; TCGA LUSC -0.122; TCGA PAAD -0.207; TCGA PRAD -0.188; TCGA SARC -0.107; TCGA THCA -0.062; TCGA STAD -0.205; TCGA UCEC -0.133
hsa-miR-19b-3p
JAZF1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.472; TCGA BRCA -0.066; TCGA CESC -0.205; TCGA COAD -0.509; TCGA ESCA -0.233; TCGA HNSC -0.213; TCGA KIRP -0.127; TCGA LIHC -0.14; TCGA LUAD -0.214; TCGA LUSC -0.236; TCGA PAAD -0.224; TCGA PRAD -0.412; TCGA SARC -0.105; TCGA THCA -0.159; TCGA STAD -0.426; TCGA UCEC -0.367
hsa-miR-19b-3p
GNAQ
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.221; TCGA BRCA -0.081; TCGA COAD -0.175; TCGA ESCA -0.14; TCGA HNSC -0.144; TCGA KIRC -0.105; TCGA KIRP -0.179; TCGA LGG -0.156; TCGA LIHC -0.09; TCGA LUAD -0.145; TCGA LUSC -0.179; TCGA PAAD -0.23; TCGA PRAD -0.104; TCGA SARC -0.133; TCGA THCA -0.093; TCGA STAD -0.153; TCGA UCEC -0.207
hsa-miR-19b-3p
TUB
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.378; TCGA COAD -0.627; TCGA ESCA -0.406; TCGA HNSC -0.355; TCGA KIRC -0.334; TCGA LGG -0.16; TCGA PAAD -0.41; TCGA PRAD -0.16; TCGA SARC -0.341; TCGA STAD -0.791; TCGA UCEC -0.29
hsa-miR-19b-3p
FOXP2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -1; TCGA BRCA -0.194; TCGA COAD -0.904; TCGA ESCA -1.004; TCGA HNSC -0.579; TCGA LIHC -0.265; TCGA PAAD -0.81; TCGA PRAD -0.765; TCGA STAD -1.226; TCGA UCEC -0.742
hsa-miR-19b-3p
PXDN
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.532; TCGA BRCA -0.138; TCGA CESC -0.244; TCGA COAD -0.456; TCGA HNSC -0.421; TCGA LIHC -0.199; TCGA LUAD -0.115; TCGA LUSC -0.248; TCGA PAAD -0.344; TCGA PRAD -0.132; TCGA THCA -0.263; TCGA STAD -0.169
hsa-miR-19b-3p
TRAK2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.306; TCGA BRCA -0.209; TCGA CESC -0.157; TCGA COAD -0.086; TCGA ESCA -0.149; TCGA HNSC -0.282; TCGA KIRC -0.193; TCGA KIRP -0.212; TCGA LGG -0.083; TCGA LUAD -0.126; TCGA LUSC -0.291; TCGA PAAD -0.212; TCGA PRAD -0.164; TCGA SARC -0.188; TCGA STAD -0.224; TCGA UCEC -0.151
hsa-miR-19b-3p
PHLDA3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.124; TCGA BRCA -0.18; TCGA CESC -0.156; TCGA COAD -0.522; TCGA ESCA -0.448; TCGA LIHC -0.225; TCGA LUSC -0.095; TCGA PRAD -0.079; TCGA SARC -0.121; TCGA STAD -0.437; TCGA UCEC -0.29
hsa-miR-19b-3p
WDR44
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.169; TCGA BRCA -0.113; TCGA COAD -0.148; TCGA ESCA -0.116; TCGA HNSC -0.181; TCGA KIRP -0.205; TCGA LGG -0.098; TCGA LIHC -0.222; TCGA LUAD -0.105; TCGA PAAD -0.194; TCGA PRAD -0.249; TCGA SARC -0.206; TCGA THCA -0.106; TCGA STAD -0.068; TCGA UCEC -0.148
hsa-miR-19b-3p
HIC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.482; TCGA BRCA -0.277; TCGA CESC -0.347; TCGA COAD -0.435; TCGA ESCA -0.385; TCGA HNSC -0.333; TCGA LIHC -0.18; TCGA LUAD -0.099; TCGA LUSC -0.369; TCGA PRAD -0.101; TCGA STAD -0.384; TCGA UCEC -0.485
hsa-miR-19b-3p
F3
9 cancers: BLCA; BRCA; COAD; KIRP; LGG; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.253; TCGA BRCA -0.161; TCGA COAD -0.306; TCGA KIRP -0.258; TCGA LGG -0.301; TCGA LUSC -0.29; TCGA PRAD -0.447; TCGA STAD -0.151; TCGA UCEC -0.272
hsa-miR-19b-3p
CTGF
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.844; TCGA BRCA -0.161; TCGA CESC -0.626; TCGA COAD -0.519; TCGA ESCA -0.417; TCGA HNSC -0.382; TCGA KIRP -0.284; TCGA LUAD -0.33; TCGA LUSC -0.564; TCGA PAAD -0.518; TCGA PRAD -0.21; TCGA STAD -0.398; TCGA UCEC -0.409
hsa-miR-19b-3p
PPTC7
11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.251; TCGA COAD -0.136; TCGA HNSC -0.376; TCGA KIRC -0.284; TCGA KIRP -0.565; TCGA LGG -0.232; TCGA LUAD -0.089; TCGA PAAD -0.259; TCGA PRAD -0.514; TCGA SARC -0.218; TCGA THCA -0.313
hsa-miR-19b-3p
SEL1L
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.171; TCGA BRCA -0.18; TCGA CESC -0.088; TCGA COAD -0.167; TCGA HNSC -0.256; TCGA KIRC -0.154; TCGA KIRP -0.314; TCGA LGG -0.149; TCGA LIHC -0.161; TCGA LUAD -0.145; TCGA LUSC -0.162; TCGA PAAD -0.272; TCGA SARC -0.108; TCGA THCA -0.141; TCGA UCEC -0.143
hsa-miR-19b-3p
SEPT7
9 cancers: BLCA; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; mirMAP; miRNATAP
TCGA BLCA -0.121; TCGA KIRP -0.096; TCGA LGG -0.057; TCGA LUAD -0.142; TCGA PAAD -0.201; TCGA PRAD -0.147; TCGA THCA -0.067; TCGA STAD -0.119; TCGA UCEC -0.147
hsa-miR-19b-3p
ZMAT3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.376; TCGA BRCA -0.162; TCGA CESC -0.183; TCGA COAD -0.315; TCGA ESCA -0.18; TCGA HNSC -0.513; TCGA KIRC -0.272; TCGA KIRP -0.468; TCGA LGG -0.291; TCGA LIHC -0.321; TCGA LUAD -0.253; TCGA LUSC -0.226; TCGA PAAD -0.424; TCGA PRAD -0.406; TCGA THCA -0.274; TCGA STAD -0.149; TCGA UCEC -0.243
hsa-miR-19b-3p
ITPR1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.434; TCGA BRCA -0.37; TCGA CESC -0.395; TCGA COAD -0.556; TCGA ESCA -0.519; TCGA HNSC -0.374; TCGA KIRC -0.202; TCGA KIRP -0.553; TCGA LGG -0.236; TCGA LIHC -0.182; TCGA LUAD -0.132; TCGA LUSC -0.459; TCGA PAAD -0.368; TCGA PRAD -0.623; TCGA SARC -0.501; TCGA STAD -0.558; TCGA UCEC -0.618
hsa-miR-19b-3p
TMEM106B
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.123; TCGA BRCA -0.099; TCGA CESC -0.095; TCGA HNSC -0.163; TCGA KIRC -0.183; TCGA KIRP -0.259; TCGA LGG -0.076; TCGA LIHC -0.086; TCGA LUAD -0.133; TCGA PAAD -0.17; TCGA PRAD -0.306; TCGA SARC -0.074; TCGA THCA -0.093; TCGA UCEC -0.214
hsa-miR-19b-3p
TAOK1
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.255; TCGA BRCA -0.226; TCGA CESC -0.189; TCGA COAD -0.217; TCGA HNSC -0.649; TCGA KIRC -0.374; TCGA KIRP -0.823; TCGA LGG -0.339; TCGA LIHC -0.187; TCGA LUAD -0.132; TCGA PAAD -0.524; TCGA PRAD -0.609; TCGA SARC -0.216; TCGA THCA -0.35; TCGA STAD -0.069; TCGA UCEC -0.136
hsa-miR-19b-3p
ARMC8
9 cancers: BLCA; COAD; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.066; TCGA COAD -0.051; TCGA KIRC -0.09; TCGA LUAD -0.069; TCGA PAAD -0.1; TCGA PRAD -0.134; TCGA SARC -0.083; TCGA THCA -0.079; TCGA STAD -0.082
hsa-miR-19b-3p
S1PR1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.494; TCGA BRCA -0.218; TCGA CESC -0.356; TCGA COAD -0.546; TCGA ESCA -0.318; TCGA HNSC -0.455; TCGA KIRP -0.268; TCGA LGG -0.27; TCGA LIHC -0.158; TCGA LUAD -0.323; TCGA LUSC -0.616; TCGA PAAD -0.301; TCGA PRAD -0.203; TCGA SARC -0.189; TCGA THCA -0.202; TCGA STAD -0.489; TCGA UCEC -0.594
hsa-miR-19b-3p
CFL2
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.512; TCGA CESC -0.119; TCGA COAD -0.544; TCGA ESCA -0.411; TCGA HNSC -0.229; TCGA KIRC -0.146; TCGA LIHC -0.147; TCGA LUAD -0.117; TCGA LUSC -0.264; TCGA PAAD -0.253; TCGA PRAD -0.327; TCGA SARC -0.404; TCGA THCA -0.118; TCGA STAD -0.79; TCGA UCEC -0.31
hsa-miR-19b-3p
SPOCK1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.565; TCGA BRCA -0.451; TCGA CESC -0.501; TCGA COAD -1.139; TCGA ESCA -0.528; TCGA HNSC -0.6; TCGA KIRP -0.323; TCGA LGG -0.184; TCGA PAAD -0.497; TCGA STAD -0.737; TCGA UCEC -0.297
hsa-miR-19b-3p
SH3RF3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.452; TCGA BRCA -0.135; TCGA COAD -0.295; TCGA ESCA -0.205; TCGA HNSC -0.344; TCGA LIHC -0.365; TCGA LUAD -0.083; TCGA LUSC -0.195; TCGA PAAD -0.163; TCGA PRAD -0.107; TCGA STAD -0.385; TCGA UCEC -0.208
hsa-miR-19b-3p
WNK1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.149; TCGA CESC -0.166; TCGA COAD -0.07; TCGA ESCA -0.193; TCGA HNSC -0.268; TCGA KIRC -0.225; TCGA KIRP -0.377; TCGA LUAD -0.08; TCGA LUSC -0.06; TCGA PAAD -0.175; TCGA PRAD -0.164; TCGA THCA -0.163; TCGA STAD -0.086; TCGA UCEC -0.097
hsa-miR-19b-3p
ARRDC4
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.337; TCGA BRCA -0.164; TCGA COAD -0.184; TCGA ESCA -0.273; TCGA HNSC -0.112; TCGA LUAD -0.258; TCGA LUSC -0.211; TCGA PAAD -0.238; TCGA PRAD -0.063; TCGA STAD -0.358; TCGA UCEC -0.36
hsa-miR-19b-3p
MIER1
11 cancers: BLCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.103; TCGA COAD -0.065; TCGA HNSC -0.119; TCGA KIRP -0.153; TCGA LIHC -0.146; TCGA LUAD -0.142; TCGA LUSC -0.098; TCGA PAAD -0.176; TCGA PRAD -0.2; TCGA SARC -0.093; TCGA UCEC -0.142
hsa-miR-19b-3p
WASL
12 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.063; TCGA HNSC -0.095; TCGA KIRC -0.137; TCGA KIRP -0.141; TCGA LGG -0.103; TCGA LIHC -0.079; TCGA LUAD -0.093; TCGA LUSC -0.059; TCGA PAAD -0.161; TCGA SARC -0.076; TCGA THCA -0.112; TCGA UCEC -0.133
hsa-miR-19b-3p
CAB39
14 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.068; TCGA HNSC -0.107; TCGA KIRC -0.14; TCGA KIRP -0.216; TCGA LGG -0.08; TCGA LIHC -0.077; TCGA LUAD -0.119; TCGA LUSC -0.108; TCGA PAAD -0.103; TCGA PRAD -0.093; TCGA SARC -0.109; TCGA STAD -0.05; TCGA UCEC -0.115
hsa-miR-19b-3p
REEP3
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.123; TCGA BRCA -0.075; TCGA COAD -0.211; TCGA ESCA -0.135; TCGA HNSC -0.194; TCGA KIRC -0.147; TCGA KIRP -0.408; TCGA LIHC -0.12; TCGA LUAD -0.124; TCGA LUSC -0.187; TCGA PAAD -0.294; TCGA PRAD -0.122; TCGA THCA -0.259; TCGA STAD -0.187; TCGA UCEC -0.098
hsa-miR-19b-3p
EXOC5
13 cancers: BLCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.079; TCGA COAD -0.087; TCGA HNSC -0.105; TCGA KIRP -0.253; TCGA LGG -0.052; TCGA LIHC -0.079; TCGA LUAD -0.08; TCGA PAAD -0.212; TCGA PRAD -0.16; TCGA SARC -0.065; TCGA THCA -0.117; TCGA STAD -0.051; TCGA UCEC -0.083
hsa-miR-19b-3p
USP12
15 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.263; TCGA BRCA -0.08; TCGA HNSC -0.381; TCGA KIRC -0.297; TCGA KIRP -0.653; TCGA LGG -0.158; TCGA LIHC -0.212; TCGA LUAD -0.152; TCGA LUSC -0.131; TCGA PAAD -0.355; TCGA PRAD -0.442; TCGA SARC -0.174; TCGA THCA -0.247; TCGA STAD -0.12; TCGA UCEC -0.148
hsa-miR-19b-3p
MAGI2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.33; TCGA BRCA -0.19; TCGA CESC -0.24; TCGA COAD -0.235; TCGA ESCA -0.406; TCGA HNSC -0.12; TCGA KIRC -0.162; TCGA LGG -0.203; TCGA LIHC -0.172; TCGA LUAD -0.175; TCGA PAAD -0.287; TCGA PRAD -0.155; TCGA SARC -0.212; TCGA STAD -0.732; TCGA UCEC -0.162
hsa-miR-19b-3p
ARHGAP21
12 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.103; TCGA HNSC -0.217; TCGA KIRP -0.249; TCGA LGG -0.066; TCGA LIHC -0.069; TCGA LUAD -0.055; TCGA LUSC -0.14; TCGA PAAD -0.204; TCGA PRAD -0.139; TCGA SARC -0.158; TCGA THCA -0.119; TCGA UCEC -0.116
hsa-miR-19b-3p
RAB33B
12 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.102; TCGA HNSC -0.114; TCGA KIRP -0.113; TCGA LIHC -0.133; TCGA LUAD -0.127; TCGA LUSC -0.14; TCGA PAAD -0.17; TCGA PRAD -0.135; TCGA SARC -0.198; TCGA STAD -0.109; TCGA UCEC -0.186
hsa-miR-19b-3p
MTMR10
10 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.136; TCGA BRCA -0.102; TCGA HNSC -0.109; TCGA KIRC -0.19; TCGA LGG -0.092; TCGA LUAD -0.089; TCGA PRAD -0.095; TCGA SARC -0.082; TCGA STAD -0.077; TCGA UCEC -0.135
hsa-miR-19b-3p
SYNM
12 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.281; TCGA COAD -1.076; TCGA ESCA -1.197; TCGA HNSC -0.385; TCGA LUAD -0.12; TCGA LUSC -0.169; TCGA PAAD -0.428; TCGA PRAD -0.619; TCGA SARC -1.002; TCGA THCA -0.232; TCGA STAD -1.701; TCGA UCEC -0.569
hsa-miR-19b-3p
SKIL
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD
MirTarget
TCGA BLCA -0.229; TCGA BRCA -0.11; TCGA CESC -0.214; TCGA HNSC -0.408; TCGA KIRC -0.134; TCGA KIRP -0.379; TCGA LGG -0.153; TCGA LUAD -0.105; TCGA PAAD -0.297; TCGA PRAD -0.306
hsa-miR-19b-3p
CLOCK
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.171; TCGA BRCA -0.1; TCGA COAD -0.159; TCGA ESCA -0.138; TCGA HNSC -0.392; TCGA KIRC -0.349; TCGA KIRP -0.723; TCGA LGG -0.264; TCGA LIHC -0.243; TCGA LUAD -0.095; TCGA LUSC -0.162; TCGA PAAD -0.42; TCGA PRAD -0.478; TCGA THCA -0.303; TCGA STAD -0.106
hsa-miR-19b-3p
PDE5A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.606; TCGA BRCA -0.171; TCGA CESC -0.218; TCGA COAD -0.542; TCGA ESCA -0.467; TCGA HNSC -0.317; TCGA KIRP -0.327; TCGA LIHC -0.169; TCGA LUAD -0.293; TCGA LUSC -0.399; TCGA PAAD -0.334; TCGA PRAD -0.553; TCGA SARC -0.664; TCGA STAD -0.533; TCGA UCEC -0.329
hsa-miR-19b-3p
LAMP2
9 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.116; TCGA HNSC -0.158; TCGA KIRP -0.253; TCGA LGG -0.152; TCGA LIHC -0.196; TCGA LUAD -0.142; TCGA PAAD -0.213; TCGA PRAD -0.112; TCGA THCA -0.12
hsa-miR-19b-3p
GAS7
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.796; TCGA BRCA -0.351; TCGA CESC -0.402; TCGA COAD -0.693; TCGA ESCA -0.607; TCGA HNSC -0.469; TCGA LGG -0.179; TCGA LUAD -0.301; TCGA LUSC -0.556; TCGA PAAD -0.489; TCGA PRAD -0.34; TCGA SARC -0.235; TCGA STAD -0.562; TCGA UCEC -0.216
hsa-miR-19b-3p
PHF20
9 cancers: BLCA; BRCA; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; THCA
mirMAP; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.079; TCGA HNSC -0.117; TCGA KIRP -0.08; TCGA LUSC -0.056; TCGA PAAD -0.163; TCGA PRAD -0.06; TCGA SARC -0.055; TCGA THCA -0.064
hsa-miR-19b-3p
MFAP3
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.069; TCGA BRCA -0.16; TCGA COAD -0.109; TCGA HNSC -0.214; TCGA KIRP -0.216; TCGA LGG -0.068; TCGA LIHC -0.065; TCGA LUAD -0.122; TCGA LUSC -0.112; TCGA PAAD -0.305; TCGA PRAD -0.154; TCGA THCA -0.094
hsa-miR-19b-3p
PHLPP2
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; UCEC
mirMAP
TCGA BLCA -0.107; TCGA BRCA -0.053; TCGA HNSC -0.119; TCGA KIRC -0.115; TCGA KIRP -0.248; TCGA LGG -0.128; TCGA LIHC -0.233; TCGA LUAD -0.078; TCGA PAAD -0.189; TCGA PRAD -0.156; TCGA UCEC -0.169
hsa-miR-19b-3p
GPM6B
9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.389; TCGA COAD -0.349; TCGA ESCA -0.406; TCGA HNSC -0.238; TCGA LGG -0.24; TCGA LUSC -0.242; TCGA PAAD -0.367; TCGA PRAD -0.279; TCGA STAD -0.664
hsa-miR-19b-3p
LMO3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.93; TCGA CESC -0.711; TCGA COAD -1.408; TCGA ESCA -0.835; TCGA HNSC -0.258; TCGA LGG -0.466; TCGA LUSC -0.433; TCGA PAAD -0.669; TCGA PRAD -0.508; TCGA SARC -0.707; TCGA STAD -1.138; TCGA UCEC -0.696
hsa-miR-19b-3p
KITLG
15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.414; TCGA BRCA -0.417; TCGA COAD -0.335; TCGA HNSC -0.271; TCGA KIRC -0.374; TCGA KIRP -0.606; TCGA LGG -0.345; TCGA LUAD -0.166; TCGA LUSC -0.24; TCGA PAAD -0.397; TCGA PRAD -0.407; TCGA SARC -0.206; TCGA THCA -0.208; TCGA STAD -0.309; TCGA UCEC -0.435
hsa-miR-19b-3p
H6PD
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.11; TCGA BRCA -0.104; TCGA CESC -0.107; TCGA ESCA -0.111; TCGA HNSC -0.291; TCGA LUSC -0.142; TCGA PRAD -0.128; TCGA STAD -0.191; TCGA UCEC -0.161
hsa-miR-19b-3p
PER3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.375; TCGA BRCA -0.152; TCGA CESC -0.289; TCGA COAD -0.196; TCGA ESCA -0.284; TCGA HNSC -0.254; TCGA KIRC -0.156; TCGA KIRP -0.143; TCGA LGG -0.126; TCGA LUSC -0.201; TCGA PAAD -0.242; TCGA PRAD -0.302; TCGA SARC -0.197; TCGA STAD -0.496; TCGA UCEC -0.214
hsa-miR-19b-3p
KIAA2022
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.73; TCGA BRCA -0.16; TCGA CESC -0.689; TCGA COAD -1.077; TCGA ESCA -1.011; TCGA HNSC -0.362; TCGA KIRC -0.91; TCGA KIRP -0.546; TCGA PAAD -0.63; TCGA PRAD -0.262; TCGA SARC -0.894; TCGA THCA -0.179; TCGA STAD -1.295; TCGA UCEC -0.29
hsa-miR-19b-3p
ATG2B
9 cancers: BLCA; BRCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.091; TCGA BRCA -0.162; TCGA HNSC -0.192; TCGA KIRP -0.091; TCGA PAAD -0.117; TCGA PRAD -0.075; TCGA SARC -0.065; TCGA STAD -0.066; TCGA UCEC -0.132
hsa-miR-19b-3p
NEO1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.207; TCGA BRCA -0.141; TCGA HNSC -0.278; TCGA KIRC -0.141; TCGA KIRP -0.221; TCGA LGG -0.109; TCGA LIHC -0.082; TCGA LUAD -0.136; TCGA PAAD -0.256; TCGA PRAD -0.126; TCGA SARC -0.199
hsa-miR-19b-3p
EVI5
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.117; TCGA BRCA -0.069; TCGA CESC -0.076; TCGA COAD -0.088; TCGA HNSC -0.129; TCGA KIRP -0.182; TCGA LUAD -0.114; TCGA LUSC -0.156; TCGA PAAD -0.183; TCGA PRAD -0.153; TCGA THCA -0.051; TCGA STAD -0.08; TCGA UCEC -0.154
hsa-miR-19b-3p
NAV3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.718; TCGA BRCA -0.41; TCGA CESC -0.354; TCGA COAD -0.823; TCGA ESCA -0.497; TCGA HNSC -0.275; TCGA LGG -0.323; TCGA LUAD -0.307; TCGA LUSC -0.482; TCGA PAAD -0.539; TCGA PRAD -0.217; TCGA STAD -0.742; TCGA UCEC -0.453
hsa-miR-19b-3p
NUAK1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.212; TCGA BRCA -0.299; TCGA CESC -0.254; TCGA COAD -0.492; TCGA HNSC -0.237; TCGA KIRP -0.157; TCGA LUAD -0.205; TCGA LUSC -0.152; TCGA PAAD -0.433; TCGA PRAD -0.339; TCGA THCA -0.188; TCGA STAD -0.149; TCGA UCEC -0.252
hsa-miR-19b-3p
IPCEF1
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.192; TCGA CESC -0.395; TCGA COAD -0.359; TCGA HNSC -0.323; TCGA KIRC -0.248; TCGA LGG -0.238; TCGA LUAD -0.208; TCGA LUSC -0.225; TCGA PRAD -0.183; TCGA SARC -0.303; TCGA UCEC -0.158
hsa-miR-19b-3p
PPP1R12B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.749; TCGA BRCA -0.137; TCGA CESC -0.356; TCGA COAD -0.645; TCGA ESCA -0.676; TCGA HNSC -0.359; TCGA KIRC -0.197; TCGA KIRP -0.233; TCGA LGG -0.069; TCGA LIHC -0.101; TCGA LUSC -0.222; TCGA PAAD -0.169; TCGA PRAD -0.46; TCGA SARC -0.975; TCGA STAD -0.987; TCGA UCEC -0.758
hsa-miR-19b-3p
PPP2R5C
11 cancers: BLCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.079; TCGA ESCA -0.07; TCGA KIRC -0.066; TCGA KIRP -0.103; TCGA LGG -0.091; TCGA LIHC -0.071; TCGA LUAD -0.055; TCGA PRAD -0.069; TCGA THCA -0.071; TCGA STAD -0.053; TCGA UCEC -0.059
hsa-miR-19b-3p
RUNX1T1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.918; TCGA BRCA -0.529; TCGA CESC -0.651; TCGA COAD -0.801; TCGA ESCA -0.65; TCGA HNSC -0.914; TCGA KIRP -0.679; TCGA LGG -0.234; TCGA LUAD -0.33; TCGA LUSC -0.753; TCGA PAAD -0.733; TCGA PRAD -0.678; TCGA SARC -0.184; TCGA THCA -0.222; TCGA STAD -0.78; TCGA UCEC -0.762
hsa-miR-19b-3p
SSH1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA BRCA -0.056; TCGA COAD -0.161; TCGA ESCA -0.102; TCGA HNSC -0.219; TCGA KIRP -0.129; TCGA LUAD -0.085; TCGA LUSC -0.141; TCGA PAAD -0.225; TCGA PRAD -0.204; TCGA THCA -0.051; TCGA STAD -0.169; TCGA UCEC -0.146
hsa-miR-19b-3p
PDPR
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.153; TCGA ESCA -0.14; TCGA HNSC -0.416; TCGA KIRC -0.23; TCGA KIRP -0.334; TCGA LGG -0.156; TCGA PAAD -0.188; TCGA PRAD -0.385; TCGA STAD -0.155; TCGA UCEC -0.097
hsa-miR-19b-3p
MAPK1
10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.069; TCGA HNSC -0.153; TCGA KIRC -0.086; TCGA KIRP -0.205; TCGA LGG -0.176; TCGA PAAD -0.168; TCGA PRAD -0.143; TCGA SARC -0.056; TCGA THCA -0.094; TCGA UCEC -0.105
hsa-miR-19b-3p
CBX7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.434; TCGA BRCA -0.19; TCGA CESC -0.22; TCGA COAD -0.218; TCGA ESCA -0.456; TCGA HNSC -0.23; TCGA KIRC -0.167; TCGA LGG -0.17; TCGA LIHC -0.16; TCGA LUAD -0.137; TCGA LUSC -0.194; TCGA PRAD -0.206; TCGA SARC -0.606; TCGA STAD -0.636; TCGA UCEC -0.601
hsa-miR-19b-3p
NIN
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.074; TCGA BRCA -0.056; TCGA COAD -0.141; TCGA ESCA -0.164; TCGA HNSC -0.098; TCGA KIRP -0.157; TCGA PAAD -0.243; TCGA PRAD -0.062; TCGA THCA -0.083; TCGA STAD -0.268; TCGA UCEC -0.099
hsa-miR-19b-3p
NFATC2
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.47; TCGA BRCA -0.287; TCGA CESC -0.404; TCGA HNSC -1.155; TCGA KIRC -0.26; TCGA KIRP -0.862; TCGA LGG -0.335; TCGA LUAD -0.379; TCGA LUSC -0.67; TCGA PAAD -0.513; TCGA PRAD -0.729; TCGA THCA -0.249; TCGA UCEC -0.342
hsa-miR-19b-3p
SAMHD1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.303; TCGA BRCA -0.087; TCGA CESC -0.203; TCGA COAD -0.283; TCGA ESCA -0.291; TCGA HNSC -0.455; TCGA KIRP -0.399; TCGA LGG -0.119; TCGA LIHC -0.195; TCGA LUAD -0.317; TCGA LUSC -0.464; TCGA PAAD -0.524; TCGA PRAD -0.433; TCGA SARC -0.205; TCGA THCA -0.233; TCGA STAD -0.201
hsa-miR-19b-3p
TBL1X
9 cancers: BLCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.197; TCGA KIRC -0.144; TCGA KIRP -0.131; TCGA LGG -0.062; TCGA PAAD -0.13; TCGA PRAD -0.147; TCGA SARC -0.141; TCGA STAD -0.158; TCGA UCEC -0.349
hsa-miR-19b-3p
XIAP
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
mirMAP
TCGA BLCA -0.055; TCGA BRCA -0.098; TCGA CESC -0.101; TCGA HNSC -0.135; TCGA KIRC -0.123; TCGA KIRP -0.156; TCGA LIHC -0.103; TCGA LUAD -0.052; TCGA LUSC -0.052; TCGA PAAD -0.097; TCGA PRAD -0.11; TCGA UCEC -0.085
hsa-miR-19b-3p
EEA1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.23; TCGA BRCA -0.151; TCGA CESC -0.181; TCGA HNSC -0.242; TCGA KIRP -0.264; TCGA LGG -0.067; TCGA LUAD -0.158; TCGA LUSC -0.123; TCGA PAAD -0.321; TCGA PRAD -0.233; TCGA SARC -0.204; TCGA THCA -0.142; TCGA UCEC -0.22
hsa-miR-19b-3p
XYLT1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.444; TCGA BRCA -0.147; TCGA CESC -0.319; TCGA ESCA -0.217; TCGA HNSC -0.495; TCGA KIRP -0.262; TCGA LIHC -0.205; TCGA LUAD -0.205; TCGA LUSC -0.308; TCGA PAAD -0.404; TCGA PRAD -0.292; TCGA STAD -0.2; TCGA UCEC -0.553
hsa-miR-19b-3p
IGDCC4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.453; TCGA BRCA -0.181; TCGA CESC -0.297; TCGA COAD -0.266; TCGA ESCA -0.204; TCGA HNSC -0.558; TCGA LGG -0.153; TCGA LUSC -0.225; TCGA PAAD -0.335; TCGA PRAD -0.373; TCGA STAD -0.224
hsa-miR-19b-3p
SLC30A4
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.373; TCGA BRCA -0.183; TCGA COAD -0.267; TCGA ESCA -0.261; TCGA HNSC -0.531; TCGA KIRC -0.339; TCGA KIRP -0.724; TCGA LGG -0.278; TCGA LIHC -0.318; TCGA LUAD -0.252; TCGA LUSC -0.209; TCGA PAAD -0.429; TCGA PRAD -0.321; TCGA SARC -0.262; TCGA THCA -0.253; TCGA STAD -0.288; TCGA UCEC -0.245
hsa-miR-19b-3p
TRPS1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.541; TCGA CESC -0.234; TCGA COAD -0.691; TCGA ESCA -0.363; TCGA HNSC -0.235; TCGA KIRC -0.195; TCGA KIRP -0.217; TCGA LGG -0.225; TCGA LIHC -0.167; TCGA PAAD -0.377; TCGA PRAD -0.267; TCGA STAD -0.565; TCGA UCEC -0.132
hsa-miR-19b-3p
NOVA2
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.124; TCGA BRCA -0.128; TCGA COAD -0.28; TCGA HNSC -0.201; TCGA LUAD -0.157; TCGA LUSC -0.438; TCGA THCA -0.137; TCGA STAD -0.242; TCGA UCEC -0.335
hsa-miR-19b-3p
GLIS3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.33; TCGA BRCA -0.221; TCGA CESC -0.387; TCGA COAD -0.733; TCGA HNSC -0.636; TCGA KIRP -0.198; TCGA LGG -0.287; TCGA LUAD -0.166; TCGA LUSC -0.355; TCGA PAAD -0.316; TCGA PRAD -0.453; TCGA STAD -0.256
hsa-miR-19b-3p
SH3PXD2A
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.34; TCGA BRCA -0.104; TCGA COAD -0.214; TCGA ESCA -0.215; TCGA HNSC -0.211; TCGA KIRP -0.124; TCGA LUAD -0.067; TCGA LUSC -0.127; TCGA PAAD -0.315; TCGA PRAD -0.368; TCGA STAD -0.229; TCGA UCEC -0.169
hsa-miR-19b-3p
EBF3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.424; TCGA BRCA -0.256; TCGA COAD -0.768; TCGA ESCA -0.409; TCGA HNSC -0.284; TCGA PAAD -0.474; TCGA PRAD -0.114; TCGA THCA -0.232; TCGA STAD -0.542; TCGA UCEC -0.237
hsa-miR-19b-3p
PPARGC1A
10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.876; TCGA HNSC -0.539; TCGA KIRC -0.519; TCGA KIRP -0.257; TCGA LGG -0.459; TCGA LIHC -0.224; TCGA LUSC -0.571; TCGA PRAD -0.62; TCGA SARC -0.869; TCGA STAD -0.31
hsa-miR-19b-3p
PPFIBP1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.196; TCGA BRCA -0.107; TCGA COAD -0.236; TCGA ESCA -0.167; TCGA HNSC -0.233; TCGA LIHC -0.105; TCGA LUAD -0.155; TCGA LUSC -0.192; TCGA PAAD -0.187; TCGA PRAD -0.177; TCGA STAD -0.161
hsa-miR-19b-3p
BACH2
9 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.396; TCGA CESC -0.244; TCGA COAD -0.721; TCGA HNSC -0.318; TCGA LIHC -0.317; TCGA LUAD -0.148; TCGA PRAD -0.174; TCGA STAD -0.337; TCGA UCEC -0.208
hsa-miR-19b-3p
QKI
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.126; TCGA CESC -0.115; TCGA COAD -0.527; TCGA ESCA -0.197; TCGA HNSC -0.187; TCGA KIRP -0.198; TCGA LGG -0.09; TCGA LUAD -0.186; TCGA LUSC -0.159; TCGA PAAD -0.3; TCGA PRAD -0.184; TCGA THCA -0.06; TCGA STAD -0.395; TCGA UCEC -0.148
hsa-miR-19b-3p
NPR3
14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.59; TCGA COAD -1.023; TCGA ESCA -0.626; TCGA HNSC -0.385; TCGA KIRC -0.463; TCGA KIRP -0.445; TCGA LIHC -0.625; TCGA LUAD -0.485; TCGA LUSC -0.449; TCGA PAAD -0.6; TCGA PRAD -0.184; TCGA THCA -0.317; TCGA STAD -1.013; TCGA UCEC -0.3
hsa-miR-19b-3p
LIFR
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.432; TCGA BRCA -0.2; TCGA CESC -0.339; TCGA COAD -0.808; TCGA ESCA -0.339; TCGA HNSC -0.448; TCGA KIRC -0.345; TCGA KIRP -0.38; TCGA LGG -0.274; TCGA LIHC -0.36; TCGA LUAD -0.122; TCGA LUSC -0.269; TCGA PAAD -0.354; TCGA PRAD -0.165; TCGA THCA -0.226; TCGA STAD -0.584; TCGA UCEC -0.56
hsa-miR-19b-3p
CPEB4
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.399; TCGA BRCA -0.238; TCGA CESC -0.227; TCGA COAD -0.225; TCGA ESCA -0.181; TCGA HNSC -0.398; TCGA KIRC -0.34; TCGA KIRP -0.316; TCGA LGG -0.172; TCGA LIHC -0.199; TCGA LUAD -0.126; TCGA LUSC -0.348; TCGA PAAD -0.313; TCGA PRAD -0.309; TCGA SARC -0.4; TCGA THCA -0.15; TCGA STAD -0.162; TCGA UCEC -0.291
hsa-miR-19b-3p
PLEKHG1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.162; TCGA CESC -0.319; TCGA COAD -0.212; TCGA ESCA -0.239; TCGA HNSC -0.368; TCGA KIRP -0.251; TCGA LGG -0.256; TCGA LIHC -0.15; TCGA LUAD -0.151; TCGA LUSC -0.133; TCGA PAAD -0.163; TCGA PRAD -0.319; TCGA THCA -0.162
hsa-miR-19b-3p
KCNJ5
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.391; TCGA BRCA -0.209; TCGA COAD -0.843; TCGA HNSC -0.538; TCGA LIHC -0.19; TCGA LUAD -0.361; TCGA LUSC -0.617; TCGA PAAD -0.427; TCGA PRAD -0.453; TCGA STAD -0.494
hsa-miR-19b-3p
LDB3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.762; TCGA BRCA -0.267; TCGA CESC -0.367; TCGA COAD -1.043; TCGA ESCA -0.96; TCGA HNSC -0.744; TCGA LUAD -0.13; TCGA LUSC -0.323; TCGA PAAD -0.333; TCGA PRAD -0.587; TCGA SARC -0.725; TCGA STAD -1.466; TCGA UCEC -0.41
hsa-miR-19b-3p
RHOJ
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.578; TCGA BRCA -0.227; TCGA CESC -0.34; TCGA COAD -0.539; TCGA ESCA -0.389; TCGA HNSC -0.474; TCGA KIRP -0.233; TCGA LIHC -0.128; TCGA LUAD -0.251; TCGA LUSC -0.547; TCGA PAAD -0.351; TCGA PRAD -0.294; TCGA THCA -0.113; TCGA STAD -0.583; TCGA UCEC -0.568
hsa-miR-19b-3p
ARPP19
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.07; TCGA CESC -0.076; TCGA COAD -0.094; TCGA ESCA -0.081; TCGA HNSC -0.084; TCGA KIRC -0.122; TCGA KIRP -0.158; TCGA LGG -0.05; TCGA LUAD -0.081; TCGA PAAD -0.205; TCGA PRAD -0.158; TCGA SARC -0.081; TCGA THCA -0.091; TCGA STAD -0.067; TCGA UCEC -0.106
hsa-miR-19b-3p
CCNT1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.226; TCGA BRCA -0.18; TCGA COAD -0.175; TCGA ESCA -0.11; TCGA HNSC -0.665; TCGA KIRC -0.351; TCGA KIRP -0.828; TCGA LGG -0.251; TCGA LUAD -0.193; TCGA PAAD -0.482; TCGA PRAD -0.631; TCGA THCA -0.275
hsa-miR-19b-3p
MAP1B
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.742; TCGA BRCA -0.124; TCGA COAD -0.611; TCGA ESCA -0.457; TCGA HNSC -0.515; TCGA LGG -0.207; TCGA LIHC -0.198; TCGA PAAD -0.599; TCGA PRAD -0.529; TCGA SARC -0.395; TCGA THCA -0.283; TCGA STAD -0.777; TCGA UCEC -0.242
hsa-miR-19b-3p
DSTYK
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.096; TCGA COAD -0.083; TCGA ESCA -0.109; TCGA HNSC -0.143; TCGA KIRC -0.165; TCGA KIRP -0.176; TCGA LGG -0.12; TCGA PAAD -0.256; TCGA PRAD -0.128; TCGA SARC -0.059; TCGA STAD -0.165; TCGA UCEC -0.118
hsa-miR-19b-3p
GIMAP6
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.35; TCGA BRCA -0.193; TCGA CESC -0.345; TCGA COAD -0.574; TCGA ESCA -0.262; TCGA HNSC -0.492; TCGA KIRP -0.246; TCGA LIHC -0.191; TCGA LUAD -0.341; TCGA LUSC -0.582; TCGA PAAD -0.416; TCGA PRAD -0.28; TCGA SARC -0.137; TCGA THCA -0.202; TCGA STAD -0.349; TCGA UCEC -0.59
hsa-miR-19b-3p
LPIN1
9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.214; TCGA HNSC -0.126; TCGA KIRC -0.142; TCGA KIRP -0.105; TCGA LGG -0.142; TCGA LIHC -0.202; TCGA PRAD -0.227; TCGA SARC -0.066; TCGA STAD -0.12
hsa-miR-19b-3p
IL6ST
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.708; TCGA BRCA -0.616; TCGA COAD -0.474; TCGA ESCA -0.312; TCGA HNSC -0.995; TCGA KIRC -0.43; TCGA KIRP -1.067; TCGA LGG -0.39; TCGA LIHC -0.377; TCGA LUAD -0.358; TCGA LUSC -0.514; TCGA PAAD -0.67; TCGA PRAD -0.813; TCGA SARC -0.424; TCGA THCA -0.416; TCGA STAD -0.366; TCGA UCEC -0.464
hsa-miR-19b-3p
NAV1
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.174; TCGA BRCA -0.125; TCGA COAD -0.301; TCGA HNSC -0.241; TCGA KIRP -0.193; TCGA LIHC -0.178; TCGA PAAD -0.188; TCGA STAD -0.106; TCGA UCEC -0.108
hsa-miR-19b-3p
SOX5
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.678; TCGA BRCA -0.267; TCGA CESC -0.308; TCGA COAD -0.471; TCGA HNSC -0.698; TCGA KIRC -0.33; TCGA KIRP -0.481; TCGA LGG -0.401; TCGA LUAD -0.275; TCGA LUSC -0.267; TCGA PAAD -0.514; TCGA PRAD -0.586; TCGA SARC -0.366; TCGA STAD -0.494
hsa-miR-19b-3p
KIAA0513
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.478; TCGA BRCA -0.168; TCGA CESC -0.177; TCGA COAD -0.294; TCGA ESCA -0.379; TCGA HNSC -0.277; TCGA KIRC -0.125; TCGA KIRP -0.137; TCGA LGG -0.201; TCGA LIHC -0.132; TCGA LUAD -0.094; TCGA LUSC -0.379; TCGA PRAD -0.252; TCGA THCA -0.098; TCGA STAD -0.388; TCGA UCEC -0.488
hsa-miR-19b-3p
RASGEF1B
9 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD
mirMAP
TCGA BLCA -0.159; TCGA HNSC -0.241; TCGA KIRC -0.157; TCGA KIRP -0.289; TCGA LIHC -0.313; TCGA LUAD -0.209; TCGA LUSC -0.33; TCGA PAAD -0.279; TCGA PRAD -0.247
hsa-miR-19b-3p
CNOT6L
11 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.065; TCGA HNSC -0.162; TCGA KIRC -0.105; TCGA KIRP -0.076; TCGA LIHC -0.104; TCGA LUAD -0.117; TCGA LUSC -0.058; TCGA PAAD -0.104; TCGA PRAD -0.116; TCGA SARC -0.102; TCGA UCEC -0.137
hsa-miR-19b-3p
SHROOM3
9 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC
mirMAP
TCGA BLCA -0.198; TCGA BRCA -0.116; TCGA KIRC -0.407; TCGA KIRP -0.303; TCGA LIHC -0.176; TCGA LUAD -0.084; TCGA LUSC -0.155; TCGA PRAD -0.061; TCGA SARC -0.417
hsa-miR-19b-3p
GLIPR1
13 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.414; TCGA CESC -0.279; TCGA COAD -0.39; TCGA HNSC -0.189; TCGA LGG -0.195; TCGA LIHC -0.217; TCGA LUAD -0.268; TCGA LUSC -0.398; TCGA PAAD -0.366; TCGA PRAD -0.337; TCGA SARC -0.181; TCGA STAD -0.245; TCGA UCEC -0.445
hsa-miR-19b-3p
SBNO1
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.15; TCGA BRCA -0.094; TCGA COAD -0.092; TCGA HNSC -0.45; TCGA KIRC -0.332; TCGA KIRP -0.678; TCGA LGG -0.176; TCGA LUAD -0.101; TCGA PAAD -0.436; TCGA PRAD -0.504; TCGA SARC -0.148; TCGA THCA -0.329
hsa-miR-19b-3p
TCF12
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.157; TCGA BRCA -0.088; TCGA HNSC -0.305; TCGA KIRC -0.121; TCGA KIRP -0.25; TCGA LUAD -0.092; TCGA LUSC -0.061; TCGA PAAD -0.249; TCGA PRAD -0.221; TCGA THCA -0.081
hsa-miR-19b-3p
ABHD2
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; UCEC
mirMAP
TCGA BLCA -0.15; TCGA BRCA -0.222; TCGA CESC -0.162; TCGA HNSC -0.299; TCGA KIRC -0.407; TCGA KIRP -0.342; TCGA LGG -0.124; TCGA LIHC -0.236; TCGA LUAD -0.127; TCGA LUSC -0.224; TCGA PAAD -0.354; TCGA THCA -0.091; TCGA UCEC -0.144
hsa-miR-19b-3p
NTRK3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.851; TCGA CESC -0.606; TCGA COAD -0.883; TCGA ESCA -0.691; TCGA HNSC -0.5; TCGA LGG -0.177; TCGA LUAD -0.287; TCGA LUSC -0.394; TCGA PRAD -0.394; TCGA SARC -0.559; TCGA STAD -0.991; TCGA UCEC -0.505
hsa-miR-19b-3p
ASXL3
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.589; TCGA BRCA -0.179; TCGA CESC -0.453; TCGA ESCA -0.45; TCGA KIRC -0.36; TCGA LIHC -0.238; TCGA LUSC -0.461; TCGA PAAD -0.447; TCGA PRAD -0.579; TCGA STAD -0.718
hsa-miR-19b-3p
ZNF660
10 cancers: BLCA; BRCA; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.319; TCGA BRCA -0.129; TCGA ESCA -0.249; TCGA KIRP -0.272; TCGA LUAD -0.186; TCGA LUSC -0.202; TCGA PAAD -0.426; TCGA PRAD -0.556; TCGA SARC -0.229; TCGA STAD -0.511
hsa-miR-19b-3p
RNF217
11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.326; TCGA CESC -0.171; TCGA ESCA -0.598; TCGA HNSC -0.256; TCGA KIRP -0.307; TCGA LGG -0.126; TCGA LIHC -0.269; TCGA PAAD -0.313; TCGA PRAD -0.296; TCGA SARC -0.161; TCGA STAD -0.623
hsa-miR-19b-3p
EIF4EBP2
9 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.075; TCGA HNSC -0.128; TCGA KIRC -0.221; TCGA KIRP -0.195; TCGA LUAD -0.077; TCGA LUSC -0.091; TCGA PAAD -0.086; TCGA PRAD -0.156; TCGA THCA -0.065
hsa-miR-19b-3p
ENDOD1
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.19; TCGA CESC -0.16; TCGA COAD -0.165; TCGA ESCA -0.33; TCGA HNSC -0.181; TCGA KIRC -0.23; TCGA KIRP -0.283; TCGA LGG -0.174; TCGA LIHC -0.343; TCGA LUAD -0.215; TCGA LUSC -0.16; TCGA PAAD -0.159; TCGA SARC -0.316; TCGA STAD -0.238; TCGA UCEC -0.225
hsa-miR-19b-3p
SCN2B
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.842; TCGA BRCA -0.579; TCGA COAD -1.216; TCGA ESCA -0.923; TCGA HNSC -0.559; TCGA KIRC -0.568; TCGA LGG -0.44; TCGA LUAD -0.512; TCGA LUSC -0.704; TCGA PAAD -0.738; TCGA PRAD -0.59; TCGA SARC -0.592; TCGA STAD -1.343; TCGA UCEC -0.632
hsa-miR-19b-3p
DLG2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.744; TCGA BRCA -0.281; TCGA CESC -0.511; TCGA COAD -0.924; TCGA ESCA -0.653; TCGA HNSC -0.433; TCGA KIRC -0.585; TCGA KIRP -0.26; TCGA LGG -0.192; TCGA LIHC -0.228; TCGA LUAD -0.188; TCGA LUSC -0.419; TCGA PAAD -0.562; TCGA STAD -1.029; TCGA UCEC -0.394
hsa-miR-19b-3p
ZNF827
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.252; TCGA BRCA -0.194; TCGA CESC -0.255; TCGA COAD -0.12; TCGA HNSC -0.603; TCGA KIRC -0.323; TCGA KIRP -0.568; TCGA LGG -0.135; TCGA LUSC -0.111; TCGA PAAD -0.304; TCGA PRAD -0.491; TCGA THCA -0.194; TCGA STAD -0.129
hsa-miR-19b-3p
UHMK1
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP; miRNATAP
TCGA BLCA -0.215; TCGA BRCA -0.225; TCGA COAD -0.181; TCGA HNSC -0.708; TCGA KIRC -0.522; TCGA KIRP -1.023; TCGA LGG -0.303; TCGA LIHC -0.307; TCGA LUAD -0.189; TCGA LUSC -0.116; TCGA PAAD -0.454; TCGA PRAD -0.661; TCGA THCA -0.396
hsa-miR-19b-3p
MR1
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.182; TCGA BRCA -0.152; TCGA CESC -0.317; TCGA COAD -0.209; TCGA ESCA -0.222; TCGA HNSC -0.146; TCGA KIRC -0.239; TCGA KIRP -0.342; TCGA LGG -0.369; TCGA LIHC -0.204; TCGA LUAD -0.202; TCGA LUSC -0.253; TCGA PAAD -0.155; TCGA PRAD -0.455; TCGA SARC -0.145; TCGA THCA -0.215; TCGA STAD -0.239; TCGA UCEC -0.114
hsa-miR-19b-3p
MMP16
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.53; TCGA BRCA -0.399; TCGA COAD -0.573; TCGA ESCA -0.293; TCGA HNSC -0.668; TCGA LIHC -0.297; TCGA LUAD -0.219; TCGA LUSC -0.362; TCGA PAAD -0.773; TCGA PRAD -0.576; TCGA STAD -0.592; TCGA UCEC -0.248
hsa-miR-19b-3p
PALM2-AKAP2
13 cancers: BLCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.375; TCGA CESC -0.211; TCGA COAD -0.301; TCGA HNSC -0.362; TCGA KIRP -0.141; TCGA LIHC -0.18; TCGA LUAD -0.207; TCGA LUSC -0.422; TCGA PAAD -0.328; TCGA PRAD -0.206; TCGA SARC -0.145; TCGA STAD -0.386; TCGA UCEC -0.43
hsa-miR-19b-3p
RAPGEF6
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.222; TCGA BRCA -0.217; TCGA HNSC -0.56; TCGA KIRC -0.185; TCGA KIRP -0.609; TCGA LGG -0.176; TCGA LUAD -0.187; TCGA LUSC -0.18; TCGA PAAD -0.409; TCGA PRAD -0.47; TCGA SARC -0.23; TCGA THCA -0.22
hsa-miR-19b-3p
PRKAA2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.447; TCGA BRCA -0.167; TCGA COAD -0.419; TCGA HNSC -0.67; TCGA KIRC -0.289; TCGA KIRP -0.276; TCGA PAAD -0.287; TCGA PRAD -0.114; TCGA SARC -0.631; TCGA THCA -0.136; TCGA STAD -1.141
hsa-miR-19b-3p
UBXN10
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.23; TCGA BRCA -0.554; TCGA HNSC -0.378; TCGA KIRC -0.169; TCGA KIRP -0.267; TCGA LGG -0.37; TCGA LIHC -0.515; TCGA LUSC -0.55; TCGA PRAD -0.659; TCGA STAD -0.497
hsa-miR-19b-3p
NFASC
14 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.61; TCGA COAD -0.308; TCGA ESCA -0.864; TCGA HNSC -0.236; TCGA KIRP -0.569; TCGA LGG -0.136; TCGA LIHC -0.19; TCGA LUAD -0.198; TCGA LUSC -0.209; TCGA PAAD -0.357; TCGA PRAD -0.4; TCGA SARC -0.932; TCGA STAD -0.945; TCGA UCEC -0.551
hsa-miR-19b-3p
DNAJB14
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.105; TCGA BRCA -0.14; TCGA CESC -0.122; TCGA COAD -0.095; TCGA HNSC -0.19; TCGA KIRC -0.217; TCGA KIRP -0.448; TCGA LGG -0.193; TCGA LIHC -0.2; TCGA LUAD -0.156; TCGA LUSC -0.084; TCGA PAAD -0.233; TCGA PRAD -0.223; TCGA SARC -0.104; TCGA THCA -0.146; TCGA UCEC -0.094
hsa-miR-19b-3p
CTSB
10 cancers: BLCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA
mirMAP
TCGA BLCA -0.157; TCGA COAD -0.283; TCGA HNSC -0.131; TCGA KIRP -0.174; TCGA LGG -0.128; TCGA LIHC -0.132; TCGA LUAD -0.118; TCGA LUSC -0.251; TCGA PRAD -0.186; TCGA THCA -0.156
hsa-miR-19b-3p
DLC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.42; TCGA BRCA -0.273; TCGA CESC -0.322; TCGA COAD -0.493; TCGA ESCA -0.273; TCGA HNSC -0.416; TCGA KIRP -0.195; TCGA LGG -0.149; TCGA LIHC -0.173; TCGA LUAD -0.228; TCGA LUSC -0.68; TCGA PAAD -0.377; TCGA PRAD -0.264; TCGA STAD -0.5; TCGA UCEC -0.371
hsa-miR-19b-3p
MARCH8
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.238; TCGA BRCA -0.203; TCGA COAD -0.151; TCGA ESCA -0.198; TCGA HNSC -0.49; TCGA KIRC -0.296; TCGA KIRP -0.593; TCGA LIHC -0.229; TCGA LUAD -0.146; TCGA LUSC -0.183; TCGA PAAD -0.364; TCGA PRAD -0.404; TCGA SARC -0.193; TCGA THCA -0.211; TCGA STAD -0.213; TCGA UCEC -0.313
hsa-miR-19b-3p
KIAA0355
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.074; TCGA BRCA -0.052; TCGA ESCA -0.116; TCGA HNSC -0.215; TCGA KIRP -0.131; TCGA LUAD -0.07; TCGA LUSC -0.07; TCGA PAAD -0.178; TCGA PRAD -0.077; TCGA STAD -0.175; TCGA UCEC -0.108
hsa-miR-19b-3p
IGF2
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.462; TCGA BRCA -0.523; TCGA CESC -0.293; TCGA COAD -0.424; TCGA HNSC -0.429; TCGA LUAD -0.268; TCGA LUSC -0.381; TCGA PRAD -0.183; TCGA STAD -0.336
hsa-miR-19b-3p
SPRYD3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.154; TCGA BRCA -0.151; TCGA COAD -0.074; TCGA ESCA -0.201; TCGA HNSC -0.071; TCGA KIRC -0.114; TCGA LGG -0.099; TCGA LUAD -0.071; TCGA LUSC -0.143; TCGA PRAD -0.064; TCGA STAD -0.156; TCGA UCEC -0.19
hsa-miR-19b-3p
AR
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.689; TCGA BRCA -1.08; TCGA CESC -0.792; TCGA COAD -0.921; TCGA ESCA -0.698; TCGA HNSC -1.13; TCGA KIRC -0.628; TCGA KIRP -0.56; TCGA LGG -0.638; TCGA LIHC -0.683; TCGA LUAD -0.27; TCGA LUSC -0.705; TCGA PAAD -0.937; TCGA PRAD -0.414; TCGA SARC -0.71; TCGA THCA -0.233; TCGA STAD -1.008; TCGA UCEC -0.358
hsa-miR-19b-3p
PLEKHA2
10 cancers: BLCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.2; TCGA CESC -0.093; TCGA HNSC -0.134; TCGA KIRP -0.077; TCGA LIHC -0.103; TCGA LUAD -0.179; TCGA LUSC -0.198; TCGA PRAD -0.38; TCGA SARC -0.185; TCGA STAD -0.142
hsa-miR-19b-3p
SGCD
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -1.106; TCGA BRCA -0.469; TCGA CESC -0.497; TCGA COAD -0.874; TCGA ESCA -0.766; TCGA HNSC -0.856; TCGA KIRC -0.321; TCGA KIRP -0.331; TCGA LIHC -0.522; TCGA LUAD -0.402; TCGA LUSC -0.621; TCGA PAAD -0.768; TCGA PRAD -0.13; TCGA SARC -0.392; TCGA STAD -0.83; TCGA UCEC -0.337
hsa-miR-19b-3p
PRKCE
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.093; TCGA CESC -0.134; TCGA HNSC -0.123; TCGA KIRC -0.336; TCGA KIRP -0.363; TCGA LIHC -0.128; TCGA LUAD -0.189; TCGA LUSC -0.239; TCGA PAAD -0.185; TCGA PRAD -0.199; TCGA STAD -0.153
hsa-miR-19b-3p
NPTX1
11 cancers: BLCA; COAD; ESCA; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.604; TCGA COAD -1.226; TCGA ESCA -0.867; TCGA KIRP -0.53; TCGA LIHC -0.254; TCGA LUSC -0.298; TCGA PAAD -0.464; TCGA PRAD -0.317; TCGA SARC -0.414; TCGA STAD -1.522; TCGA UCEC -0.278
hsa-miR-19b-3p
TLN2
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.194; TCGA BRCA -0.164; TCGA HNSC -0.241; TCGA KIRC -0.354; TCGA KIRP -0.177; TCGA LGG -0.201; TCGA LUAD -0.119; TCGA PAAD -0.234; TCGA UCEC -0.103
hsa-miR-19b-3p
IL16
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.353; TCGA BRCA -0.198; TCGA CESC -0.293; TCGA COAD -0.418; TCGA ESCA -0.297; TCGA HNSC -0.277; TCGA LUAD -0.249; TCGA LUSC -0.429; TCGA PAAD -0.3; TCGA PRAD -0.16; TCGA SARC -0.174; TCGA STAD -0.274; TCGA UCEC -0.283
hsa-miR-19b-3p
DAG1
12 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA
mirMAP; miRNATAP
TCGA BLCA -0.074; TCGA COAD -0.102; TCGA HNSC -0.193; TCGA KIRC -0.182; TCGA KIRP -0.182; TCGA LGG -0.18; TCGA LIHC -0.065; TCGA LUAD -0.055; TCGA LUSC -0.057; TCGA PRAD -0.121; TCGA SARC -0.13; TCGA THCA -0.065
hsa-miR-19b-3p
ZHX3
16 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.225; TCGA BRCA -0.125; TCGA ESCA -0.263; TCGA HNSC -0.157; TCGA KIRC -0.285; TCGA KIRP -0.151; TCGA LGG -0.229; TCGA LIHC -0.106; TCGA LUAD -0.083; TCGA LUSC -0.18; TCGA PAAD -0.264; TCGA PRAD -0.075; TCGA SARC -0.218; TCGA THCA -0.1; TCGA STAD -0.294; TCGA UCEC -0.319
hsa-miR-19b-3p
ZNF25
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.302; TCGA BRCA -0.085; TCGA CESC -0.153; TCGA COAD -0.24; TCGA ESCA -0.258; TCGA HNSC -0.153; TCGA KIRP -0.091; TCGA LIHC -0.164; TCGA LUAD -0.099; TCGA LUSC -0.113; TCGA PAAD -0.227; TCGA PRAD -0.12; TCGA SARC -0.15; TCGA STAD -0.453; TCGA UCEC -0.226
hsa-miR-19b-3p
ARL10
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.195; TCGA COAD -0.324; TCGA ESCA -0.323; TCGA HNSC -0.255; TCGA KIRP -0.272; TCGA LUAD -0.131; TCGA PAAD -0.353; TCGA PRAD -0.452; TCGA STAD -0.469
hsa-miR-19b-3p
RNF152
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.099; TCGA CESC -0.235; TCGA COAD -0.547; TCGA ESCA -0.362; TCGA HNSC -0.325; TCGA KIRC -0.521; TCGA KIRP -0.637; TCGA LIHC -0.192; TCGA LUAD -0.148; TCGA PAAD -0.406; TCGA PRAD -0.461; TCGA SARC -0.2; TCGA STAD -0.346; TCGA UCEC -0.156
hsa-miR-19b-3p
MAF
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.429; TCGA BRCA -0.127; TCGA COAD -0.516; TCGA ESCA -0.345; TCGA HNSC -0.172; TCGA KIRP -0.196; TCGA LGG -0.113; TCGA LIHC -0.101; TCGA LUAD -0.15; TCGA LUSC -0.129; TCGA PAAD -0.195; TCGA PRAD -0.103; TCGA STAD -0.327; TCGA UCEC -0.573
hsa-miR-19b-3p
KCTD12
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.498; TCGA BRCA -0.175; TCGA COAD -0.666; TCGA ESCA -0.285; TCGA HNSC -0.373; TCGA KIRC -0.179; TCGA KIRP -0.324; TCGA LGG -0.175; TCGA LIHC -0.26; TCGA LUAD -0.346; TCGA LUSC -0.396; TCGA PAAD -0.335; TCGA PRAD -0.231; TCGA STAD -0.352; TCGA UCEC -0.46
hsa-miR-19b-3p
PTPN11
11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.134; TCGA HNSC -0.143; TCGA KIRC -0.132; TCGA KIRP -0.232; TCGA LGG -0.14; TCGA LIHC -0.058; TCGA PAAD -0.207; TCGA PRAD -0.21; TCGA SARC -0.128; TCGA THCA -0.167; TCGA UCEC -0.099
hsa-miR-19b-3p
WSCD1
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.385; TCGA BRCA -0.374; TCGA ESCA -0.296; TCGA HNSC -0.309; TCGA LUAD -0.137; TCGA LUSC -0.33; TCGA PRAD -0.094; TCGA STAD -0.388; TCGA UCEC -0.43
hsa-miR-19b-3p
SLITRK4
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.568; TCGA BRCA -0.167; TCGA CESC -0.694; TCGA ESCA -0.567; TCGA HNSC -0.824; TCGA LUAD -0.282; TCGA LUSC -0.47; TCGA PAAD -0.607; TCGA PRAD -0.393; TCGA THCA -0.281; TCGA STAD -0.673
hsa-miR-19b-3p
C5orf24
13 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.065; TCGA COAD -0.079; TCGA HNSC -0.137; TCGA KIRP -0.193; TCGA LIHC -0.073; TCGA LUAD -0.099; TCGA PAAD -0.217; TCGA PRAD -0.156; TCGA SARC -0.185; TCGA THCA -0.071; TCGA STAD -0.123; TCGA UCEC -0.105
hsa-miR-19b-3p
CHST15
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.356; TCGA BRCA -0.363; TCGA COAD -0.516; TCGA HNSC -0.305; TCGA KIRP -0.215; TCGA LGG -0.307; TCGA LIHC -0.235; TCGA LUSC -0.194; TCGA PRAD -0.472; TCGA STAD -0.472; TCGA UCEC -0.139
hsa-miR-19b-3p
FBXL7
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.724; TCGA BRCA -0.427; TCGA CESC -0.463; TCGA COAD -0.575; TCGA ESCA -0.43; TCGA HNSC -0.453; TCGA LGG -0.099; TCGA LUAD -0.196; TCGA LUSC -0.441; TCGA PAAD -0.363; TCGA PRAD -0.192; TCGA SARC -0.198; TCGA STAD -0.654; TCGA UCEC -0.479
hsa-miR-19b-3p
BTBD9
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.055; TCGA BRCA -0.065; TCGA CESC -0.151; TCGA HNSC -0.139; TCGA KIRC -0.227; TCGA KIRP -0.107; TCGA LGG -0.069; TCGA LUSC -0.189; TCGA PAAD -0.095; TCGA THCA -0.057; TCGA STAD -0.08; TCGA UCEC -0.058
hsa-miR-19b-3p
ATL3
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.091; TCGA BRCA -0.063; TCGA COAD -0.216; TCGA ESCA -0.252; TCGA HNSC -0.194; TCGA KIRP -0.25; TCGA LGG -0.188; TCGA LIHC -0.191; TCGA LUAD -0.186; TCGA LUSC -0.195; TCGA PAAD -0.343; TCGA PRAD -0.221; TCGA THCA -0.26; TCGA STAD -0.229
hsa-miR-19b-3p
SV2B
11 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.557; TCGA COAD -1.019; TCGA ESCA -0.443; TCGA HNSC -0.503; TCGA LGG -0.449; TCGA LUAD -0.305; TCGA PAAD -0.407; TCGA PRAD -0.466; TCGA SARC -0.192; TCGA STAD -0.555; TCGA UCEC -0.458
hsa-miR-19b-3p
OLFML2A
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.28; TCGA BRCA -0.213; TCGA COAD -0.288; TCGA ESCA -0.183; TCGA HNSC -0.156; TCGA LUAD -0.134; TCGA LUSC -0.242; TCGA PRAD -0.357; TCGA STAD -0.364; TCGA UCEC -0.495
hsa-miR-19b-3p
IKZF1
12 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.311; TCGA CESC -0.31; TCGA COAD -0.662; TCGA HNSC -0.446; TCGA LGG -0.142; TCGA LIHC -0.14; TCGA LUAD -0.252; TCGA LUSC -0.385; TCGA PAAD -0.285; TCGA PRAD -0.204; TCGA STAD -0.162; TCGA UCEC -0.223
hsa-miR-19b-3p
TEAD1
15 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.293; TCGA BRCA -0.089; TCGA COAD -0.08; TCGA HNSC -0.259; TCGA KIRC -0.136; TCGA KIRP -0.279; TCGA LGG -0.111; TCGA LIHC -0.114; TCGA LUAD -0.063; TCGA PAAD -0.313; TCGA PRAD -0.384; TCGA SARC -0.156; TCGA THCA -0.121; TCGA STAD -0.423; TCGA UCEC -0.151
hsa-miR-19b-3p
ZC3H6
10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.173; TCGA BRCA -0.102; TCGA CESC -0.157; TCGA HNSC -0.161; TCGA LGG -0.065; TCGA LIHC -0.158; TCGA PRAD -0.104; TCGA SARC -0.146; TCGA STAD -0.279; TCGA UCEC -0.138
hsa-miR-19b-3p
AFAP1
11 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.266; TCGA COAD -0.082; TCGA HNSC -0.29; TCGA KIRP -0.254; TCGA LUAD -0.103; TCGA LUSC -0.094; TCGA PAAD -0.163; TCGA PRAD -0.22; TCGA SARC -0.155; TCGA STAD -0.265; TCGA UCEC -0.304
hsa-miR-19b-3p
NHLRC2
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.123; TCGA COAD -0.149; TCGA HNSC -0.332; TCGA KIRC -0.349; TCGA KIRP -0.646; TCGA LGG -0.21; TCGA LIHC -0.186; TCGA LUAD -0.107; TCGA PAAD -0.315; TCGA PRAD -0.342; TCGA THCA -0.232
hsa-miR-19b-3p
DDI2
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.197; TCGA BRCA -0.189; TCGA HNSC -0.652; TCGA KIRC -0.361; TCGA KIRP -0.926; TCGA LGG -0.17; TCGA LIHC -0.266; TCGA LUAD -0.084; TCGA LUSC -0.095; TCGA PAAD -0.525; TCGA PRAD -0.517; TCGA THCA -0.414
hsa-miR-19b-3p
ADARB1
9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.419; TCGA COAD -0.262; TCGA ESCA -0.273; TCGA LIHC -0.069; TCGA LUAD -0.133; TCGA LUSC -0.267; TCGA PAAD -0.153; TCGA STAD -0.446; TCGA UCEC -0.204
hsa-miR-19b-3p
MYO5A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.239; TCGA BRCA -0.091; TCGA CESC -0.177; TCGA COAD -0.602; TCGA ESCA -0.355; TCGA HNSC -0.237; TCGA KIRP -0.294; TCGA LIHC -0.148; TCGA LUAD -0.163; TCGA LUSC -0.139; TCGA PAAD -0.364; TCGA PRAD -0.197; TCGA THCA -0.15; TCGA STAD -0.324; TCGA UCEC -0.224
hsa-miR-19b-3p
PEG3
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.867; TCGA CESC -0.613; TCGA COAD -0.867; TCGA ESCA -0.686; TCGA HNSC -0.753; TCGA KIRC -0.502; TCGA KIRP -0.566; TCGA LGG -0.213; TCGA LUAD -0.287; TCGA LUSC -0.674; TCGA PAAD -0.649; TCGA PRAD -0.413; TCGA THCA -0.133; TCGA STAD -1.03; TCGA UCEC -0.872
hsa-miR-19b-3p
MBD5
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.234; TCGA BRCA -0.087; TCGA CESC -0.105; TCGA HNSC -0.232; TCGA KIRC -0.117; TCGA KIRP -0.218; TCGA LGG -0.077; TCGA LUSC -0.18; TCGA PAAD -0.273; TCGA PRAD -0.236; TCGA SARC -0.089; TCGA THCA -0.059; TCGA STAD -0.254
hsa-miR-19b-3p
TMEM231
10 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.071; TCGA KIRC -0.143; TCGA KIRP -0.176; TCGA LGG -0.157; TCGA LIHC -0.34; TCGA LUAD -0.144; TCGA LUSC -0.135; TCGA PAAD -0.141; TCGA PRAD -0.139; TCGA STAD -0.103
hsa-miR-19b-3p
ITSN1
11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.135; TCGA COAD -0.176; TCGA HNSC -0.16; TCGA LGG -0.1; TCGA LUSC -0.094; TCGA PAAD -0.251; TCGA PRAD -0.235; TCGA SARC -0.077; TCGA STAD -0.157; TCGA UCEC -0.064
hsa-miR-19b-3p
DOK6
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.896; TCGA BRCA -0.347; TCGA CESC -0.491; TCGA COAD -0.567; TCGA ESCA -0.253; TCGA HNSC -0.603; TCGA KIRP -0.331; TCGA LUAD -0.209; TCGA LUSC -0.425; TCGA PAAD -0.628; TCGA PRAD -0.421; TCGA STAD -0.581; TCGA UCEC -0.325
hsa-miR-19b-3p
VGLL3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.287; TCGA BRCA -0.228; TCGA CESC -0.349; TCGA COAD -0.843; TCGA ESCA -0.348; TCGA HNSC -0.603; TCGA KIRP -0.468; TCGA LIHC -0.296; TCGA LUAD -0.325; TCGA LUSC -0.698; TCGA PAAD -0.563; TCGA PRAD -0.233; TCGA SARC -0.495; TCGA STAD -0.555; TCGA UCEC -0.721
hsa-miR-19b-3p
DDX3X
12 cancers: BLCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.105; TCGA CESC -0.066; TCGA HNSC -0.143; TCGA KIRP -0.234; TCGA LGG -0.127; TCGA LIHC -0.093; TCGA LUAD -0.071; TCGA LUSC -0.06; TCGA PAAD -0.181; TCGA PRAD -0.143; TCGA THCA -0.058; TCGA UCEC -0.092
hsa-miR-19b-3p
NPTXR
11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.362; TCGA BRCA -0.142; TCGA COAD -0.527; TCGA HNSC -0.349; TCGA LGG -0.174; TCGA LIHC -0.271; TCGA LUAD -0.274; TCGA PAAD -0.269; TCGA SARC -0.368; TCGA STAD -0.79; TCGA UCEC -0.257
hsa-miR-19b-3p
AKAP2
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.786; TCGA BRCA -0.116; TCGA CESC -0.424; TCGA COAD -0.448; TCGA HNSC -0.942; TCGA KIRC -0.26; TCGA KIRP -0.882; TCGA LGG -0.287; TCGA LIHC -0.275; TCGA LUAD -0.347; TCGA LUSC -0.621; TCGA PAAD -0.581; TCGA PRAD -0.747; TCGA SARC -0.394; TCGA THCA -0.21; TCGA UCEC -0.675
hsa-miR-19b-3p
MECP2
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.054; TCGA ESCA -0.087; TCGA HNSC -0.097; TCGA KIRC -0.124; TCGA KIRP -0.106; TCGA LGG -0.071; TCGA PRAD -0.132; TCGA SARC -0.126; TCGA STAD -0.198; TCGA UCEC -0.139
hsa-miR-19b-3p
PPP1R12A
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.32; TCGA CESC -0.14; TCGA COAD -0.164; TCGA ESCA -0.155; TCGA HNSC -0.144; TCGA KIRP -0.16; TCGA LUAD -0.075; TCGA PAAD -0.203; TCGA PRAD -0.284; TCGA SARC -0.295; TCGA STAD -0.274; TCGA UCEC -0.202
hsa-miR-19b-3p
FAM179B
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.179; TCGA CESC -0.164; TCGA HNSC -0.201; TCGA KIRC -0.126; TCGA KIRP -0.239; TCGA LGG -0.107; TCGA LIHC -0.091; TCGA PAAD -0.194; TCGA PRAD -0.19; TCGA STAD -0.125; TCGA UCEC -0.141
hsa-miR-19b-3p
LIMCH1
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.295; TCGA BRCA -0.236; TCGA CESC -0.345; TCGA COAD -0.42; TCGA ESCA -0.344; TCGA HNSC -0.608; TCGA KIRC -0.344; TCGA KIRP -0.382; TCGA LGG -0.266; TCGA LIHC -0.409; TCGA LUAD -0.148; TCGA LUSC -0.49; TCGA PAAD -0.174; TCGA PRAD -0.207; TCGA SARC -0.361; TCGA THCA -0.088; TCGA STAD -0.303; TCGA UCEC -0.133
hsa-miR-19b-3p
ATXN1L
13 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.122; TCGA ESCA -0.101; TCGA HNSC -0.285; TCGA KIRC -0.2; TCGA KIRP -0.285; TCGA LIHC -0.135; TCGA LUAD -0.102; TCGA LUSC -0.095; TCGA PAAD -0.208; TCGA PRAD -0.262; TCGA THCA -0.096; TCGA STAD -0.154; TCGA UCEC -0.168
hsa-miR-19b-3p
NFIA
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.412; TCGA BRCA -0.254; TCGA CESC -0.202; TCGA ESCA -0.235; TCGA HNSC -0.111; TCGA LIHC -0.206; TCGA LUSC -0.136; TCGA PAAD -0.149; TCGA PRAD -0.094; TCGA SARC -0.261; TCGA STAD -0.421
hsa-miR-19b-3p
ZNF831
9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PRAD; UCEC
miRNATAP
TCGA BLCA -0.403; TCGA CESC -0.358; TCGA COAD -0.666; TCGA HNSC -0.503; TCGA LGG -0.256; TCGA LUAD -0.124; TCGA LUSC -0.431; TCGA PRAD -0.23; TCGA UCEC -0.214
hsa-miR-19b-3p
ZNF704
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.287; TCGA BRCA -0.201; TCGA CESC -0.411; TCGA HNSC -0.732; TCGA KIRC -0.244; TCGA KIRP -0.624; TCGA LIHC -0.182; TCGA PAAD -0.547; TCGA PRAD -0.372; TCGA SARC -0.286; TCGA THCA -0.194; TCGA STAD -0.322
hsa-miR-19b-3p
NFIC
17 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.376; TCGA BRCA -0.221; TCGA COAD -0.337; TCGA ESCA -0.328; TCGA HNSC -0.615; TCGA KIRC -0.261; TCGA KIRP -0.619; TCGA LGG -0.233; TCGA LIHC -0.186; TCGA LUAD -0.19; TCGA LUSC -0.21; TCGA PAAD -0.252; TCGA PRAD -0.322; TCGA SARC -0.313; TCGA THCA -0.21; TCGA STAD -0.347; TCGA UCEC -0.253
hsa-miR-19b-3p
PTPRD
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.826; TCGA BRCA -0.262; TCGA CESC -0.54; TCGA ESCA -0.504; TCGA HNSC -0.495; TCGA KIRP -0.433; TCGA LGG -0.312; TCGA LIHC -0.56; TCGA LUAD -0.271; TCGA LUSC -0.395; TCGA PAAD -0.456; TCGA PRAD -0.335; TCGA STAD -0.431; TCGA UCEC -0.49
hsa-miR-19b-3p
KLF13
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.169; TCGA ESCA -0.128; TCGA HNSC -0.229; TCGA KIRC -0.136; TCGA KIRP -0.184; TCGA LUAD -0.139; TCGA LUSC -0.202; TCGA PAAD -0.202; TCGA PRAD -0.304; TCGA UCEC -0.142
hsa-miR-19b-3p
PGM2L1
9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LIHC; PAAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.315; TCGA CESC -0.257; TCGA COAD -0.28; TCGA HNSC -0.295; TCGA KIRP -0.286; TCGA LIHC -0.116; TCGA PAAD -0.241; TCGA THCA -0.095; TCGA UCEC -0.107
hsa-miR-19b-3p
CAST
15 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.177; TCGA BRCA -0.077; TCGA ESCA -0.164; TCGA HNSC -0.119; TCGA KIRP -0.129; TCGA LGG -0.123; TCGA LIHC -0.159; TCGA LUAD -0.153; TCGA LUSC -0.186; TCGA PAAD -0.099; TCGA PRAD -0.178; TCGA SARC -0.152; TCGA THCA -0.082; TCGA STAD -0.172; TCGA UCEC -0.2
hsa-miR-19b-3p
EBF1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.644; TCGA BRCA -0.3; TCGA CESC -0.441; TCGA COAD -0.486; TCGA ESCA -0.251; TCGA HNSC -0.406; TCGA KIRP -0.338; TCGA LUAD -0.178; TCGA LUSC -0.513; TCGA PAAD -0.296; TCGA PRAD -0.252; TCGA SARC -0.124; TCGA STAD -0.454; TCGA UCEC -0.441
hsa-miR-19b-3p
ARID5B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.381; TCGA BRCA -0.087; TCGA CESC -0.132; TCGA COAD -0.127; TCGA ESCA -0.177; TCGA HNSC -0.302; TCGA KIRP -0.287; TCGA LGG -0.093; TCGA LUAD -0.11; TCGA LUSC -0.144; TCGA PAAD -0.308; TCGA PRAD -0.149; TCGA SARC -0.257; TCGA STAD -0.103; TCGA UCEC -0.281
hsa-miR-19b-3p
RAI2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.722; TCGA BRCA -0.495; TCGA CESC -0.401; TCGA COAD -0.299; TCGA ESCA -0.484; TCGA HNSC -0.627; TCGA KIRC -0.303; TCGA LIHC -0.367; TCGA LUAD -0.32; TCGA LUSC -0.568; TCGA PAAD -0.387; TCGA PRAD -0.251; TCGA SARC -0.361; TCGA STAD -0.662
hsa-miR-19b-3p
C3orf70
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.46; TCGA BRCA -0.107; TCGA COAD -0.336; TCGA ESCA -0.301; TCGA HNSC -0.345; TCGA KIRP -0.296; TCGA LGG -0.168; TCGA LUAD -0.166; TCGA PAAD -0.299; TCGA PRAD -0.513; TCGA SARC -0.597; TCGA THCA -0.224; TCGA STAD -0.777; TCGA UCEC -0.856
hsa-miR-19b-3p
PLXNA4
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.693; TCGA BRCA -0.237; TCGA CESC -0.357; TCGA COAD -0.941; TCGA ESCA -0.734; TCGA HNSC -0.621; TCGA KIRP -0.496; TCGA LGG -0.48; TCGA LIHC -0.363; TCGA LUAD -0.25; TCGA LUSC -0.572; TCGA PAAD -0.615; TCGA PRAD -0.426; TCGA SARC -0.796; TCGA THCA -0.293; TCGA STAD -0.735
hsa-miR-19b-3p
DOCK10
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.292; TCGA BRCA -0.171; TCGA CESC -0.32; TCGA COAD -0.624; TCGA ESCA -0.232; TCGA HNSC -0.399; TCGA KIRP -0.259; TCGA LIHC -0.161; TCGA LUAD -0.211; TCGA LUSC -0.418; TCGA PAAD -0.406; TCGA PRAD -0.35; TCGA THCA -0.165; TCGA STAD -0.16; TCGA UCEC -0.276
hsa-miR-19b-3p
MBNL2
11 cancers: BLCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.23; TCGA HNSC -0.237; TCGA LGG -0.077; TCGA LIHC -0.214; TCGA LUAD -0.142; TCGA LUSC -0.197; TCGA PAAD -0.234; TCGA PRAD -0.422; TCGA SARC -0.149; TCGA STAD -0.162; TCGA UCEC -0.17
hsa-miR-19b-3p
PLXNC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.607; TCGA BRCA -0.417; TCGA CESC -0.491; TCGA COAD -0.895; TCGA ESCA -0.423; TCGA HNSC -1.026; TCGA KIRP -0.691; TCGA LGG -0.474; TCGA LUAD -0.378; TCGA LUSC -0.722; TCGA PAAD -0.723; TCGA PRAD -0.784; TCGA SARC -0.225; TCGA STAD -0.211; TCGA UCEC -0.426
hsa-miR-19b-3p
ZDHHC15
16 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.591; TCGA CESC -0.708; TCGA COAD -0.747; TCGA ESCA -0.708; TCGA HNSC -0.548; TCGA KIRC -0.565; TCGA KIRP -0.37; TCGA LGG -0.064; TCGA LIHC -0.254; TCGA LUAD -0.339; TCGA LUSC -0.371; TCGA PAAD -0.496; TCGA PRAD -0.522; TCGA THCA -0.058; TCGA STAD -0.829; TCGA UCEC -0.38
hsa-miR-19b-3p
OSBPL6
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.353; TCGA BRCA -0.238; TCGA COAD -0.614; TCGA ESCA -0.43; TCGA KIRP -0.45; TCGA LGG -0.294; TCGA PAAD -0.397; TCGA PRAD -0.105; TCGA THCA -0.232; TCGA STAD -0.507
hsa-miR-19b-3p
ZNF800
11 cancers: BLCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.059; TCGA HNSC -0.162; TCGA KIRP -0.234; TCGA LGG -0.095; TCGA LIHC -0.142; TCGA LUAD -0.12; TCGA PAAD -0.122; TCGA PRAD -0.158; TCGA SARC -0.084; TCGA THCA -0.061; TCGA UCEC -0.141
hsa-miR-19b-3p
ZEB2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.571; TCGA BRCA -0.222; TCGA CESC -0.382; TCGA COAD -0.633; TCGA ESCA -0.347; TCGA HNSC -0.548; TCGA KIRP -0.197; TCGA LIHC -0.235; TCGA LUAD -0.305; TCGA LUSC -0.553; TCGA PAAD -0.446; TCGA PRAD -0.452; TCGA SARC -0.231; TCGA THCA -0.092; TCGA STAD -0.448; TCGA UCEC -0.441
hsa-miR-19b-3p
MEF2C
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.517; TCGA BRCA -0.133; TCGA CESC -0.342; TCGA COAD -0.495; TCGA ESCA -0.268; TCGA HNSC -0.569; TCGA KIRP -0.145; TCGA LGG -0.146; TCGA LIHC -0.126; TCGA LUAD -0.261; TCGA LUSC -0.505; TCGA PAAD -0.308; TCGA PRAD -0.315; TCGA SARC -0.201; TCGA STAD -0.461; TCGA UCEC -0.531
hsa-miR-19b-3p
FBXO32
11 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.385; TCGA COAD -0.433; TCGA ESCA -0.52; TCGA HNSC -0.231; TCGA LGG -0.128; TCGA LIHC -0.239; TCGA PRAD -0.251; TCGA SARC -0.528; TCGA THCA -0.125; TCGA STAD -0.814; TCGA UCEC -0.593
hsa-miR-19b-3p
ZFPM2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.969; TCGA BRCA -0.4; TCGA CESC -0.348; TCGA COAD -0.817; TCGA ESCA -0.611; TCGA HNSC -0.583; TCGA KIRP -0.398; TCGA LGG -0.243; TCGA LIHC -0.347; TCGA LUAD -0.369; TCGA LUSC -0.605; TCGA PAAD -0.581; TCGA PRAD -0.489; TCGA SARC -0.46; TCGA STAD -0.834; TCGA UCEC -0.731
hsa-miR-19b-3p
DIP2C
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.213; TCGA BRCA -0.102; TCGA COAD -0.359; TCGA ESCA -0.347; TCGA HNSC -0.294; TCGA KIRC -0.214; TCGA KIRP -0.235; TCGA LIHC -0.172; TCGA LUSC -0.119; TCGA PAAD -0.339; TCGA PRAD -0.196; TCGA SARC -0.203; TCGA THCA -0.183; TCGA STAD -0.49; TCGA UCEC -0.216
hsa-miR-19b-3p
FNDC3B
9 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
miRNATAP
TCGA BLCA -0.157; TCGA COAD -0.104; TCGA HNSC -0.322; TCGA KIRP -0.301; TCGA LUAD -0.124; TCGA LUSC -0.155; TCGA PAAD -0.274; TCGA PRAD -0.272; TCGA THCA -0.076
hsa-miR-19b-3p
SCN1B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.597; TCGA BRCA -0.338; TCGA CESC -0.329; TCGA COAD -0.539; TCGA ESCA -0.429; TCGA HNSC -0.378; TCGA LIHC -0.173; TCGA LUSC -0.283; TCGA SARC -0.43; TCGA STAD -0.461; TCGA UCEC -0.299
hsa-miR-19b-3p
THSD7A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.55; TCGA BRCA -0.339; TCGA CESC -0.552; TCGA COAD -0.885; TCGA ESCA -0.411; TCGA HNSC -0.732; TCGA KIRC -0.69; TCGA KIRP -0.721; TCGA LGG -0.362; TCGA LUAD -0.186; TCGA LUSC -0.451; TCGA PAAD -0.601; TCGA PRAD -0.296; TCGA STAD -0.475; TCGA UCEC -0.298
hsa-miR-19b-3p
KIF1B
10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.089; TCGA HNSC -0.234; TCGA KIRC -0.104; TCGA KIRP -0.224; TCGA LGG -0.105; TCGA LIHC -0.073; TCGA PAAD -0.228; TCGA PRAD -0.129; TCGA THCA -0.103; TCGA STAD -0.144
hsa-miR-19b-3p
PLCB1
10 cancers: BLCA; CESC; HNSC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.278; TCGA CESC -0.295; TCGA HNSC -0.382; TCGA KIRP -0.314; TCGA LGG -0.165; TCGA PAAD -0.413; TCGA PRAD -0.287; TCGA SARC -0.264; TCGA THCA -0.152; TCGA STAD -0.294
hsa-miR-19b-3p
CYLD
17 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.206; TCGA CESC -0.106; TCGA COAD -0.156; TCGA ESCA -0.182; TCGA HNSC -0.218; TCGA KIRC -0.08; TCGA KIRP -0.171; TCGA LGG -0.156; TCGA LIHC -0.166; TCGA LUAD -0.147; TCGA LUSC -0.206; TCGA PAAD -0.154; TCGA PRAD -0.199; TCGA SARC -0.077; TCGA THCA -0.092; TCGA STAD -0.177; TCGA UCEC -0.201
hsa-miR-19b-3p
PRDM1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.086; TCGA CESC -0.218; TCGA COAD -0.269; TCGA HNSC -0.166; TCGA KIRP -0.176; TCGA LGG -0.101; TCGA LIHC -0.13; TCGA LUAD -0.154; TCGA LUSC -0.289; TCGA PAAD -0.191; TCGA PRAD -0.262; TCGA UCEC -0.365
hsa-miR-19b-3p
CD164
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC
miRNATAP
TCGA BLCA -0.054; TCGA BRCA -0.092; TCGA CESC -0.126; TCGA HNSC -0.11; TCGA KIRC -0.139; TCGA KIRP -0.179; TCGA LGG -0.092; TCGA LUAD -0.151; TCGA LUSC -0.084
hsa-miR-19b-3p
JAM2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.738; TCGA BRCA -0.297; TCGA CESC -0.608; TCGA COAD -0.947; TCGA ESCA -0.604; TCGA HNSC -0.526; TCGA LGG -0.258; TCGA LIHC -0.205; TCGA LUAD -0.281; TCGA LUSC -0.595; TCGA PAAD -0.435; TCGA PRAD -0.263; TCGA THCA -0.168; TCGA STAD -0.846; TCGA UCEC -0.608
hsa-miR-19b-3p
PCGF5
11 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.146; TCGA HNSC -0.161; TCGA KIRC -0.162; TCGA KIRP -0.298; TCGA LGG -0.12; TCGA LUAD -0.176; TCGA LUSC -0.118; TCGA PAAD -0.165; TCGA PRAD -0.189; TCGA SARC -0.146; TCGA UCEC -0.072
hsa-miR-19b-3p
PPP1R3C
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.255; TCGA BRCA -0.624; TCGA COAD -0.797; TCGA ESCA -0.533; TCGA HNSC -0.544; TCGA KIRP -0.172; TCGA LGG -0.31; TCGA LUAD -0.192; TCGA LUSC -0.425; TCGA PAAD -0.452; TCGA PRAD -0.439; TCGA SARC -0.515; TCGA THCA -0.349; TCGA STAD -1.116; TCGA UCEC -0.624
hsa-miR-19b-3p
C20orf194
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.21; TCGA BRCA -0.103; TCGA CESC -0.259; TCGA COAD -0.75; TCGA ESCA -0.319; TCGA HNSC -0.125; TCGA KIRC -0.108; TCGA LGG -0.172; TCGA LUSC -0.145; TCGA PAAD -0.181; TCGA PRAD -0.385; TCGA SARC -0.119; TCGA THCA -0.096; TCGA STAD -0.559; TCGA UCEC -0.263
hsa-miR-19b-3p
RTN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRNATAP
TCGA BLCA -0.25; TCGA BRCA -0.327; TCGA CESC -0.259; TCGA COAD -0.739; TCGA ESCA -0.399; TCGA HNSC -0.436; TCGA KIRP -0.193; TCGA LGG -0.253; TCGA LIHC -0.17; TCGA LUAD -0.332; TCGA LUSC -0.559; TCGA PAAD -0.338; TCGA SARC -0.276; TCGA STAD -0.485
hsa-miR-19b-3p
RIN2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.179; TCGA COAD -0.112; TCGA HNSC -0.151; TCGA KIRC -0.149; TCGA KIRP -0.191; TCGA LIHC -0.157; TCGA LUAD -0.177; TCGA LUSC -0.294; TCGA PAAD -0.203; TCGA PRAD -0.21; TCGA THCA -0.069; TCGA UCEC -0.107
hsa-miR-19b-3p
ITPRIPL2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.204; TCGA COAD -0.077; TCGA ESCA -0.107; TCGA HNSC -0.201; TCGA LUAD -0.074; TCGA LUSC -0.208; TCGA PAAD -0.135; TCGA PRAD -0.115; TCGA THCA -0.082; TCGA STAD -0.172; TCGA UCEC -0.139
hsa-miR-19b-3p
ADCY9
16 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.37; TCGA BRCA -0.289; TCGA COAD -0.166; TCGA ESCA -0.315; TCGA HNSC -0.287; TCGA KIRC -0.147; TCGA KIRP -0.221; TCGA LIHC -0.104; TCGA LUAD -0.177; TCGA LUSC -0.276; TCGA PAAD -0.167; TCGA PRAD -0.224; TCGA SARC -0.338; TCGA THCA -0.167; TCGA STAD -0.376; TCGA UCEC -0.301
hsa-miR-19b-3p
TMEM47
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.522; TCGA BRCA -0.108; TCGA CESC -0.486; TCGA COAD -0.566; TCGA ESCA -0.572; TCGA HNSC -0.535; TCGA KIRC -0.208; TCGA KIRP -0.313; TCGA LGG -0.418; TCGA LIHC -0.5; TCGA LUAD -0.291; TCGA LUSC -0.505; TCGA PAAD -0.378; TCGA PRAD -0.342; TCGA SARC -0.592; TCGA THCA -0.116; TCGA STAD -0.724; TCGA UCEC -0.537
hsa-miR-19b-3p
ITPKB
10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.261; TCGA COAD -0.182; TCGA ESCA -0.411; TCGA HNSC -0.162; TCGA LGG -0.317; TCGA LIHC -0.096; TCGA PRAD -0.084; TCGA SARC -0.148; TCGA STAD -0.534; TCGA UCEC -0.365
hsa-miR-19b-3p
PARM1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.423; TCGA BRCA -0.229; TCGA CESC -0.354; TCGA HNSC -0.349; TCGA KIRC -0.271; TCGA KIRP -0.474; TCGA LGG -0.268; TCGA LUSC -0.378; TCGA PRAD -0.384; TCGA SARC -0.644; TCGA THCA -0.246; TCGA STAD -0.364; TCGA UCEC -0.41
hsa-miR-19b-3p
FLNC
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.31; TCGA BRCA -0.372; TCGA COAD -0.881; TCGA ESCA -1.04; TCGA HNSC -0.607; TCGA LUAD -0.173; TCGA LUSC -0.439; TCGA PAAD -0.373; TCGA PRAD -0.589; TCGA SARC -0.433; TCGA STAD -1.404; TCGA UCEC -0.8
hsa-miR-19b-3p
CDC73
9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC
miRNATAP
TCGA BLCA -0.114; TCGA COAD -0.08; TCGA HNSC -0.09; TCGA KIRP -0.259; TCGA LGG -0.069; TCGA LIHC -0.053; TCGA PAAD -0.144; TCGA PRAD -0.167; TCGA SARC -0.104
hsa-miR-19b-3p
SCN4B
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.541; TCGA BRCA -0.364; TCGA COAD -0.651; TCGA ESCA -0.493; TCGA HNSC -0.292; TCGA LGG -0.307; TCGA LUAD -0.368; TCGA LUSC -0.36; TCGA PAAD -0.522; TCGA PRAD -0.306; TCGA SARC -0.325; TCGA THCA -0.182; TCGA STAD -0.781; TCGA UCEC -0.657
hsa-miR-19b-3p
DKK3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.336; TCGA BRCA -0.298; TCGA CESC -0.248; TCGA COAD -0.514; TCGA ESCA -0.196; TCGA HNSC -0.285; TCGA KIRP -0.302; TCGA LGG -0.285; TCGA LIHC -0.292; TCGA LUAD -0.352; TCGA LUSC -0.339; TCGA PAAD -0.486; TCGA PRAD -0.354; TCGA THCA -0.093; TCGA STAD -0.466; TCGA UCEC -0.258
hsa-miR-19b-3p
CCDC88A
10 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.211; TCGA COAD -0.656; TCGA HNSC -0.209; TCGA KIRP -0.126; TCGA LUAD -0.119; TCGA LUSC -0.096; TCGA PAAD -0.296; TCGA PRAD -0.371; TCGA THCA -0.107; TCGA STAD -0.208
hsa-miR-19b-3p
LRCH2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.595; TCGA BRCA -0.225; TCGA CESC -0.593; TCGA COAD -0.87; TCGA ESCA -0.449; TCGA HNSC -0.477; TCGA KIRP -0.395; TCGA LUAD -0.214; TCGA LUSC -0.407; TCGA PAAD -0.611; TCGA PRAD -0.483; TCGA STAD -0.725; TCGA UCEC -0.352
hsa-miR-19b-3p
ZFP91
13 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.075; TCGA COAD -0.079; TCGA HNSC -0.142; TCGA KIRC -0.148; TCGA KIRP -0.281; TCGA LGG -0.088; TCGA LIHC -0.1; TCGA LUAD -0.086; TCGA PAAD -0.21; TCGA PRAD -0.177; TCGA SARC -0.087; TCGA THCA -0.133; TCGA UCEC -0.08
hsa-miR-19b-3p
SMOC2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.007; TCGA BRCA -0.434; TCGA CESC -0.51; TCGA ESCA -0.537; TCGA HNSC -0.486; TCGA KIRP -0.284; TCGA LUAD -0.292; TCGA LUSC -0.267; TCGA PAAD -0.696; TCGA SARC -0.702; TCGA STAD -1.031; TCGA UCEC -0.678
hsa-miR-19b-3p
MIB1
9 cancers: BLCA; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.066; TCGA COAD -0.142; TCGA HNSC -0.177; TCGA KIRC -0.132; TCGA KIRP -0.299; TCGA PAAD -0.22; TCGA PRAD -0.188; TCGA THCA -0.062; TCGA UCEC -0.111
hsa-miR-19b-3p
DAAM1
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.248; TCGA BRCA -0.17; TCGA CESC -0.185; TCGA COAD -0.22; TCGA ESCA -0.306; TCGA HNSC -0.245; TCGA KIRC -0.291; TCGA KIRP -0.432; TCGA LGG -0.28; TCGA LIHC -0.251; TCGA LUAD -0.138; TCGA LUSC -0.213; TCGA PAAD -0.358; TCGA PRAD -0.34; TCGA SARC -0.312; TCGA THCA -0.192; TCGA STAD -0.223; TCGA UCEC -0.13
hsa-miR-19b-3p
REST
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
miRNATAP
TCGA BLCA -0.235; TCGA BRCA -0.186; TCGA COAD -0.131; TCGA HNSC -0.652; TCGA KIRC -0.423; TCGA KIRP -0.754; TCGA LUAD -0.166; TCGA LUSC -0.115; TCGA PAAD -0.427; TCGA PRAD -0.513; TCGA THCA -0.269
hsa-miR-19b-3p
WDR1
9 cancers: BLCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.087; TCGA HNSC -0.061; TCGA KIRP -0.058; TCGA LUAD -0.052; TCGA LUSC -0.113; TCGA PRAD -0.131; TCGA SARC -0.251; TCGA THCA -0.05; TCGA UCEC -0.109
hsa-miR-19b-3p
ARHGAP5
13 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.186; TCGA CESC -0.106; TCGA HNSC -0.199; TCGA KIRC -0.218; TCGA KIRP -0.285; TCGA LGG -0.175; TCGA LIHC -0.126; TCGA LUAD -0.064; TCGA PAAD -0.162; TCGA PRAD -0.231; TCGA SARC -0.09; TCGA THCA -0.098; TCGA UCEC -0.122
hsa-miR-19b-3p
RAPH1
9 cancers: BLCA; BRCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.119; TCGA BRCA -0.077; TCGA HNSC -0.233; TCGA KIRP -0.359; TCGA LUAD -0.063; TCGA LUSC -0.114; TCGA PAAD -0.134; TCGA PRAD -0.136; TCGA UCEC -0.228
hsa-miR-19b-3p
KLF6
12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.193; TCGA COAD -0.103; TCGA ESCA -0.146; TCGA HNSC -0.115; TCGA KIRP -0.166; TCGA LIHC -0.199; TCGA LUAD -0.211; TCGA LUSC -0.393; TCGA PAAD -0.17; TCGA PRAD -0.291; TCGA STAD -0.115; TCGA UCEC -0.276
hsa-miR-19b-3p
MFSD6
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.095; TCGA CESC -0.157; TCGA ESCA -0.146; TCGA HNSC -0.181; TCGA KIRC -0.192; TCGA KIRP -0.255; TCGA LGG -0.098; TCGA LUAD -0.071; TCGA LUSC -0.176; TCGA PAAD -0.108; TCGA PRAD -0.275; TCGA SARC -0.305; TCGA THCA -0.145
hsa-miR-19b-3p
FNDC3A
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.13; TCGA BRCA -0.064; TCGA HNSC -0.253; TCGA KIRC -0.166; TCGA KIRP -0.21; TCGA LIHC -0.152; TCGA LUSC -0.198; TCGA PAAD -0.23; TCGA PRAD -0.281; TCGA UCEC -0.125
hsa-miR-19b-3p
SATB1
9 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.212; TCGA HNSC -0.388; TCGA KIRC -0.254; TCGA KIRP -0.183; TCGA LIHC -0.172; TCGA LUSC -0.15; TCGA PRAD -0.261; TCGA STAD -0.42; TCGA UCEC -0.239
hsa-miR-19b-3p
SYNPO2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -1.358; TCGA BRCA -0.36; TCGA CESC -0.588; TCGA COAD -1.189; TCGA ESCA -1.041; TCGA HNSC -0.737; TCGA KIRP -0.471; TCGA LGG -0.264; TCGA LIHC -0.33; TCGA LUAD -0.395; TCGA LUSC -0.5; TCGA PAAD -0.732; TCGA PRAD -0.687; TCGA SARC -1.262; TCGA THCA -0.138; TCGA STAD -1.618; TCGA UCEC -0.887
hsa-miR-19b-3p
WWP1
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.239; TCGA HNSC -0.132; TCGA KIRC -0.276; TCGA KIRP -0.258; TCGA LGG -0.085; TCGA LIHC -0.117; TCGA LUAD -0.052; TCGA PAAD -0.106; TCGA SARC -0.084; TCGA THCA -0.109; TCGA UCEC -0.123
hsa-miR-19b-3p
MN1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.616; TCGA BRCA -0.378; TCGA COAD -0.682; TCGA ESCA -0.675; TCGA HNSC -0.432; TCGA KIRP -0.187; TCGA LGG -0.163; TCGA LIHC -0.191; TCGA PAAD -0.365; TCGA PRAD -0.459; TCGA SARC -0.361; TCGA STAD -0.763; TCGA UCEC -0.343
hsa-miR-19b-3p
ACTN1
12 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.411; TCGA COAD -0.222; TCGA ESCA -0.299; TCGA HNSC -0.178; TCGA LIHC -0.097; TCGA LUAD -0.114; TCGA LUSC -0.216; TCGA PAAD -0.125; TCGA PRAD -0.283; TCGA SARC -0.289; TCGA STAD -0.479; TCGA UCEC -0.237
hsa-miR-19b-3p
SEMA6D
10 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.459; TCGA BRCA -0.291; TCGA HNSC -0.422; TCGA KIRP -0.292; TCGA LGG -0.26; TCGA LIHC -0.188; TCGA LUAD -0.229; TCGA PAAD -0.426; TCGA PRAD -0.608; TCGA STAD -0.406
hsa-miR-19b-3p
ANKRD12
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.12; TCGA BRCA -0.079; TCGA CESC -0.103; TCGA COAD -0.145; TCGA HNSC -0.13; TCGA KIRP -0.146; TCGA LGG -0.075; TCGA LUSC -0.063; TCGA PAAD -0.184; TCGA PRAD -0.157; TCGA SARC -0.139; TCGA STAD -0.087; TCGA UCEC -0.17
hsa-miR-19b-3p
NCALD
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.498; TCGA COAD -0.197; TCGA ESCA -0.328; TCGA HNSC -0.222; TCGA KIRC -0.179; TCGA LUAD -0.105; TCGA LUSC -0.293; TCGA PAAD -0.193; TCGA PRAD -0.182; TCGA SARC -0.165; TCGA THCA -0.101; TCGA STAD -0.489
hsa-miR-19b-3p
FEM1C
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.158; TCGA ESCA -0.116; TCGA HNSC -0.142; TCGA KIRP -0.145; TCGA LIHC -0.092; TCGA LUAD -0.107; TCGA LUSC -0.077; TCGA PAAD -0.112; TCGA PRAD -0.152; TCGA SARC -0.149; TCGA THCA -0.054; TCGA STAD -0.095; TCGA UCEC -0.119
hsa-miR-19b-3p
BMPER
11 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.427; TCGA BRCA -0.165; TCGA HNSC -0.36; TCGA LGG -0.194; TCGA LIHC -0.564; TCGA LUAD -0.336; TCGA LUSC -0.37; TCGA PAAD -0.323; TCGA PRAD -0.411; TCGA STAD -0.904; TCGA UCEC -0.396
hsa-miR-19b-3p
CALM1
13 cancers: BLCA; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.16; TCGA COAD -0.075; TCGA ESCA -0.156; TCGA KIRC -0.076; TCGA LGG -0.185; TCGA LUAD -0.097; TCGA LUSC -0.196; TCGA PAAD -0.15; TCGA PRAD -0.153; TCGA SARC -0.126; TCGA THCA -0.118; TCGA STAD -0.148; TCGA UCEC -0.07
hsa-miR-19b-3p
ADAMTSL3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.121; TCGA BRCA -0.257; TCGA CESC -0.406; TCGA COAD -1.044; TCGA ESCA -0.732; TCGA HNSC -0.741; TCGA KIRC -0.227; TCGA KIRP -0.539; TCGA LGG -0.196; TCGA LIHC -0.242; TCGA LUAD -0.258; TCGA LUSC -0.554; TCGA PAAD -0.708; TCGA PRAD -0.654; TCGA SARC -0.251; TCGA STAD -1.001; TCGA UCEC -0.627
hsa-miR-19b-3p
ROBO2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.364; TCGA BRCA -0.549; TCGA CESC -0.433; TCGA COAD -0.321; TCGA HNSC -0.537; TCGA KIRC -0.344; TCGA LGG -0.397; TCGA LUAD -0.459; TCGA LUSC -0.416; TCGA PAAD -0.488; TCGA PRAD -0.456; TCGA STAD -0.248
hsa-miR-19b-3p
NPAS3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.319; TCGA CESC -0.284; TCGA COAD -0.859; TCGA ESCA -0.419; TCGA HNSC -0.398; TCGA KIRP -0.196; TCGA LGG -0.154; TCGA LUSC -0.208; TCGA PAAD -0.284; TCGA PRAD -0.223; TCGA STAD -0.779
hsa-miR-19b-3p
FAM102A
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; SARC; UCEC
miRNATAP
TCGA BLCA -0.151; TCGA BRCA -0.182; TCGA CESC -0.119; TCGA ESCA -0.145; TCGA HNSC -0.132; TCGA KIRC -0.228; TCGA KIRP -0.214; TCGA LIHC -0.091; TCGA SARC -0.087; TCGA UCEC -0.246
hsa-miR-19b-3p
GLIS2
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.471; TCGA BRCA -0.224; TCGA COAD -0.532; TCGA ESCA -0.201; TCGA HNSC -0.269; TCGA LUSC -0.298; TCGA PAAD -0.197; TCGA PRAD -0.273; TCGA STAD -0.37
hsa-miR-19b-3p
C8orf4
10 cancers: BLCA; BRCA; CESC; COAD; KIRP; LIHC; LUSC; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.453; TCGA BRCA -0.27; TCGA CESC -0.512; TCGA COAD -0.193; TCGA KIRP -0.351; TCGA LIHC -0.204; TCGA LUSC -0.394; TCGA PRAD -0.24; TCGA SARC -0.315; TCGA THCA -0.203
hsa-miR-19b-3p
NHS
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; PRAD; SARC
miRNATAP
TCGA BLCA -0.163; TCGA BRCA -0.173; TCGA CESC -0.249; TCGA COAD -0.327; TCGA HNSC -0.177; TCGA KIRP -0.119; TCGA LGG -0.15; TCGA LIHC -0.17; TCGA PRAD -0.474; TCGA SARC -0.35
hsa-miR-19b-3p
EIF4G2
12 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.055; TCGA HNSC -0.128; TCGA KIRC -0.12; TCGA KIRP -0.223; TCGA LIHC -0.066; TCGA LUAD -0.074; TCGA LUSC -0.065; TCGA PAAD -0.147; TCGA PRAD -0.162; TCGA THCA -0.107; TCGA STAD -0.055; TCGA UCEC -0.073
hsa-miR-19b-3p
ZNF609
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.068; TCGA BRCA -0.11; TCGA CESC -0.079; TCGA COAD -0.097; TCGA HNSC -0.187; TCGA KIRC -0.081; TCGA KIRP -0.15; TCGA PAAD -0.149; TCGA PRAD -0.118; TCGA SARC -0.075; TCGA THCA -0.055
hsa-miR-19b-3p
STRN3
10 cancers: BLCA; BRCA; COAD; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.133; TCGA COAD -0.098; TCGA KIRP -0.115; TCGA PAAD -0.117; TCGA PRAD -0.146; TCGA SARC -0.13; TCGA THCA -0.057; TCGA STAD -0.136; TCGA UCEC -0.095
hsa-miR-19b-3p
ZNF469
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.488; TCGA BRCA -0.11; TCGA CESC -0.278; TCGA COAD -0.58; TCGA HNSC -0.622; TCGA LIHC -0.134; TCGA LUSC -0.301; TCGA PAAD -0.248; TCGA PRAD -0.334; TCGA UCEC -0.239
hsa-miR-19b-3p
MTUS1
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.261; TCGA BRCA -0.249; TCGA CESC -0.251; TCGA COAD -0.153; TCGA HNSC -0.19; TCGA KIRC -0.175; TCGA KIRP -0.197; TCGA LGG -0.177; TCGA LIHC -0.244; TCGA LUSC -0.134; TCGA PAAD -0.144; TCGA PRAD -0.192; TCGA SARC -0.247; TCGA STAD -0.126; TCGA UCEC -0.245
hsa-miR-19b-3p
FAM46C
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.234; TCGA BRCA -0.297; TCGA COAD -0.336; TCGA HNSC -0.423; TCGA KIRC -0.262; TCGA KIRP -0.273; TCGA LIHC -0.171; TCGA LUAD -0.169; TCGA LUSC -0.538; TCGA PAAD -0.276; TCGA PRAD -0.246; TCGA SARC -0.45; TCGA UCEC -0.158
hsa-miR-19b-3p
KLHL15
10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.09; TCGA HNSC -0.104; TCGA KIRC -0.173; TCGA KIRP -0.238; TCGA LGG -0.068; TCGA LIHC -0.112; TCGA LUAD -0.055; TCGA PAAD -0.199; TCGA PRAD -0.141; TCGA STAD -0.169
hsa-miR-19b-3p
MAPK10
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.23; TCGA BRCA -0.182; TCGA CESC -0.608; TCGA COAD -0.696; TCGA ESCA -0.446; TCGA KIRC -0.309; TCGA LGG -0.155; TCGA LIHC -0.202; TCGA LUAD -0.19; TCGA PAAD -0.368; TCGA SARC -0.612; TCGA STAD -0.849; TCGA UCEC -0.442
hsa-miR-19b-3p
PFKFB3
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD
miRNATAP
TCGA BLCA -0.164; TCGA BRCA -0.135; TCGA COAD -0.179; TCGA HNSC -0.163; TCGA LGG -0.26; TCGA LIHC -0.201; TCGA LUAD -0.121; TCGA LUSC -0.153; TCGA PRAD -0.328
hsa-miR-19b-3p
CD69
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.474; TCGA BRCA -0.097; TCGA CESC -0.385; TCGA COAD -0.578; TCGA HNSC -0.19; TCGA LGG -0.28; TCGA LIHC -0.155; TCGA LUAD -0.329; TCGA LUSC -0.495; TCGA PRAD -0.34; TCGA SARC -0.28; TCGA STAD -0.226; TCGA UCEC -0.256
hsa-miR-19b-3p
KIT
14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.606; TCGA COAD -0.546; TCGA ESCA -0.439; TCGA HNSC -0.571; TCGA KIRC -0.477; TCGA KIRP -0.491; TCGA LGG -0.28; TCGA LIHC -0.141; TCGA LUSC -0.311; TCGA PAAD -0.551; TCGA PRAD -0.528; TCGA SARC -0.225; TCGA STAD -0.788; TCGA UCEC -0.314
hsa-miR-19b-3p
GNAI1
9 cancers: BLCA; COAD; ESCA; KIRC; LIHC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.166; TCGA COAD -0.405; TCGA ESCA -0.273; TCGA KIRC -0.158; TCGA LIHC -0.164; TCGA PAAD -0.27; TCGA THCA -0.128; TCGA STAD -0.488; TCGA UCEC -0.183
hsa-miR-19b-3p
HLF
13 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -1.02; TCGA CESC -0.283; TCGA COAD -0.293; TCGA ESCA -0.46; TCGA KIRC -0.297; TCGA LGG -0.224; TCGA LIHC -0.267; TCGA LUAD -0.251; TCGA PAAD -0.443; TCGA PRAD -0.387; TCGA SARC -0.703; TCGA STAD -0.99; TCGA UCEC -0.763
hsa-miR-19b-3p
SORL1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA
miRNATAP
TCGA BLCA -0.169; TCGA BRCA -0.175; TCGA HNSC -0.296; TCGA KIRC -0.407; TCGA KIRP -0.336; TCGA LGG -0.389; TCGA LIHC -0.228; TCGA PAAD -0.237; TCGA PRAD -0.396; TCGA SARC -0.187; TCGA THCA -0.134
hsa-miR-19b-3p
PDE7B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.388; TCGA BRCA -0.187; TCGA CESC -0.312; TCGA COAD -0.539; TCGA ESCA -0.38; TCGA HNSC -0.431; TCGA KIRC -0.343; TCGA KIRP -0.223; TCGA LGG -0.223; TCGA LIHC -0.314; TCGA LUSC -0.424; TCGA PAAD -0.358; TCGA PRAD -0.383; TCGA THCA -0.239; TCGA STAD -0.8; TCGA UCEC -0.503
hsa-miR-19b-3p
SNPH
11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.229; TCGA BRCA -0.295; TCGA COAD -0.481; TCGA HNSC -0.236; TCGA LGG -0.235; TCGA LUSC -0.219; TCGA PRAD -0.268; TCGA SARC -0.191; TCGA THCA -0.101; TCGA STAD -0.415; TCGA UCEC -0.418
hsa-miR-19b-3p
AP2B1
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; THCA
miRNAWalker2 validate
TCGA BRCA -0.089; TCGA HNSC -0.11; TCGA KIRC -0.158; TCGA KIRP -0.125; TCGA LGG -0.062; TCGA LIHC -0.089; TCGA LUAD -0.071; TCGA PAAD -0.07; TCGA THCA -0.111
hsa-miR-19b-3p
ARHGAP12
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; THCA; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.066; TCGA HNSC -0.108; TCGA KIRC -0.156; TCGA KIRP -0.175; TCGA LGG -0.094; TCGA LIHC -0.117; TCGA PRAD -0.153; TCGA THCA -0.098; TCGA UCEC -0.072
hsa-miR-19b-3p
CPD
11 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.212; TCGA COAD -0.086; TCGA HNSC -0.304; TCGA KIRC -0.16; TCGA KIRP -0.343; TCGA LUAD -0.103; TCGA LUSC -0.104; TCGA PAAD -0.223; TCGA PRAD -0.203; TCGA THCA -0.241; TCGA UCEC -0.183
hsa-miR-19b-3p
CTR9
12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.086; TCGA CESC -0.073; TCGA HNSC -0.053; TCGA KIRC -0.154; TCGA KIRP -0.191; TCGA LGG -0.071; TCGA LIHC -0.072; TCGA LUAD -0.051; TCGA PAAD -0.136; TCGA PRAD -0.102; TCGA THCA -0.099; TCGA UCEC -0.078
hsa-miR-19b-3p
ELOVL5
9 cancers: BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; STAD
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BRCA -0.29; TCGA ESCA -0.238; TCGA HNSC -0.17; TCGA KIRP -0.219; TCGA LGG -0.102; TCGA LIHC -0.136; TCGA LUSC -0.06; TCGA PAAD -0.223; TCGA STAD -0.206
hsa-miR-19b-3p
ESYT1
10 cancers: BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.064; TCGA HNSC -0.145; TCGA KIRP -0.082; TCGA LIHC -0.057; TCGA LUAD -0.101; TCGA LUSC -0.114; TCGA PRAD -0.085; TCGA SARC -0.106; TCGA THCA -0.087; TCGA STAD -0.125
hsa-miR-19b-3p
SMCR8
10 cancers: BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.097; TCGA HNSC -0.236; TCGA KIRC -0.188; TCGA KIRP -0.264; TCGA LUSC -0.1; TCGA PAAD -0.11; TCGA PRAD -0.106; TCGA SARC -0.139; TCGA THCA -0.068; TCGA UCEC -0.109
hsa-miR-19b-3p
SPTY2D1
12 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BRCA -0.09; TCGA COAD -0.075; TCGA HNSC -0.148; TCGA KIRC -0.188; TCGA KIRP -0.31; TCGA LGG -0.055; TCGA LIHC -0.073; TCGA LUAD -0.096; TCGA PAAD -0.224; TCGA PRAD -0.124; TCGA THCA -0.07; TCGA UCEC -0.072
hsa-miR-19b-3p
TMBIM6
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA
miRNAWalker2 validate; MirTarget
TCGA BRCA -0.145; TCGA HNSC -0.097; TCGA KIRC -0.199; TCGA KIRP -0.19; TCGA LGG -0.143; TCGA LIHC -0.152; TCGA LUAD -0.084; TCGA LUSC -0.148; TCGA THCA -0.069
hsa-miR-19b-3p
TMEM9B
9 cancers: BRCA; CESC; KIRC; LGG; LIHC; LUAD; LUSC; THCA; UCEC
miRNAWalker2 validate
TCGA BRCA -0.108; TCGA CESC -0.065; TCGA KIRC -0.162; TCGA LGG -0.142; TCGA LIHC -0.095; TCGA LUAD -0.109; TCGA LUSC -0.108; TCGA THCA -0.066; TCGA UCEC -0.091
hsa-miR-19b-3p
ELMOD2
10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
MirTarget; miRNATAP
TCGA BRCA -0.178; TCGA KIRC -0.242; TCGA KIRP -0.157; TCGA LGG -0.099; TCGA LIHC -0.149; TCGA LUAD -0.06; TCGA LUSC -0.052; TCGA PAAD -0.187; TCGA PRAD -0.077; TCGA THCA -0.118
hsa-miR-19b-3p
DOCK5
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; THCA
MirTarget
TCGA BRCA -0.083; TCGA CESC -0.192; TCGA COAD -0.152; TCGA HNSC -0.202; TCGA KIRP -0.285; TCGA LGG -0.232; TCGA LIHC -0.162; TCGA LUSC -0.255; TCGA PRAD -0.314; TCGA SARC -0.294; TCGA THCA -0.131
hsa-miR-19b-3p
ABCD3
9 cancers: BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
MirTarget
TCGA BRCA -0.13; TCGA HNSC -0.061; TCGA KIRC -0.249; TCGA KIRP -0.193; TCGA LUAD -0.1; TCGA LUSC -0.072; TCGA PAAD -0.098; TCGA PRAD -0.194; TCGA THCA -0.098
hsa-miR-19b-3p
PHAX
9 cancers: BRCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BRCA -0.075; TCGA KIRC -0.101; TCGA KIRP -0.152; TCGA LGG -0.111; TCGA LUAD -0.075; TCGA PAAD -0.184; TCGA PRAD -0.114; TCGA THCA -0.11; TCGA STAD -0.063
hsa-miR-19b-3p
CCDC126
9 cancers: BRCA; CESC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.189; TCGA CESC -0.089; TCGA KIRP -0.231; TCGA LIHC -0.062; TCGA LUAD -0.133; TCGA PAAD -0.165; TCGA PRAD -0.093; TCGA THCA -0.095; TCGA UCEC -0.124
hsa-miR-19b-3p
ZFYVE26
10 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC
MirTarget
TCGA BRCA -0.122; TCGA CESC -0.071; TCGA ESCA -0.132; TCGA HNSC -0.153; TCGA KIRP -0.122; TCGA LGG -0.062; TCGA LUSC -0.153; TCGA PAAD -0.078; TCGA PRAD -0.124; TCGA SARC -0.112
hsa-miR-19b-3p
PCDHA11
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; UCEC
MirTarget
TCGA BRCA -0.251; TCGA CESC -0.383; TCGA COAD -0.654; TCGA HNSC -0.333; TCGA KIRC -0.421; TCGA KIRP -0.42; TCGA LGG -0.468; TCGA LIHC -0.256; TCGA LUSC -0.554; TCGA PAAD -0.332; TCGA UCEC -0.431
hsa-miR-19b-3p
PLS1
10 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
MirTarget
TCGA BRCA -0.099; TCGA HNSC -0.154; TCGA KIRC -0.305; TCGA KIRP -0.266; TCGA LIHC -0.166; TCGA LUAD -0.09; TCGA LUSC -0.131; TCGA PAAD -0.318; TCGA PRAD -0.301; TCGA THCA -0.134
hsa-miR-19b-3p
SLC31A2
11 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget
TCGA BRCA -0.067; TCGA COAD -0.333; TCGA ESCA -0.17; TCGA HNSC -0.15; TCGA KIRP -0.124; TCGA LIHC -0.209; TCGA LUAD -0.281; TCGA LUSC -0.358; TCGA PAAD -0.202; TCGA PRAD -0.08; TCGA UCEC -0.102
hsa-miR-19b-3p
FKBP15
11 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget
TCGA BRCA -0.057; TCGA COAD -0.065; TCGA ESCA -0.097; TCGA HNSC -0.095; TCGA KIRP -0.059; TCGA LIHC -0.09; TCGA LUAD -0.069; TCGA LUSC -0.091; TCGA PAAD -0.065; TCGA PRAD -0.052; TCGA UCEC -0.075
hsa-miR-19b-3p
ANO1
9 cancers: BRCA; COAD; HNSC; KIRP; LIHC; LUAD; PRAD; SARC; STAD
MirTarget; miRNATAP
TCGA BRCA -0.166; TCGA COAD -0.553; TCGA HNSC -0.282; TCGA KIRP -0.281; TCGA LIHC -0.261; TCGA LUAD -0.202; TCGA PRAD -0.53; TCGA SARC -0.349; TCGA STAD -0.201
hsa-miR-19b-3p
SLC14A1
9 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUSC; PRAD; SARC; STAD
MirTarget
TCGA BRCA -0.159; TCGA CESC -0.278; TCGA HNSC -0.207; TCGA LGG -0.753; TCGA LIHC -0.334; TCGA LUSC -0.392; TCGA PRAD -0.613; TCGA SARC -0.458; TCGA STAD -0.362
hsa-miR-19b-3p
USP32
11 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BRCA -0.098; TCGA COAD -0.063; TCGA HNSC -0.131; TCGA KIRC -0.078; TCGA KIRP -0.28; TCGA LGG -0.135; TCGA LIHC -0.102; TCGA PAAD -0.177; TCGA PRAD -0.222; TCGA SARC -0.061; TCGA THCA -0.137
hsa-miR-19b-3p
SHISA6
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; STAD
MirTarget
TCGA BRCA -0.627; TCGA COAD -0.456; TCGA ESCA -0.562; TCGA HNSC -0.377; TCGA KIRC -0.37; TCGA LGG -0.908; TCGA PAAD -0.553; TCGA PRAD -0.233; TCGA STAD -0.566
hsa-miR-19b-3p
SLC9A1
10 cancers: BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
MirTarget
TCGA BRCA -0.123; TCGA COAD -0.145; TCGA HNSC -0.12; TCGA KIRP -0.095; TCGA LIHC -0.144; TCGA LUAD -0.117; TCGA LUSC -0.183; TCGA PRAD -0.144; TCGA THCA -0.155; TCGA UCEC -0.128
hsa-miR-19b-3p
NIPA1
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA
MirTarget; miRNATAP
TCGA BRCA -0.052; TCGA HNSC -0.088; TCGA KIRC -0.11; TCGA KIRP -0.196; TCGA LIHC -0.09; TCGA PAAD -0.112; TCGA PRAD -0.076; TCGA SARC -0.177; TCGA THCA -0.147
hsa-miR-19b-3p
DENND4C
12 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BRCA -0.083; TCGA HNSC -0.195; TCGA KIRP -0.238; TCGA LGG -0.151; TCGA LIHC -0.134; TCGA LUAD -0.078; TCGA LUSC -0.112; TCGA PAAD -0.2; TCGA PRAD -0.21; TCGA SARC -0.195; TCGA THCA -0.077; TCGA UCEC -0.152
hsa-miR-19b-3p
VPS41
11 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.057; TCGA HNSC -0.095; TCGA KIRC -0.102; TCGA KIRP -0.141; TCGA LGG -0.072; TCGA LIHC -0.133; TCGA LUAD -0.063; TCGA PAAD -0.159; TCGA PRAD -0.084; TCGA THCA -0.1; TCGA STAD -0.079
hsa-miR-19b-3p
SPTLC2
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
mirMAP
TCGA BRCA -0.215; TCGA HNSC -0.132; TCGA KIRC -0.274; TCGA KIRP -0.291; TCGA LGG -0.09; TCGA LIHC -0.118; TCGA LUAD -0.113; TCGA PAAD -0.118; TCGA PRAD -0.181; TCGA THCA -0.173
hsa-miR-19b-3p
SYTL4
11 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.39; TCGA CESC -0.307; TCGA ESCA -0.197; TCGA HNSC -0.163; TCGA LGG -0.364; TCGA LIHC -0.322; TCGA LUAD -0.14; TCGA LUSC -0.187; TCGA PRAD -0.097; TCGA STAD -0.155; TCGA UCEC -0.454
hsa-miR-19b-3p
PLEKHB2
10 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BRCA -0.076; TCGA HNSC -0.093; TCGA KIRC -0.352; TCGA KIRP -0.293; TCGA LIHC -0.065; TCGA LUAD -0.072; TCGA LUSC -0.155; TCGA PAAD -0.139; TCGA PRAD -0.122; TCGA THCA -0.164
hsa-miR-19b-3p
SOCS2
11 cancers: BRCA; CESC; COAD; ESCA; LIHC; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.21; TCGA CESC -0.27; TCGA COAD -0.145; TCGA ESCA -0.28; TCGA LIHC -0.316; TCGA LUSC -0.245; TCGA PAAD -0.164; TCGA SARC -0.534; TCGA THCA -0.096; TCGA STAD -0.321; TCGA UCEC -0.554
hsa-miR-19b-3p
ARFGEF2
9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BRCA -0.071; TCGA HNSC -0.235; TCGA KIRC -0.274; TCGA KIRP -0.308; TCGA LGG -0.079; TCGA PAAD -0.148; TCGA PRAD -0.271; TCGA SARC -0.113; TCGA THCA -0.147
hsa-miR-19b-3p
PARP9
10 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; SARC; THCA
mirMAP
TCGA BRCA -0.074; TCGA CESC -0.126; TCGA COAD -0.18; TCGA HNSC -0.115; TCGA KIRP -0.154; TCGA LGG -0.212; TCGA LIHC -0.098; TCGA LUAD -0.098; TCGA SARC -0.183; TCGA THCA -0.115
hsa-miR-19b-3p
TMOD3
13 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.069; TCGA CESC -0.14; TCGA COAD -0.084; TCGA HNSC -0.143; TCGA KIRP -0.246; TCGA LGG -0.103; TCGA LIHC -0.058; TCGA LUAD -0.118; TCGA LUSC -0.084; TCGA PAAD -0.146; TCGA PRAD -0.167; TCGA THCA -0.126; TCGA UCEC -0.13
hsa-miR-19b-3p
XPR1
9 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; THCA
mirMAP
TCGA BRCA -0.062; TCGA COAD -0.075; TCGA HNSC -0.147; TCGA KIRC -0.1; TCGA KIRP -0.16; TCGA LGG -0.073; TCGA PAAD -0.14; TCGA PRAD -0.165; TCGA THCA -0.101
hsa-miR-19b-3p
CDKN2B
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BRCA -0.096; TCGA CESC -0.212; TCGA COAD -0.563; TCGA HNSC -0.381; TCGA KIRP -0.144; TCGA LUAD -0.114; TCGA LUSC -0.342; TCGA PAAD -0.31; TCGA PRAD -0.251; TCGA SARC -0.286; TCGA THCA -0.206
hsa-miR-19b-3p
SAR1B
12 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.167; TCGA HNSC -0.092; TCGA KIRC -0.148; TCGA KIRP -0.162; TCGA LGG -0.194; TCGA LIHC -0.138; TCGA LUAD -0.084; TCGA LUSC -0.08; TCGA PAAD -0.165; TCGA SARC -0.082; TCGA THCA -0.171; TCGA STAD -0.061
hsa-miR-19b-3p
RAB11FIP1
10 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA
mirMAP
TCGA BRCA -0.157; TCGA HNSC -0.148; TCGA KIRC -0.231; TCGA KIRP -0.205; TCGA LGG -0.16; TCGA LIHC -0.118; TCGA LUAD -0.149; TCGA LUSC -0.292; TCGA PRAD -0.133; TCGA THCA -0.113
hsa-miR-19b-3p
TMEM110
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA BRCA -0.126; TCGA COAD -0.086; TCGA ESCA -0.163; TCGA HNSC -0.084; TCGA KIRC -0.228; TCGA KIRP -0.186; TCGA LGG -0.093; TCGA LUAD -0.056; TCGA LUSC -0.137; TCGA PAAD -0.087; TCGA PRAD -0.091; TCGA THCA -0.078; TCGA UCEC -0.091
hsa-miR-19b-3p
AP1G1
9 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.051; TCGA HNSC -0.163; TCGA KIRC -0.201; TCGA KIRP -0.157; TCGA LIHC -0.169; TCGA PAAD -0.081; TCGA PRAD -0.144; TCGA THCA -0.093; TCGA UCEC -0.067
hsa-miR-19b-3p
ABR
9 cancers: BRCA; CESC; HNSC; LGG; LUAD; LUSC; PRAD; THCA; UCEC
miRNATAP
TCGA BRCA -0.117; TCGA CESC -0.125; TCGA HNSC -0.176; TCGA LGG -0.2; TCGA LUAD -0.069; TCGA LUSC -0.2; TCGA PRAD -0.066; TCGA THCA -0.172; TCGA UCEC -0.193
hsa-miR-19b-3p
MECOM
9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; THCA
miRNATAP
TCGA BRCA -0.204; TCGA CESC -0.243; TCGA HNSC -0.462; TCGA KIRC -0.411; TCGA KIRP -0.471; TCGA LIHC -0.129; TCGA LUSC -0.274; TCGA PRAD -0.504; TCGA THCA -0.164
hsa-miR-19b-3p
YIPF6
11 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA
miRNATAP
TCGA BRCA -0.08; TCGA HNSC -0.154; TCGA KIRC -0.258; TCGA KIRP -0.433; TCGA LGG -0.16; TCGA LIHC -0.094; TCGA LUAD -0.08; TCGA PAAD -0.287; TCGA PRAD -0.23; TCGA SARC -0.073; TCGA THCA -0.235
hsa-miR-19b-3p
FOXF2
9 cancers: BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -0.206; TCGA COAD -0.477; TCGA ESCA -0.617; TCGA LUAD -0.351; TCGA LUSC -0.254; TCGA PAAD -0.375; TCGA PRAD -0.27; TCGA THCA -0.238; TCGA STAD -0.743
hsa-miR-19b-3p
PRKAA1
10 cancers: CESC; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; miRTarBase; miRNATAP
TCGA CESC -0.144; TCGA HNSC -0.11; TCGA KIRC -0.1; TCGA KIRP -0.149; TCGA LUAD -0.064; TCGA PAAD -0.112; TCGA PRAD -0.141; TCGA SARC -0.255; TCGA THCA -0.063; TCGA UCEC -0.192
hsa-miR-19b-3p
ARAP2
9 cancers: CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; UCEC
MirTarget
TCGA CESC -0.159; TCGA HNSC -0.149; TCGA KIRP -0.132; TCGA LGG -0.404; TCGA LIHC -0.167; TCGA LUAD -0.162; TCGA LUSC -0.17; TCGA PRAD -0.152; TCGA UCEC -0.205
hsa-miR-19b-3p
SLC26A4
10 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.326; TCGA HNSC -0.309; TCGA KIRC -0.36; TCGA KIRP -0.549; TCGA LGG -0.24; TCGA LUSC -0.299; TCGA PAAD -0.369; TCGA THCA -0.313; TCGA STAD -0.404; TCGA UCEC -0.262
hsa-miR-19b-3p
MDFIC
13 cancers: CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA CESC -0.179; TCGA COAD -0.596; TCGA ESCA -0.21; TCGA HNSC -0.241; TCGA KIRP -0.224; TCGA LGG -0.245; TCGA LIHC -0.377; TCGA LUAD -0.258; TCGA LUSC -0.257; TCGA PAAD -0.294; TCGA PRAD -0.38; TCGA STAD -0.421; TCGA UCEC -0.468
hsa-miR-19b-3p
IFI44L
9 cancers: CESC; COAD; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget
TCGA CESC -0.333; TCGA COAD -0.755; TCGA LGG -0.271; TCGA LIHC -0.235; TCGA LUAD -0.144; TCGA LUSC -0.249; TCGA PRAD -0.125; TCGA SARC -0.291; TCGA STAD -0.24
hsa-miR-19b-3p
ITGB8
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD
MirTarget
TCGA CESC -0.172; TCGA COAD -0.22; TCGA HNSC -0.271; TCGA KIRC -0.349; TCGA KIRP -0.348; TCGA LGG -0.368; TCGA LIHC -0.398; TCGA LUAD -0.357; TCGA PAAD -0.212; TCGA PRAD -0.567
hsa-miR-19b-3p
ABHD5
13 cancers: COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNAWalker2 validate
TCGA COAD -0.12; TCGA ESCA -0.171; TCGA KIRC -0.145; TCGA KIRP -0.163; TCGA LGG -0.091; TCGA LIHC -0.112; TCGA LUAD -0.136; TCGA LUSC -0.151; TCGA PAAD -0.144; TCGA PRAD -0.097; TCGA SARC -0.121; TCGA THCA -0.156; TCGA STAD -0.06
hsa-miR-19b-3p
VPS4B
11 cancers: COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA COAD -0.114; TCGA HNSC -0.07; TCGA KIRC -0.071; TCGA KIRP -0.182; TCGA LIHC -0.144; TCGA LUAD -0.071; TCGA PAAD -0.084; TCGA PRAD -0.154; TCGA SARC -0.098; TCGA THCA -0.069; TCGA UCEC -0.113
hsa-miR-19b-3p
CAND1
9 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA
MirTarget
TCGA COAD -0.071; TCGA HNSC -0.1; TCGA KIRC -0.106; TCGA KIRP -0.222; TCGA LGG -0.059; TCGA LUAD -0.056; TCGA PAAD -0.164; TCGA PRAD -0.139; TCGA THCA -0.096
hsa-miR-19b-3p
ZDHHC2
9 cancers: COAD; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; STAD
mirMAP
TCGA COAD -0.251; TCGA HNSC -0.291; TCGA KIRC -0.271; TCGA KIRP -0.439; TCGA LIHC -0.171; TCGA LUAD -0.174; TCGA PAAD -0.2; TCGA PRAD -0.233; TCGA STAD -0.211
hsa-miR-19b-3p
FIGN
10 cancers: COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA COAD -0.825; TCGA ESCA -0.446; TCGA HNSC -0.484; TCGA KIRP -0.163; TCGA LGG -0.306; TCGA LUSC -0.371; TCGA PAAD -0.389; TCGA PRAD -0.208; TCGA SARC -0.549; TCGA STAD -0.615
hsa-miR-19b-3p
MBP
9 cancers: COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; UCEC
mirMAP
TCGA COAD -0.125; TCGA HNSC -0.203; TCGA KIRP -0.213; TCGA LIHC -0.101; TCGA LUAD -0.156; TCGA LUSC -0.147; TCGA PAAD -0.159; TCGA SARC -0.303; TCGA UCEC -0.128
hsa-miR-19b-3p
TMEM64
12 cancers: COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA COAD -0.31; TCGA HNSC -0.096; TCGA KIRC -0.109; TCGA KIRP -0.155; TCGA LIHC -0.192; TCGA LUAD -0.182; TCGA LUSC -0.152; TCGA PAAD -0.184; TCGA PRAD -0.157; TCGA SARC -0.132; TCGA THCA -0.071; TCGA UCEC -0.152
hsa-miR-19b-3p
ARL8B
11 cancers: ESCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA ESCA -0.103; TCGA KIRC -0.12; TCGA KIRP -0.078; TCGA LGG -0.168; TCGA LUAD -0.079; TCGA PAAD -0.078; TCGA PRAD -0.077; TCGA SARC -0.089; TCGA THCA -0.052; TCGA STAD -0.085; TCGA UCEC -0.147
hsa-miR-19b-3p
ATMIN
9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA HNSC -0.084; TCGA KIRC -0.096; TCGA KIRP -0.162; TCGA LGG -0.056; TCGA LIHC -0.121; TCGA PAAD -0.126; TCGA PRAD -0.071; TCGA THCA -0.087; TCGA UCEC -0.064
hsa-miR-19b-3p
MTF1
9 cancers: HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget
TCGA HNSC -0.142; TCGA KIRC -0.104; TCGA KIRP -0.251; TCGA LIHC -0.122; TCGA LUSC -0.101; TCGA PAAD -0.186; TCGA PRAD -0.154; TCGA THCA -0.07; TCGA UCEC -0.103
hsa-miR-19b-3p
IGSF3
9 cancers: HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA HNSC -0.156; TCGA KIRC -0.287; TCGA KIRP -0.144; TCGA LGG -0.363; TCGA PAAD -0.203; TCGA PRAD -0.207; TCGA SARC -0.303; TCGA THCA -0.247; TCGA STAD -0.203
hsa-miR-19b-3p
ACBD5
10 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.111; TCGA KIRC -0.187; TCGA KIRP -0.259; TCGA LGG -0.096; TCGA LIHC -0.168; TCGA LUAD -0.057; TCGA PAAD -0.119; TCGA PRAD -0.083; TCGA THCA -0.169; TCGA UCEC -0.079
hsa-miR-19b-3p
ACSL4
9 cancers: HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
MirTarget; miRNATAP
TCGA HNSC -0.211; TCGA KIRC -0.172; TCGA KIRP -0.482; TCGA LUAD -0.26; TCGA LUSC -0.237; TCGA PAAD -0.195; TCGA PRAD -0.448; TCGA THCA -0.089; TCGA UCEC -0.172
hsa-miR-19b-3p
LMBR1
9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
mirMAP
TCGA HNSC -0.128; TCGA KIRC -0.147; TCGA KIRP -0.197; TCGA LGG -0.101; TCGA LIHC -0.129; TCGA LUAD -0.108; TCGA PAAD -0.108; TCGA PRAD -0.122; TCGA THCA -0.123
hsa-miR-19b-3p
ATP6V1A
9 cancers: HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; UCEC
mirMAP
TCGA HNSC -0.138; TCGA KIRC -0.405; TCGA KIRP -0.293; TCGA LGG -0.129; TCGA LUAD -0.09; TCGA PAAD -0.17; TCGA PRAD -0.103; TCGA THCA -0.184; TCGA UCEC -0.075
hsa-miR-19b-3p
VCPIP1
12 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP; miRNATAP
TCGA HNSC -0.204; TCGA KIRC -0.08; TCGA KIRP -0.223; TCGA LGG -0.064; TCGA LIHC -0.099; TCGA LUAD -0.059; TCGA LUSC -0.057; TCGA PAAD -0.114; TCGA PRAD -0.081; TCGA SARC -0.052; TCGA THCA -0.055; TCGA UCEC -0.078
hsa-miR-19b-3p
ANKIB1
9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
miRNATAP
TCGA HNSC -0.204; TCGA KIRC -0.145; TCGA KIRP -0.253; TCGA LGG -0.191; TCGA LIHC -0.116; TCGA LUAD -0.061; TCGA PAAD -0.163; TCGA PRAD -0.157; TCGA THCA -0.127
hsa-miR-19b-3p
CCDC47
9 cancers: HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA
miRNATAP
TCGA HNSC -0.08; TCGA KIRC -0.087; TCGA KIRP -0.127; TCGA LGG -0.06; TCGA LIHC -0.054; TCGA LUAD -0.067; TCGA PAAD -0.153; TCGA PRAD -0.054; TCGA THCA -0.139
hsa-miR-19b-3p
ITCH
9 cancers: HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; UCEC
miRNATAP
TCGA HNSC -0.116; TCGA KIRC -0.122; TCGA KIRP -0.16; TCGA LGG -0.07; TCGA LUAD -0.069; TCGA PAAD -0.119; TCGA PRAD -0.17; TCGA THCA -0.12; TCGA UCEC -0.061





Enriched cancer pathways of putative targets