microRNA information: hsa-miR-200a-3p

SectionIDlink
Mature name: hsa-miR-200a-3pmiRbase
Accession: MIMAT0000682miRbase
Precursor name: hsa-mir-200a miRbase
Precursor accession: MI0000737miRbase
Symbol: MIR200AHGNC
RefSeq ID: NR_029834GenBank
Sequence: UAACACUGUCUGGUAACGAUGU



Reported expression in cancers: hsa-miR-200a-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-200a-3p

bladder cancerderegulation"In other recruited 17 patients with BUC who were d ......"22886973Reverse transcription PCR; Microarray
hsa-miR-200a-3p

bladder cancerderegulation"We screened 723 miRNAs by microarray and selected ......"23945108qPCR; Microarray
hsa-miR-200a-3p

breast cancerdownregulation"Expression levels of miR-200a miR-200b miR-200c mi ......"26201425qPCR
hsa-miR-200a-3p

breast cancerdownregulation"Loss of expression of miR-200 family members has b ......"27717206
hsa-miR-200a-3p

cervical and endocervical cancerupregulation"Vote-counting analysis showed that up-regulation w ......"25920605
hsa-miR-200a-3p

colorectal cancerdownregulation"Here we used in situ hybridization and immunohisto ......"23441132in situ hybridization; qPCR
hsa-miR-200a-3p

colorectal cancerupregulation"The processes of EMT and metastasis are highly reg ......"25422078
hsa-miR-200a-3p

endometrial cancerupregulation"We evaluated the differential expressions of miRNA ......"21035172Microarray
hsa-miR-200a-3p

endometrial cancerupregulation"Using integrated statistical analyses we identifie ......"25750291
hsa-miR-200a-3p

endometrial cancerupregulation"The expression level of miR-200a was significantly ......"26045795
hsa-miR-200a-3p

esophageal cancerderegulation"The expression profiles of miRNAs in paired EC and ......"23761828Microarray; qPCR
hsa-miR-200a-3p

gastric cancerdownregulation"Although microRNA-200 miR-200 family members are t ......"25502084
hsa-miR-200a-3p

gastric cancerdownregulation"To find a potentially useful prognostic predictor ......"26137064
hsa-miR-200a-3p

head and neck cancerdownregulation"The miR-200 family and miR-203 were downregulated ......"26882562
hsa-miR-200a-3p

kidney renal cell cancerdownregulation"The set of miRNAs with significantly decreased exp ......"23074016
hsa-miR-200a-3p

kidney renal cell cancerdownregulation"Here we report that the expression of miR-200a was ......"25813153
hsa-miR-200a-3p

liver cancerdownregulation"We investigated the diagnostic impact of microRNA- ......"24895326qPCR
hsa-miR-200a-3p

liver cancerdownregulation"Although microRNA-200a miR-200a is frequently down ......"25797260
hsa-miR-200a-3p

liver cancerdownregulation"MiR-200 family is an important regulator of epithe ......"25909223
hsa-miR-200a-3p

liver cancerdownregulation"Expression of the microRNA-200 family was investig ......"26447841qPCR
hsa-miR-200a-3p

lung cancerupregulation"Among these 28 miRNAs were up-regulated in both th ......"27189341qPCR
hsa-miR-200a-3p

lymphomadownregulation"Intriguingly both hsa-miR-363 and hsa-miR-200a bel ......"26893685
hsa-miR-200a-3p

melanomaderegulation"A functional role of microRNAs miRNAs or miRs in n ......"20957176
hsa-miR-200a-3p

melanomadownregulation"Here we demonstrate a significant correlation betw ......"22956368
hsa-miR-200a-3p

melanomaupregulation"Arsenic exposed Keratinocytes Exhibit Differential ......"27054085qPCR
hsa-miR-200a-3p

ovarian cancerupregulation"To identify the micro-ribonucleic acids miRNAs exp ......"24816756qPCR
hsa-miR-200a-3p

ovarian cancerupregulation"miR 200a overexpression in advanced ovarian carcin ......"25374174qPCR; Microarray
hsa-miR-200a-3p

ovarian cancerupregulation"The prognostic value of the miR 200 family in ovar ......"26910180
hsa-miR-200a-3p

prostate cancerupregulation"Here we demonstrate the involvement of miR-200 b i ......"24391862
hsa-miR-200a-3p

sarcomaderegulation"The most significantly downregulated miRNAs were m ......"24027049
hsa-miR-200a-3p

thyroid cancerupregulation"The miR-200 family was recently identified as a su ......"22797360
hsa-miR-200a-3p

thyroid cancerdownregulation"MiR 200 Regulates Epithelial Mesenchymal Transitio ......"25542369



Reported cancer pathway affected by hsa-miR-200a-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-200a-3p

breast cancercell cycle pathway; Apoptosis pathway"The genes encoding microRNAs of the human miR-200 ......"20514023Luciferase
hsa-miR-200a-3p

breast cancerEpithelial mesenchymal transition pathway"Phosphoglucose isomerase/autocrine motility factor ......"21389093
hsa-miR-200a-3p

breast cancerEpithelial mesenchymal transition pathway"Global miRNA expression profiling was performed on ......"22294488
hsa-miR-200a-3p

breast cancerEpithelial mesenchymal transition pathway"Epigenetic modulation of the miR 200 family is ass ......"23525011
hsa-miR-200a-3p

breast cancerEpithelial mesenchymal transition pathway"MiR 200 can repress breast cancer metastasis throu ......"24037528
hsa-miR-200a-3p

breast cancerEpithelial mesenchymal transition pathway"Some miRNAs especially the miR-200 family miR-9 an ......"25086633
hsa-miR-200a-3p

breast cancerWnt signaling pathway; Apoptosis pathway; Notch signaling pathway"The miRNAs and their clusters such as the miR-200 ......"26712794
hsa-miR-200a-3p

colon cancerEpithelial mesenchymal transition pathway"MicroRNA 200 miR 200 cluster regulation by achaete ......"25371200
hsa-miR-200a-3p

colon cancerApoptosis pathway; Notch signaling pathway"Niclosamide inhibits colon cancer progression thro ......"27460529Flow cytometry; Cell migration assay
hsa-miR-200a-3p

colorectal cancerApoptosis pathway; Epithelial mesenchymal transition pathway"MiR 200a regulates epithelial to mesenchymal trans ......"24504363
hsa-miR-200a-3p

colorectal cancerEpithelial mesenchymal transition pathway"Epithelial-mesenchymal transition EMT and changes ......"25757925
hsa-miR-200a-3p

colorectal cancerApoptosis pathway"Expression of miR 200a in colorectal carcinoma cel ......"25818799Cell migration assay
hsa-miR-200a-3p

colorectal cancerEpithelial mesenchymal transition pathway"The miR-200 family presented as the most powerful ......"27157610
hsa-miR-200a-3p

endometrial cancerEpithelial mesenchymal transition pathway"Tamoxifen represses miR 200 microRNAs and promotes ......"23295740
hsa-miR-200a-3p

endometrial cancerApoptosis pathway"Moreover the study explored the involvement of mic ......"27497669Western blot; Wound Healing Assay
hsa-miR-200a-3p

gastric cancerEpithelial mesenchymal transition pathway"The microRNA-200 miR-200 family has been reported ......"22311119
hsa-miR-200a-3p

gastric cancerEpithelial mesenchymal transition pathway"In addition the microRNA miR-200 family plays a ce ......"25411357
hsa-miR-200a-3p

glioblastomaEpithelial mesenchymal transition pathway"NPV LDE 225 Erismodegib inhibits epithelial mesenc ......"23482671Luciferase; Western blot
hsa-miR-200a-3p

head and neck cancerEpithelial mesenchymal transition pathway"Epithelial-mesenchymal-transition EMT is a critica ......"24424572
hsa-miR-200a-3p

kidney renal cell cancerApoptosis pathway"MicroRNA 200a 3p suppresses tumor proliferation an ......"26797273
hsa-miR-200a-3p

liver cancercell cycle pathway"Expression of the microRNA-200 miR-200 family has ......"23760980Flow cytometry; MTT assay
hsa-miR-200a-3p

liver cancercell cycle pathway"microRNA 200a is an independent prognostic factor ......"24009066Western blot
hsa-miR-200a-3p

liver cancerEpithelial mesenchymal transition pathway"We investigated the diagnostic impact of microRNA- ......"24895326
hsa-miR-200a-3p

liver cancerEpithelial mesenchymal transition pathway"Overexpression of miR 200a suppresses epithelial m ......"25412960
hsa-miR-200a-3p

liver cancerEpithelial mesenchymal transition pathway"MiR-200 family is an important regulator of epithe ......"25909223
hsa-miR-200a-3p

liver cancerEpithelial mesenchymal transition pathway; Apoptosis pathway"MicroRNA 200a inhibits epithelial mesenchymal tran ......"26617701Western blot; Wound Healing Assay; MTT assay
hsa-miR-200a-3p

liver cancerEpithelial mesenchymal transition pathway"LncRNA HULC enhances epithelial mesenchymal transi ......"27285757
hsa-miR-200a-3p

lung cancerEpithelial mesenchymal transition pathway"BMP4 depletion by miR 200 inhibits tumorigenesis a ......"26395571Western blot; Luciferase
hsa-miR-200a-3p

lung cancerEpithelial mesenchymal transition pathway"Microarray analysis using 2000 probes revealed 87 ......"27189341
hsa-miR-200a-3p

lung squamous cell cancerEpithelial mesenchymal transition pathway"The microRNA‑200 miR-200 family is a powerful re ......"23708087Western blot
hsa-miR-200a-3p

lung squamous cell cancerEpithelial mesenchymal transition pathway"The difference in miRNA expression profiles betwee ......"26783187
hsa-miR-200a-3p

ovarian cancerEpithelial mesenchymal transition pathway"Differences in miRNA expression between HGSC CCC a ......"24512620
hsa-miR-200a-3p

ovarian cancerEpithelial mesenchymal transition pathway"Epithelial mesenchymal transition associated miRNA ......"24952258
hsa-miR-200a-3p

ovarian cancercell cycle pathway"Upregulation of microRNA 200a associates with tumo ......"25997962Colony formation
hsa-miR-200a-3p

ovarian cancerEpithelial mesenchymal transition pathway"The miR 200 family differentially regulates sensit ......"26025631
hsa-miR-200a-3p

pancreatic cancerEpithelial mesenchymal transition pathway"MiR 200a inhibits epithelial mesenchymal transitio ......"24521357
hsa-miR-200a-3p

prostate cancerEpithelial mesenchymal transition pathway"miR 200 regulates PDGF D mediated epithelial mesen ......"19544444
hsa-miR-200a-3p

prostate cancerApoptosis pathway"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-200a-3p

thyroid cancerEpithelial mesenchymal transition pathway"We identified two significantly decreased microRNA ......"20498632
hsa-miR-200a-3p

thyroid cancerEpithelial mesenchymal transition pathway"The miR 200 family regulates the epithelial mesenc ......"22797360Western blot
hsa-miR-200a-3p

thyroid cancerEpithelial mesenchymal transition pathway"MiR 200 Regulates Epithelial Mesenchymal Transitio ......"25542369Western blot



Reported cancer prognosis affected by hsa-miR-200a-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-200a-3p

B cell lymphomaworse prognosis"Inhibition of ZEB1 by miR 200 characterizes Helico ......"24390222
hsa-miR-200a-3p

bladder cancerdrug resistance; cell migration"miR 200 expression regulates epithelial to mesench ......"19671845Western blot; Luciferase
hsa-miR-200a-3p

bladder cancerstaging; progression"Coordinated epigenetic repression of the miR 200 f ......"20473948
hsa-miR-200a-3p

bladder cancerrecurrence"Datasets of GSE20418 and GSE19717 were used for an ......"22961325
hsa-miR-200a-3p

bladder cancermalignant trasformation"We screened 723 miRNAs by microarray and selected ......"23945108
hsa-miR-200a-3p

breast cancerdrug resistance"The drug resistance of MCF-7/ADR cells was evaluat ......"18971180Flow cytometry; MTT assay
hsa-miR-200a-3p

breast cancermetastasis"miR 200 enhances mouse breast cancer cell coloniza ......"19787069
hsa-miR-200a-3p

breast cancerprogression"The genes encoding microRNAs of the human miR-200 ......"20514023Luciferase
hsa-miR-200a-3p

breast cancermotility; metastasis"Phosphoglucose isomerase/autocrine motility factor ......"21389093
hsa-miR-200a-3p

breast cancermetastasis"Decreased expression of miRNAs of the miR-200 fami ......"21682933
hsa-miR-200a-3p

breast cancermetastasis; staging; progression"Global miRNA expression profiling was performed on ......"22294488
hsa-miR-200a-3p

breast cancerdifferentiation"In order to identify which miRNAs are involved in ......"22562546
hsa-miR-200a-3p

breast cancerdifferentiation"As the family of miR-200 microRNAs has been shown ......"23112837
hsa-miR-200a-3p

breast cancermetastasis; drug resistance"MicroRNA 200a promotes anoikis resistance and meta ......"23340296Luciferase; Colony formation
hsa-miR-200a-3p

breast cancerprogression"Epigenetic modulation of the miR 200 family is ass ......"23525011
hsa-miR-200a-3p

breast cancerdrug resistance; progression"Reduced expression of miR 200 family members contr ......"23626803
hsa-miR-200a-3p

breast cancermetastasis"Whole genome miR array analysis using PELP1-overex ......"23975430
hsa-miR-200a-3p

breast cancermetastasis; staging; poor survival"MiR 200 can repress breast cancer metastasis throu ......"24037528
hsa-miR-200a-3p

breast cancerprogression"Loss of microRNA 200a expression correlates with t ......"24280074
hsa-miR-200a-3p

breast cancermetastasis"The expression of miRNAs in patients with primary ......"24846313
hsa-miR-200a-3p

breast cancermetastasis; cell migration"The microRNA-200 miR-200 family is found to inhibi ......"24925028
hsa-miR-200a-3p

breast cancermetastasis; progression"Members of three miRNA families i.e miR-17 miR-200 ......"25001613
hsa-miR-200a-3p

breast cancerworse prognosis"Some miRNAs especially the miR-200 family miR-9 an ......"25086633
hsa-miR-200a-3p

breast cancerdrug resistance"We created a doxorubicin-resistant MCF-7 MCF-/Adr ......"25451164MTT assay
hsa-miR-200a-3p

breast cancerdrug resistance"Therefore we investigated the role of known EMT re ......"25746005
hsa-miR-200a-3p

breast cancerprogression"ADAM12 L is a direct target of the miR 29 and miR ......"25886595Western blot; Luciferase
hsa-miR-200a-3p

breast cancermetastasis"The upregulation of fibronectin and lysyl oxidase ......"26068592
hsa-miR-200a-3p

breast cancerpoor survival; cell migration; metastasis"miR 200a inhibits migration of triple negative bre ......"26088362
hsa-miR-200a-3p

breast cancermetastasis"These included miR-141 miR-144 miR-193b miR-200a m ......"26785733
hsa-miR-200a-3p

breast cancerdifferentiation"miR 9 and miR 200 Regulate PDGFRβ Mediated Endoth ......"27402080
hsa-miR-200a-3p

breast cancerprogression; poor survival"We identified eight microRNAs miR-10a miR-10b miR- ......"27433802
hsa-miR-200a-3p

breast cancerpoor survival"In this multicenter study a 10-miRNA classifier in ......"27566954
hsa-miR-200a-3p

breast cancerdrug resistance"Loss of expression of miR-200 family members has b ......"27717206
hsa-miR-200a-3p

breast cancerdrug resistance"Specifically we will discuss key miRNAs involved i ......"27721895
hsa-miR-200a-3p

cervical and endocervical cancerpoor survival; motility"Using an established PCR-based miRNA assay to anal ......"20124485
hsa-miR-200a-3p

cervical and endocervical cancerstaging; progression"An initial screening of miRNA expression was perfo ......"26171195
hsa-miR-200a-3p

colon cancerprogression"Niclosamide inhibits colon cancer progression thro ......"27460529Flow cytometry; Cell migration assay
hsa-miR-200a-3p

colorectal cancermetastasis"Applying real-time PCR we detected the expression ......"21827717
hsa-miR-200a-3p

colorectal cancermetastasis"Although the microRNA-200 miR-200 family is a cruc ......"22735571
hsa-miR-200a-3p

colorectal cancermetastasis; staging"Here we used in situ hybridization and immunohisto ......"23441132
hsa-miR-200a-3p

colorectal cancerstaging; metastasis"In the first phase we selected candidate miRNAs as ......"23982750
hsa-miR-200a-3p

colorectal cancerworse prognosis; poor survival"MiR 200a regulates epithelial to mesenchymal trans ......"24504363
hsa-miR-200a-3p

colorectal cancerpoor survival; staging"Role of miR 200 family members in survival of colo ......"24510588
hsa-miR-200a-3p

colorectal cancermetastasis"The processes of EMT and metastasis are highly reg ......"25422078
hsa-miR-200a-3p

colorectal cancerdrug resistance"Epithelial-mesenchymal transition EMT and changes ......"25757925
hsa-miR-200a-3p

colorectal cancermetastasis"Expression of miR 200a in colorectal carcinoma cel ......"25818799Cell migration assay
hsa-miR-200a-3p

colorectal cancermetastasis"MiR 200 suppresses metastases of colorectal cancer ......"26242262Luciferase
hsa-miR-200a-3p

colorectal cancerworse prognosis; poor survival"The miR-200 family presented as the most powerful ......"27157610
hsa-miR-200a-3p

colorectal cancerworse prognosis"Plasma miR 122 and miR 200 family are prognostic m ......"27632639
hsa-miR-200a-3p

endometrial cancertumorigenesis"We compared the expression profiles of 723 human m ......"21897839
hsa-miR-200a-3p

endometrial cancermotility; drug resistance"Tamoxifen represses miR 200 microRNAs and promotes ......"23295740
hsa-miR-200a-3p

endometrial cancertumorigenesis"The miRNA profiles were analyzed by miRNA microarr ......"24742567
hsa-miR-200a-3p

endometrial cancermetastasis; poor survival"The expression level of miR-200a was significantly ......"26045795
hsa-miR-200a-3p

endometrial cancermetastasis"The abnormal expression of the long noncoding RNA ......"27693631
hsa-miR-200a-3p

esophageal cancerpoor survival"In this study we selected 10 miRNAs and analyzed t ......"20309880
hsa-miR-200a-3p

gastric cancertumorigenesis"The effect of microRNA abnormalities in carcinogen ......"20484038
hsa-miR-200a-3p

gastric cancerdifferentiation"The microRNA-200 miR-200 family has been reported ......"22311119
hsa-miR-200a-3p

gastric cancerworse prognosis"Integrated microRNA network analyses identify a po ......"24352645
hsa-miR-200a-3p

gastric cancermetastasis"In addition the microRNA miR-200 family plays a ce ......"25411357
hsa-miR-200a-3p

gastric cancertumorigenesis; progression"Although microRNA-200 miR-200 family members are t ......"25502084Wound Healing Assay
hsa-miR-200a-3p

gastric cancerstaging; metastasis"In the first step of this study preliminary experi ......"26233325
hsa-miR-200a-3p

glioblastomametastasis"We determined CSF levels of several cancer-associa ......"22492962
hsa-miR-200a-3p

head and neck cancermetastasis; tumorigenesis"Epithelial-mesenchymal-transition EMT is a critica ......"24424572
hsa-miR-200a-3p

kidney renal cell cancerprogression; tumorigenesis"MicroRNA-429 miR-429 a short noncoding RNA belongi ......"25953723
hsa-miR-200a-3p

kidney renal cell cancerstaging"Comparisons of RCC and BC expression signatures re ......"27357429
hsa-miR-200a-3p

liver cancermalignant trasformation"Our study identified and validated miR-224 overexp ......"18433021
hsa-miR-200a-3p

liver cancercell migration"MicroRNA 200a and 200b mediated hepatocellular car ......"22868917Cell migration assay
hsa-miR-200a-3p

liver cancermetastasis"Epigenetic activation of the MiR 200 family contri ......"23222811
hsa-miR-200a-3p

liver cancerdrug resistance"Expression of the microRNA-200 miR-200 family has ......"23760980Flow cytometry; MTT assay
hsa-miR-200a-3p

liver cancermetastasis; progression"The aim of this study was to assess the role of th ......"24135722
hsa-miR-200a-3p

liver cancerstaging; progression"An expression analysis of miR 200a in serum and li ......"25203708
hsa-miR-200a-3p

liver cancerpoor survival; worse prognosis"Eleven miRNAs miR- miR-19a miR-101-3p miR-199a-5p ......"25275448
hsa-miR-200a-3p

liver cancerworse prognosis; metastasis; progression; poor survival"miR 200a suppresses cell growth and migration by t ......"25482402
hsa-miR-200a-3p

liver cancermetastasis"MicroRNA 200a suppresses metastatic potential of s ......"25797260
hsa-miR-200a-3p

liver cancertumorigenesis; cell migration; metastasis"MiR-200 family is an important regulator of epithe ......"25909223
hsa-miR-200a-3p

liver cancermetastasis; tumorigenesis"LncRNA HULC enhances epithelial mesenchymal transi ......"27285757
hsa-miR-200a-3p

lung cancermetastasis; worse prognosis; tumorigenesis"miR 200 Inhibits lung adenocarcinoma cell invasion ......"21115742
hsa-miR-200a-3p

lung cancermetastasis"The Notch ligand Jagged2 promotes lung adenocarcin ......"21403400
hsa-miR-200a-3p

lung cancerdifferentiation"The rBM 3-D culture-specific miRNA profile was hig ......"23036707
hsa-miR-200a-3p

lung cancermetastasis"Loss of miR-200s has been shown to enhance cancer ......"24791940
hsa-miR-200a-3p

lung cancermetastasis; cell migration"The miR 200 family and the miR 183~96~182 cluster ......"25798833
hsa-miR-200a-3p

lung cancerstaging; tumorigenesis"MicroRNA-200 miR-200 has emerged as a regulator of ......"26314828
hsa-miR-200a-3p

lung cancermetastasis; tumorigenesis"BMP4 depletion by miR 200 inhibits tumorigenesis a ......"26395571Western blot; Luciferase
hsa-miR-200a-3p

lung cancerstaging"Microarray analysis using 2000 probes revealed 87 ......"27189341
hsa-miR-200a-3p

lung cancerprogression"Interestingly mir-200 family mir-200a mir-200b and ......"27695346
hsa-miR-200a-3p

lung squamous cell cancermetastasis; immune resistance"The microRNA‑200 miR-200 family is a powerful re ......"23708087Western blot
hsa-miR-200a-3p

lung squamous cell cancerworse prognosis; staging"The miRNA family miR-200 has been associated with ......"25003366
hsa-miR-200a-3p

lung squamous cell cancerdrug resistance; cell migration"MicroRNA 200a Targets EGFR and c Met to Inhibit Mi ......"26184032
hsa-miR-200a-3p

lung squamous cell cancerprogression; tumorigenesis"The microRNA miR-200 family has been demonstrated ......"27602157
hsa-miR-200a-3p

lymphomaprogression"The profiles of miRNAs in conjunctival MALT lympho ......"22183793Luciferase
hsa-miR-200a-3p

melanomametastasis; progression; cell migration"A functional role of microRNAs miRNAs or miRs in n ......"20957176
hsa-miR-200a-3p

melanomaprogression; metastasis"Loss of microRNA 200a and c and microRNA 203 expre ......"22956368
hsa-miR-200a-3p

melanomatumorigenesis"Arsenic exposed Keratinocytes Exhibit Differential ......"27054085
hsa-miR-200a-3p

ovarian cancerworse prognosis"The microRNA expression profiles were examined usi ......"18451233
hsa-miR-200a-3p

ovarian cancerstaging"Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......"18589210
hsa-miR-200a-3p

ovarian cancerstaging; poor survival; recurrence; cell migration"A miR 200 microRNA cluster as prognostic marker in ......"19501389
hsa-miR-200a-3p

ovarian cancertumorigenesis"Regulation of miR 200 family microRNAs and ZEB tra ......"19854497Luciferase
hsa-miR-200a-3p

ovarian cancerworse prognosis"We highlight the role of the let-7 and miR-200 fam ......"20083225
hsa-miR-200a-3p

ovarian cancerprogression; poor survival; drug resistance"The miR 200 family controls beta tubulin III expre ......"21051560
hsa-miR-200a-3p

ovarian cancerprogression"MicroRNA 200a inhibits CD133/1+ ovarian cancer ste ......"21529905Western blot; Luciferase; Wound Healing Assay
hsa-miR-200a-3p

ovarian cancerpoor survival; recurrence"In this study miR-187 and miR-200a were found to b ......"21725366
hsa-miR-200a-3p

ovarian cancerworse prognosis; staging"Two families of miRNAs miR-200 and let-7 are frequ ......"23237306
hsa-miR-200a-3p

ovarian cancerstaging"The biphasic expression pattern of miR 200a and E ......"23888941
hsa-miR-200a-3p

ovarian cancerdrug resistance"Sequence variation among members of the miR 200 mi ......"24447705
hsa-miR-200a-3p

ovarian cancerpoor survival; progression; worse prognosis"The role of miR 200a in vasculogenic mimicry and i ......"24503464Western blot; Luciferase
hsa-miR-200a-3p

ovarian cancerprogression; poor survival"Differences in miRNA expression between HGSC CCC a ......"24512620
hsa-miR-200a-3p

ovarian cancermetastasis; recurrence"We recently determined that the ectopic over-expre ......"24802724
hsa-miR-200a-3p

ovarian cancerdrug resistance"Hybridization was carried out on miRNA microarray ......"24805828
hsa-miR-200a-3p

ovarian cancermetastasis; drug resistance"For example deficiencies of enzymes including Dice ......"24822185
hsa-miR-200a-3p

ovarian cancerprogression; metastasis"Epithelial mesenchymal transition associated miRNA ......"24952258
hsa-miR-200a-3p

ovarian cancerpoor survival; staging; progression"Clinicopathological and prognostic implications of ......"24966949
hsa-miR-200a-3p

ovarian cancerdrug resistance"Involvement of miR 200a in chemosensitivity regula ......"25327865Western blot; Luciferase
hsa-miR-200a-3p

ovarian cancerstaging; progression"miR 200a overexpression in advanced ovarian carcin ......"25374174
hsa-miR-200a-3p

ovarian cancerpoor survival"The authors used quantitative polymerase chain rea ......"25556270Western blot
hsa-miR-200a-3p

ovarian cancerdrug resistance"Upregulation of microRNA 200a associates with tumo ......"25997962Colony formation
hsa-miR-200a-3p

ovarian cancerprogression; staging; worse prognosis; poor survival"Expression of serum miR 200a miR 200b and miR 200c ......"26063644
hsa-miR-200a-3p

ovarian cancerprogression; poor survival"The prognostic value of the miR 200 family in ovar ......"26910180
hsa-miR-200a-3p

ovarian cancermalignant trasformation; staging; metastasis"Diagnostic and prognostic relevance of circulating ......"26943577
hsa-miR-200a-3p

ovarian cancermetastasis"The miR-200 family especially miR-200c has been sh ......"27601996
hsa-miR-200a-3p

ovarian cancerpoor survival"Furthermore some of the identified DNA-methylated ......"27746113
hsa-miR-200a-3p

ovarian cancermalignant trasformation"Circulating Cell Free miR 373 miR 200a miR 200b an ......"27753009
hsa-miR-200a-3p

pancreatic cancermetastasis"Additionally the miR-200 family regulates several ......"24040120Luciferase
hsa-miR-200a-3p

pancreatic cancercell migration"MiR 200a inhibits epithelial mesenchymal transitio ......"24521357
hsa-miR-200a-3p

prostate cancerstaging"Biochemical relapse following radical prostatectom ......"22161972
hsa-miR-200a-3p

prostate cancermetastasis"Regulation of epithelial plasticity by miR 424 and ......"24193225
hsa-miR-200a-3p

prostate cancermetastasis; progression"Here we demonstrate the involvement of miR-200 b i ......"24391862
hsa-miR-200a-3p

prostate cancerpoor survival"Non-responders to docetaxel and patients with shor ......"24714754
hsa-miR-200a-3p

prostate cancerprogression; tumorigenesis"Expression of 1205 human miRNAs and miRNA*s were e ......"25768283
hsa-miR-200a-3p

prostate cancerdrug resistance"Nevertheless decreased expressions of tumor suppre ......"26843836
hsa-miR-200a-3p

sarcomatumorigenesis"MiR-141 which belong to miR-200 family take a part ......"24307282
hsa-miR-200a-3p

thyroid cancercell migration"However specific miRNAs are downregulated in ATC s ......"25202329



Reported gene related to hsa-miR-200a-3p

miRNAcancergenereportingPUBMED
hsa-miR-200a-3p

breast cancerCDH1"β1 integrin inhibition elicits a prometastatic sw ......"24518294
hsa-miR-200a-3p

breast cancerCDH1"These findings are surprising since the miR-200 fa ......"19787069
hsa-miR-200a-3p

breast cancerCDH1"Here we demonstrate that the tumor suppressive miR ......"26062653
hsa-miR-200a-3p

breast cancerCDH1"We establish that miR-200a directs cell migration ......"26088362
hsa-miR-200a-3p

endometrial cancerCDH1"Moreover the study explored the involvement of mic ......"27497669
hsa-miR-200a-3p

gastric cancerCDH1"E-cadherin expression was partially restored by tr ......"20484038
hsa-miR-200a-3p

liver cancerCDH1"Spearman's Rho analysis revealed a significant neg ......"24895326
hsa-miR-200a-3p

liver cancerCDH1"We found that overexpression of miR-200 family mem ......"22868917
hsa-miR-200a-3p

lung cancerCDH1"However the expression of miR-200a was not signifi ......"27189341
hsa-miR-200a-3p

melanomaCDH1"MiR-200 in situ hybridization and E-cadherin immun ......"22956368
hsa-miR-200a-3p

ovarian cancerCDH1"The biphasic expression pattern of miR 200a and E ......"23888941
hsa-miR-200a-3p

ovarian cancerCDH1"Our findings showed that miR-101 represents a redu ......"24677166
hsa-miR-200a-3p

ovarian cancerCDH1"MicroRNA 200a inhibits CD133/1+ ovarian cancer ste ......"21529905
hsa-miR-200a-3p

pancreatic cancerCDH1"In a panel of 23 pancreatic cell lines we observed ......"20551052
hsa-miR-200a-3p

thyroid cancerCDH1"Restoration of miR-200 expression by pre-miR-200a/ ......"25542369
hsa-miR-200a-3p

B cell lymphomaZEB1"Inhibition of ZEB1 by miR 200 characterizes Helico ......"24390222
hsa-miR-200a-3p

bladder cancerZEB1"ZEB1 is also known to repress miR-200c-141 transcr ......"20473948
hsa-miR-200a-3p

breast cancerZEB1"Conversely ectopic expression of miR-200 inhibited ......"27402080
hsa-miR-200a-3p

breast cancerZEB1"Concomitant with miR-200 decrease there was an inc ......"23626803
hsa-miR-200a-3p

breast cancerZEB1"MiR 200 can repress breast cancer metastasis throu ......"24037528
hsa-miR-200a-3p

colorectal cancerZEB1"MiR 200 suppresses metastases of colorectal cancer ......"26242262
hsa-miR-200a-3p

endometrial cancerZEB1"This finding was accompanied by a sharp downregula ......"23743934
hsa-miR-200a-3p

head and neck cancerZEB1"Furthermore our data suggest that the promoter hyp ......"24424572
hsa-miR-200a-3p

ovarian cancerZEB1"We used qRT-PCR to examine expression of the miR-2 ......"19854497
hsa-miR-200a-3p

ovarian cancerZEB1"GRHL2 miR 200 ZEB1 maintains the epithelial status ......"26887977
hsa-miR-200a-3p

prostate cancerZEB1"Recent studies have shown that the miR-200 family ......"19544444
hsa-miR-200a-3p

sarcomaZEB1"This circuit comprises the microRNA 200 miR-200 fa ......"27402864
hsa-miR-200a-3p

sarcomaZEB1"Moreover a series of loss-of-function and gain-of- ......"24815002
hsa-miR-200a-3p

breast cancerZEB2"This switch involved activation of the transformin ......"24518294
hsa-miR-200a-3p

breast cancerZEB2"These findings are surprising since the miR-200 fa ......"19787069
hsa-miR-200a-3p

head and neck cancerZEB2"Furthermore our data suggest that the promoter hyp ......"24424572
hsa-miR-200a-3p

liver cancerZEB2"MicroRNA 200a suppresses metastatic potential of s ......"25797260
hsa-miR-200a-3p

ovarian cancerZEB2"We used qRT-PCR to examine expression of the miR-2 ......"19854497
hsa-miR-200a-3p

ovarian cancerZEB2"MicroRNA 200a inhibits CD133/1+ ovarian cancer ste ......"21529905
hsa-miR-200a-3p

prostate cancerZEB2"Recent studies have shown that the miR-200 family ......"19544444
hsa-miR-200a-3p

sarcomaZEB2"Moreover a series of loss-of-function and gain-of- ......"24815002
hsa-miR-200a-3p

breast cancerEPHA2"Our studies propose EphA2 as a novel and important ......"22562546
hsa-miR-200a-3p

breast cancerEPHA2"miR 200a inhibits migration of triple negative bre ......"26088362
hsa-miR-200a-3p

ovarian cancerEPHA2"In addition our results suggested that miR-200a in ......"24503464
hsa-miR-200a-3p

endometrial cancerPTEN"PTEN might be a potential target of miR-141 and mi ......"24742567
hsa-miR-200a-3p

pancreatic cancerPTEN"Re expression of miR 200 by novel approaches regul ......"22637745
hsa-miR-200a-3p

pancreatic cancerPTEN"Anti tumor activity of a novel compound CDF is med ......"21408027
hsa-miR-200a-3p

liver cancerVIM"Spearman's Rho analysis revealed a significant neg ......"24895326
hsa-miR-200a-3p

prostate cancerVIM"In contrast mesenchymal markers fibronectin and vi ......"24391862
hsa-miR-200a-3p

thyroid cancerVIM"Restoration of miR-200 expression by pre-miR-200a/ ......"25542369
hsa-miR-200a-3p

liver cancerAFP"Real-time quantitative PCR and enzyme-linked immun ......"25203708
hsa-miR-200a-3p

liver cancerAFP"Multivariate analysis demonstrated that AFP satell ......"25275448
hsa-miR-200a-3p

thyroid cancerATM"However specific miRNAs are downregulated in ATC s ......"25202329
hsa-miR-200a-3p

thyroid cancerATM"This study was set to study the molecular mechanis ......"25542369
hsa-miR-200a-3p

pancreatic cancerCD44"Pancreatic cancer cells with EMT phenotype display ......"24521357
hsa-miR-200a-3p

pancreatic cancerCD44"In the current study we showed for the first time ......"21408027
hsa-miR-200a-3p

bladder cancerEGFR"Protein expression and signaling pathway modulatio ......"19671845
hsa-miR-200a-3p

lung squamous cell cancerEGFR"MicroRNA 200a Targets EGFR and c Met to Inhibit Mi ......"26184032
hsa-miR-200a-3p

ovarian cancerGRHL2"GRHL2 miR 200 ZEB1 maintains the epithelial status ......"26887977
hsa-miR-200a-3p

sarcomaGRHL2"This circuit comprises the microRNA 200 miR-200 fa ......"27402864
hsa-miR-200a-3p

breast cancerKEAP1"miR 200a regulates Nrf2 activation by targeting Ke ......"21926171
hsa-miR-200a-3p

esophageal cancerKEAP1"MSA could also significantly induce miR-200a expre ......"26341629
hsa-miR-200a-3p

lung cancerQRSL1"It was reported that miR-200 can activate PI3K/AKT ......"26314828
hsa-miR-200a-3p

lung cancerQRSL1"Mechanistically Jagged2 was found to promote metas ......"21403400
hsa-miR-200a-3p

breast cancerTAM"miR-200 family expression was progressively reduce ......"23626803
hsa-miR-200a-3p

endometrial cancerTAM"When treated with TAM ECC-1 and Ishikawa cells wer ......"23295740
hsa-miR-200a-3p

ovarian cancerABCB6"Furthermore miR-200a regulation of chemoresistance ......"25327865
hsa-miR-200a-3p

ovarian cancerABCG2"Finally the interaction between miR-200a and ABCG2 ......"25327865
hsa-miR-200a-3p

ovarian cancerABCG4"Furthermore miR-200a regulation of chemoresistance ......"25327865
hsa-miR-200a-3p

breast cancerADAM12"ADAM12 L is a direct target of the miR 29 and miR ......"25886595
hsa-miR-200a-3p

lung cancerAKT2"These results suggest that AKT2 can regulate miR-2 ......"27189341
hsa-miR-200a-3p

prostate cancerAR"We identified miR-200 b as a downstream target of ......"24391862
hsa-miR-200a-3p

lung squamous cell cancerATRX"Additionally miR-200 family downregulates HNRNPR3 ......"23708087
hsa-miR-200a-3p

B cell lymphomaBCL6"In 30 H pylori-positive and 30 H pylori-negative g ......"24390222
hsa-miR-200a-3p

lung cancerBMP4"BMP4 depletion by miR 200 inhibits tumorigenesis a ......"26395571
hsa-miR-200a-3p

colon cancerCCL16"This observation indicates a common molecular axis ......"25832648
hsa-miR-200a-3p

lymphomaCCNE2"Targetscan analysis suggested cyclin E2 as potenti ......"22183793
hsa-miR-200a-3p

pancreatic cancerCD24"Pancreatic cancer cells with EMT phenotype display ......"24521357
hsa-miR-200a-3p

colorectal cancerCD2AP"Importantly epigenetic silencing of the miR-200 fa ......"27157610
hsa-miR-200a-3p

liver cancerCDK6"microRNA 200a is an independent prognostic factor ......"24009066
hsa-miR-200a-3p

melanomaCHL1"Overall our findings call into question the genera ......"20957176
hsa-miR-200a-3p

thyroid cancerCHST14"We identified two significantly decreased microRNA ......"20498632
hsa-miR-200a-3p

liver cancerCXCL1"Using computational analysis we identified the mic ......"27542259
hsa-miR-200a-3p

prostate cancerDICER1"These findings suggest possibilities that miR-200a ......"25768283
hsa-miR-200a-3p

bladder cancerEGF"miR 200 expression regulates epithelial to mesench ......"19671845
hsa-miR-200a-3p

pancreatic cancerEPCAM"In the current study we showed for the first time ......"21408027
hsa-miR-200a-3p

breast cancerFERMT2"Here we report that Kindlin 2 markedly downregulat ......"23483548
hsa-miR-200a-3p

lung cancerFLT1"Forced miR-200 expression suppressed Flt1 levels i ......"21115742
hsa-miR-200a-3p

prostate cancerFN1"In contrast mesenchymal markers fibronectin and vi ......"24391862
hsa-miR-200a-3p

lung cancerFOXF2"The miR 200 family and the miR 183~96~182 cluster ......"25798833
hsa-miR-200a-3p

breast cancerFOXM1"SUMOylation of FOXM1B alters its transcriptional a ......"24918286
hsa-miR-200a-3p

lung cancerGATA3"Reciprocally miR-200 inhibited expression of Gata3 ......"21403400
hsa-miR-200a-3p

breast cancerGJA1"Identification of miR 200a as a novel suppressor o ......"26283635
hsa-miR-200a-3p

prostate cancerGNA13"MicroRNA 182 and microRNA 200a control G protein s ......"23329838
hsa-miR-200a-3p

prostate cancerGNB2"MicroRNA 182 and microRNA 200a control G protein s ......"23329838
hsa-miR-200a-3p

liver cancerH19"Epigenetic activation of the MiR 200 family contri ......"23222811
hsa-miR-200a-3p

liver cancerHDAC4"Furthermore our results suggested that the histone ......"21837748
hsa-miR-200a-3p

lung squamous cell cancerHFE"Additionally miR-200 family downregulates HNRNPR3 ......"23708087
hsa-miR-200a-3p

lung squamous cell cancerHMI"The miR-200 family and these potential targets are ......"23708087
hsa-miR-200a-3p

liver cancerHULC"LncRNA HULC enhances epithelial mesenchymal transi ......"27285757
hsa-miR-200a-3p

lung cancerIRS1"Taken together our results suggest that miR-200 ma ......"26314828
hsa-miR-200a-3p

breast cancerITGA9"β1 integrin inhibition elicits a prometastatic sw ......"24518294
hsa-miR-200a-3p

lung cancerJAG2"The Notch ligand Jagged2 promotes lung adenocarcin ......"21403400
hsa-miR-200a-3p

endometrial cancerKCNE1"Furthermore it was observed that the expression pa ......"26788150
hsa-miR-200a-3p

esophageal cancerKLF4"Moreover MSA-induced miR-200a expression was depen ......"26341629
hsa-miR-200a-3p

kidney renal cell cancerLARP6"In addition our study uncovered that miR-200a-3p d ......"26797273
hsa-miR-200a-3p

breast cancerLOC100128922"Identification of miR 200a as a novel suppressor o ......"26283635
hsa-miR-200a-3p

liver cancerMACC1"miR 200a suppresses cell growth and migration by t ......"25482402
hsa-miR-200a-3p

endometrial cancerMALAT1"The abnormal expression of the long noncoding RNA ......"27693631
hsa-miR-200a-3p

breast cancerMAPK8"SUMOylation of FOXM1B alters its transcriptional a ......"24918286
hsa-miR-200a-3p

lung squamous cell cancerMET"MicroRNA 200a Targets EGFR and c Met to Inhibit Mi ......"26184032
hsa-miR-200a-3p

pancreatic cancerMMP14"Re expression of miR 200 by novel approaches regul ......"22637745
hsa-miR-200a-3p

ovarian cancerMMP2"Interestingly our findings show that catalpol trea ......"25347277
hsa-miR-200a-3p

breast cancerMSN"MiR 200 can repress breast cancer metastasis throu ......"24037528
hsa-miR-200a-3p

endometrial cancerMYC"Tamoxifen represses miR 200 microRNAs and promotes ......"23295740
hsa-miR-200a-3p

lymphomaPCNA"Targetscan analysis suggested cyclin E2 as potenti ......"22183793
hsa-miR-200a-3p

prostate cancerPDGFD"miR 200 regulates PDGF D mediated epithelial mesen ......"19544444
hsa-miR-200a-3p

breast cancerPELP1"Whole genome miR array analysis using PELP1-overex ......"23975430
hsa-miR-200a-3p

breast cancerPHLDA3"Our data indicate that Kindlin 2 plays a novel rol ......"23483548
hsa-miR-200a-3p

pancreatic cancerPTGS2"In a xenograft mouse model of human PC CDF treatme ......"21408027
hsa-miR-200a-3p

breast cancerSGSM3"The genes encoding microRNAs of the human miR-200 ......"20514023
hsa-miR-200a-3p

breast cancerSLC10A4"Here we investigated P4 downregulation of miR-141 ......"25241899
hsa-miR-200a-3p

colorectal cancerSNAI1"EMT-TFs and microRNAs such as ZEB1/2 and miR-200 o ......"27573895
hsa-miR-200a-3p

kidney renal cell cancerSPAG9"MicroRNA 200a 3p suppresses tumor proliferation an ......"26797273
hsa-miR-200a-3p

endometrial cancerSPEN"This finding was accompanied by a sharp downregula ......"23743934
hsa-miR-200a-3p

breast cancerTFAM"In this study we showed that miR-200a expression l ......"24684598
hsa-miR-200a-3p

thyroid cancerTGFB1"Inhibition of TGFbeta receptor 1 TGFBR1 in these c ......"20498632
hsa-miR-200a-3p

kidney renal cell cancerTGFB2"Tumor suppressive microRNA 200a inhibits renal cel ......"25813153
hsa-miR-200a-3p

thyroid cancerTGFBR1"Inhibition of TGFbeta receptor 1 TGFBR1 in these c ......"20498632
hsa-miR-200a-3p

endometrial cancerTIMP2"We found that miR-200b repressed TIMP2 expression ......"23205572
hsa-miR-200a-3p

esophageal cancerTPO"MSA could also significantly induce miR-200a expre ......"26341629
hsa-miR-200a-3p

bladder cancerTWIST1"In addition we observe that the mesoderm transcrip ......"20473948
hsa-miR-200a-3p

kidney renal cell cancerVEGFA"We also found strong anti-correlation between VEGF ......"20420713
hsa-miR-200a-3p

breast cancerYAP1"MicroRNA 200a promotes anoikis resistance and meta ......"23340296
hsa-miR-200a-3p

lung cancerZFPM2"It was reported that miR-200 can activate PI3K/AKT ......"26314828



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-200a-3p
KLHL20
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; OV; PAAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.071; TCGA BRCA -0.126; TCGA CESC -0.084; TCGA COAD -0.089; TCGA HNSC -0.076; TCGA KIRC -0.071; TCGA KIRP -0.157; TCGA OV -0.055; TCGA PAAD -0.056; TCGA STAD -0.082; TCGA UCEC -0.126
hsa-miR-200a-3p
PTPRD
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.485; TCGA BRCA -0.264; TCGA CESC -0.294; TCGA ESCA -0.382; TCGA HNSC -0.517; TCGA LUSC -0.37; TCGA OV -0.458; TCGA PAAD -0.225; TCGA STAD -0.272; TCGA UCEC -0.347
hsa-miR-200a-3p
RAB30
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; OV; PAAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.198; TCGA CESC -0.166; TCGA COAD -0.153; TCGA ESCA -0.092; TCGA HNSC -0.219; TCGA KIRP -0.369; TCGA LIHC -0.066; TCGA LUAD -0.101; TCGA OV -0.135; TCGA PAAD -0.166; TCGA STAD -0.136; TCGA UCEC -0.166
hsa-miR-200a-3p
RASSF2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.095; TCGA BRCA -0.122; TCGA CESC -0.147; TCGA COAD -0.455; TCGA ESCA -0.136; TCGA HNSC -0.286; TCGA KIRC -0.413; TCGA LUAD -0.141; TCGA LUSC -0.476; TCGA OV -0.084; TCGA PAAD -0.485; TCGA PRAD -0.07; TCGA STAD -0.244; TCGA UCEC -0.254
hsa-miR-200a-3p
RIN2
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PAAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.133; TCGA BRCA -0.072; TCGA CESC -0.101; TCGA ESCA -0.069; TCGA HNSC -0.111; TCGA KIRC -0.055; TCGA LUAD -0.063; TCGA PAAD -0.063; TCGA UCEC -0.08
hsa-miR-200a-3p
SEPT7
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNAWalker2 validate; MirTarget; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.073; TCGA CESC -0.094; TCGA COAD -0.103; TCGA ESCA -0.087; TCGA HNSC -0.083; TCGA KIRC -0.114; TCGA LUAD -0.104; TCGA LUSC -0.054; TCGA OV -0.086; TCGA PAAD -0.121; TCGA STAD -0.124; TCGA UCEC -0.12
hsa-miR-200a-3p
SHC1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; OV; PAAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.063; TCGA CESC -0.159; TCGA COAD -0.054; TCGA ESCA -0.089; TCGA HNSC -0.1; TCGA KIRC -0.247; TCGA OV -0.075; TCGA PAAD -0.073; TCGA UCEC -0.051
hsa-miR-200a-3p
TCF7L1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; OV; PAAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.317; TCGA BRCA -0.151; TCGA CESC -0.203; TCGA COAD -0.326; TCGA ESCA -0.382; TCGA KIRC -0.07; TCGA KIRP -0.195; TCGA OV -0.145; TCGA PAAD -0.18; TCGA STAD -0.405; TCGA UCEC -0.079
hsa-miR-200a-3p
VCAM1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.343; TCGA BRCA -0.192; TCGA CESC -0.238; TCGA COAD -0.505; TCGA ESCA -0.118; TCGA HNSC -0.366; TCGA LUAD -0.225; TCGA LUSC -0.436; TCGA OV -0.213; TCGA PAAD -0.394; TCGA PRAD -0.097; TCGA STAD -0.117; TCGA UCEC -0.295
hsa-miR-200a-3p
WASF3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.101; TCGA BRCA -0.406; TCGA CESC -0.371; TCGA COAD -0.603; TCGA ESCA -0.258; TCGA HNSC -0.142; TCGA LUSC -0.331; TCGA OV -0.186; TCGA PAAD -0.218; TCGA THCA -0.08; TCGA STAD -0.376; TCGA UCEC -0.242
hsa-miR-200a-3p
YAP1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRNAWalker2 validate; MirTarget
TCGA BLCA -0.116; TCGA BRCA -0.179; TCGA CESC -0.205; TCGA COAD -0.085; TCGA ESCA -0.071; TCGA HNSC -0.128; TCGA LUAD -0.07; TCGA PAAD -0.161; TCGA STAD -0.118; TCGA UCEC -0.108
hsa-miR-200a-3p
ZEB1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.369; TCGA BRCA -0.32; TCGA CESC -0.321; TCGA COAD -0.575; TCGA ESCA -0.213; TCGA HNSC -0.468; TCGA KIRC -0.205; TCGA KIRP -0.159; TCGA LUAD -0.186; TCGA LUSC -0.387; TCGA OV -0.259; TCGA PAAD -0.279; TCGA PRAD -0.089; TCGA STAD -0.452; TCGA UCEC -0.446
hsa-miR-200a-3p
ZEB2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP
TCGA BLCA -0.407; TCGA BRCA -0.35; TCGA CESC -0.338; TCGA COAD -0.505; TCGA ESCA -0.209; TCGA HNSC -0.505; TCGA KIRC -0.187; TCGA LUAD -0.247; TCGA LUSC -0.531; TCGA PAAD -0.376; TCGA PRAD -0.103; TCGA STAD -0.259; TCGA UCEC -0.337
hsa-miR-200a-3p
ZFPM2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase
TCGA BLCA -0.516; TCGA BRCA -0.372; TCGA CESC -0.29; TCGA COAD -0.715; TCGA ESCA -0.38; TCGA HNSC -0.526; TCGA KIRC -0.326; TCGA KIRP -0.27; TCGA LUAD -0.257; TCGA LUSC -0.54; TCGA OV -0.179; TCGA PAAD -0.42; TCGA PRAD -0.201; TCGA STAD -0.525; TCGA UCEC -0.624
hsa-miR-200a-3p
WIPF1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.354; TCGA BRCA -0.168; TCGA CESC -0.291; TCGA COAD -0.415; TCGA ESCA -0.224; TCGA HNSC -0.309; TCGA KIRC -0.301; TCGA KIRP -0.234; TCGA LUAD -0.186; TCGA LUSC -0.349; TCGA OV -0.106; TCGA PAAD -0.367; TCGA STAD -0.193; TCGA UCEC -0.198
hsa-miR-200a-3p
TMEFF1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; UCEC
MirTarget
TCGA BLCA -0.121; TCGA BRCA -0.061; TCGA CESC -0.12; TCGA COAD -0.318; TCGA ESCA -0.188; TCGA HNSC -0.165; TCGA KIRC -0.222; TCGA KIRP -0.532; TCGA LUAD -0.167; TCGA OV -0.177; TCGA PAAD -0.143; TCGA UCEC -0.121
hsa-miR-200a-3p
ABL2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
MirTarget; miRNATAP
TCGA BLCA -0.137; TCGA CESC -0.135; TCGA COAD -0.131; TCGA ESCA -0.1; TCGA HNSC -0.195; TCGA KIRC -0.216; TCGA KIRP -0.102; TCGA LUAD -0.069; TCGA LUSC -0.156; TCGA PAAD -0.193
hsa-miR-200a-3p
CBL
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.082; TCGA BRCA -0.107; TCGA CESC -0.068; TCGA COAD -0.059; TCGA ESCA -0.05; TCGA HNSC -0.129; TCGA KIRC -0.115; TCGA KIRP -0.104; TCGA LUAD -0.13; TCGA LUSC -0.059; TCGA PAAD -0.137; TCGA PRAD -0.073; TCGA STAD -0.088; TCGA UCEC -0.109
hsa-miR-200a-3p
KPNA3
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD
MirTarget; miRNATAP
TCGA BLCA -0.106; TCGA BRCA -0.083; TCGA HNSC -0.134; TCGA KIRC -0.056; TCGA KIRP -0.103; TCGA LUAD -0.137; TCGA OV -0.079; TCGA PAAD -0.077; TCGA PRAD -0.057
hsa-miR-200a-3p
TCF4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.243; TCGA BRCA -0.295; TCGA CESC -0.15; TCGA COAD -0.465; TCGA ESCA -0.168; TCGA HNSC -0.236; TCGA KIRC -0.281; TCGA KIRP -0.159; TCGA LUAD -0.167; TCGA LUSC -0.123; TCGA OV -0.142; TCGA PAAD -0.33; TCGA PRAD -0.059; TCGA STAD -0.215; TCGA UCEC -0.224
hsa-miR-200a-3p
CLIC4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.381; TCGA BRCA -0.115; TCGA CESC -0.215; TCGA COAD -0.373; TCGA ESCA -0.246; TCGA HNSC -0.164; TCGA LUAD -0.193; TCGA LUSC -0.175; TCGA PAAD -0.247; TCGA PRAD -0.113; TCGA STAD -0.351; TCGA UCEC -0.218
hsa-miR-200a-3p
KIF17
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.255; TCGA BRCA -0.19; TCGA CESC -0.276; TCGA COAD -0.532; TCGA ESCA -0.281; TCGA LUAD -0.228; TCGA LUSC -0.344; TCGA PAAD -0.366; TCGA STAD -0.187; TCGA UCEC -0.152
hsa-miR-200a-3p
KLF12
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.277; TCGA BRCA -0.129; TCGA COAD -0.264; TCGA ESCA -0.211; TCGA HNSC -0.178; TCGA LIHC -0.089; TCGA LUAD -0.1; TCGA LUSC -0.199; TCGA OV -0.084; TCGA PAAD -0.252; TCGA PRAD -0.106; TCGA STAD -0.265; TCGA UCEC -0.178
hsa-miR-200a-3p
RAB11FIP2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.05; TCGA BRCA -0.145; TCGA CESC -0.129; TCGA COAD -0.132; TCGA HNSC -0.138; TCGA LIHC -0.055; TCGA LUAD -0.083; TCGA LUSC -0.199; TCGA PAAD -0.091; TCGA STAD -0.142; TCGA UCEC -0.186
hsa-miR-200a-3p
WWTR1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.296; TCGA BRCA -0.183; TCGA COAD -0.657; TCGA ESCA -0.249; TCGA HNSC -0.249; TCGA KIRP -0.22; TCGA LUAD -0.168; TCGA LUSC -0.103; TCGA PAAD -0.225; TCGA PRAD -0.109; TCGA STAD -0.367; TCGA UCEC -0.091
hsa-miR-200a-3p
GEM
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.489; TCGA BRCA -0.273; TCGA CESC -0.195; TCGA COAD -0.495; TCGA ESCA -0.139; TCGA HNSC -0.337; TCGA KIRC -0.179; TCGA KIRP -0.16; TCGA LUSC -0.402; TCGA OV -0.293; TCGA PAAD -0.3; TCGA PRAD -0.098; TCGA STAD -0.391; TCGA UCEC -0.338
hsa-miR-200a-3p
CCND2
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; STAD; UCEC
MirTarget
TCGA BLCA -0.323; TCGA BRCA -0.261; TCGA CESC -0.415; TCGA ESCA -0.158; TCGA HNSC -0.1; TCGA KIRC -0.213; TCGA LUAD -0.174; TCGA STAD -0.219; TCGA UCEC -0.349
hsa-miR-200a-3p
TGFB2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.35; TCGA BRCA -0.157; TCGA CESC -0.351; TCGA COAD -0.393; TCGA ESCA -0.252; TCGA HNSC -0.246; TCGA LUAD -0.154; TCGA LUSC -0.269; TCGA PAAD -0.165; TCGA PRAD -0.082; TCGA STAD -0.19; TCGA UCEC -0.173
hsa-miR-200a-3p
STAT4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
MirTarget
TCGA BLCA -0.282; TCGA BRCA -0.214; TCGA CESC -0.283; TCGA COAD -0.266; TCGA ESCA -0.143; TCGA HNSC -0.149; TCGA KIRC -0.34; TCGA KIRP -0.311; TCGA LUAD -0.126; TCGA LUSC -0.369; TCGA PAAD -0.437; TCGA UCEC -0.063
hsa-miR-200a-3p
RFTN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.227; TCGA BRCA -0.225; TCGA CESC -0.351; TCGA COAD -0.395; TCGA ESCA -0.243; TCGA HNSC -0.288; TCGA KIRC -0.198; TCGA KIRP -0.388; TCGA LIHC -0.071; TCGA LUSC -0.467; TCGA PAAD -0.316; TCGA PRAD -0.108; TCGA STAD -0.169; TCGA UCEC -0.264
hsa-miR-200a-3p
VCAN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.33; TCGA BRCA -0.115; TCGA CESC -0.339; TCGA COAD -0.554; TCGA ESCA -0.173; TCGA HNSC -0.623; TCGA KIRC -0.397; TCGA LUAD -0.181; TCGA LUSC -0.249; TCGA OV -0.275; TCGA PAAD -0.284; TCGA PRAD -0.111; TCGA STAD -0.086
hsa-miR-200a-3p
CDC42EP3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.214; TCGA BRCA -0.131; TCGA CESC -0.241; TCGA COAD -0.269; TCGA ESCA -0.27; TCGA HNSC -0.287; TCGA LUAD -0.111; TCGA LUSC -0.228; TCGA OV -0.08; TCGA PAAD -0.108; TCGA PRAD -0.094; TCGA STAD -0.344; TCGA UCEC -0.245
hsa-miR-200a-3p
ERG
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.209; TCGA BRCA -0.329; TCGA CESC -0.358; TCGA COAD -0.473; TCGA ESCA -0.151; TCGA HNSC -0.268; TCGA KIRC -0.141; TCGA KIRP -0.196; TCGA LUAD -0.165; TCGA LUSC -0.319; TCGA OV -0.119; TCGA PAAD -0.36; TCGA STAD -0.213; TCGA UCEC -0.209
hsa-miR-200a-3p
SV2B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.458; TCGA BRCA -0.395; TCGA CESC -0.394; TCGA COAD -0.929; TCGA ESCA -0.425; TCGA HNSC -0.355; TCGA KIRP -0.63; TCGA LUAD -0.244; TCGA OV -0.303; TCGA PAAD -0.289; TCGA STAD -0.391; TCGA UCEC -0.361
hsa-miR-200a-3p
DUSP3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.161; TCGA BRCA -0.097; TCGA COAD -0.096; TCGA ESCA -0.069; TCGA HNSC -0.179; TCGA KIRP -0.193; TCGA LUAD -0.085; TCGA LUSC -0.16; TCGA PAAD -0.069; TCGA PRAD -0.057; TCGA STAD -0.215; TCGA UCEC -0.109
hsa-miR-200a-3p
PAPPA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.344; TCGA BRCA -0.225; TCGA CESC -0.497; TCGA COAD -0.47; TCGA ESCA -0.196; TCGA HNSC -0.454; TCGA LUSC -0.293; TCGA OV -0.274; TCGA PAAD -0.256; TCGA PRAD -0.07; TCGA STAD -0.157; TCGA UCEC -0.449
hsa-miR-200a-3p
UNC5C
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.413; TCGA BRCA -0.247; TCGA COAD -0.38; TCGA HNSC -0.566; TCGA KIRP -0.34; TCGA LUAD -0.22; TCGA LUSC -0.705; TCGA OV -0.425; TCGA PAAD -0.327; TCGA PRAD -0.139; TCGA STAD -0.074; TCGA UCEC -0.168
hsa-miR-200a-3p
MAP7D1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.087; TCGA CESC -0.163; TCGA COAD -0.17; TCGA ESCA -0.216; TCGA HNSC -0.158; TCGA KIRC -0.114; TCGA LUAD -0.104; TCGA LUSC -0.137; TCGA OV -0.065; TCGA STAD -0.242; TCGA UCEC -0.082
hsa-miR-200a-3p
ADARB1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.287; TCGA BRCA -0.114; TCGA CESC -0.228; TCGA COAD -0.228; TCGA ESCA -0.268; TCGA HNSC -0.179; TCGA KIRC -0.115; TCGA LUAD -0.136; TCGA LUSC -0.419; TCGA PAAD -0.276; TCGA STAD -0.315; TCGA UCEC -0.223
hsa-miR-200a-3p
GNG7
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.085; TCGA CESC -0.308; TCGA COAD -0.271; TCGA ESCA -0.201; TCGA HNSC -0.131; TCGA LUSC -0.383; TCGA PAAD -0.23; TCGA STAD -0.422; TCGA UCEC -0.41
hsa-miR-200a-3p
IRS2
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.154; TCGA BRCA -0.176; TCGA HNSC -0.142; TCGA KIRC -0.113; TCGA KIRP -0.279; TCGA LIHC -0.099; TCGA LUSC -0.309; TCGA OV -0.114; TCGA STAD -0.116; TCGA UCEC -0.329
hsa-miR-200a-3p
RORA
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.16; TCGA BRCA -0.151; TCGA CESC -0.125; TCGA COAD -0.424; TCGA ESCA -0.176; TCGA HNSC -0.138; TCGA LIHC -0.086; TCGA PAAD -0.221; TCGA STAD -0.265; TCGA UCEC -0.168
hsa-miR-200a-3p
PFKM
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.106; TCGA CESC -0.206; TCGA ESCA -0.096; TCGA HNSC -0.203; TCGA KIRP -0.231; TCGA LUAD -0.067; TCGA THCA -0.066; TCGA STAD -0.188; TCGA UCEC -0.235
hsa-miR-200a-3p
ZCCHC24
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.349; TCGA BRCA -0.347; TCGA CESC -0.29; TCGA COAD -0.471; TCGA ESCA -0.312; TCGA HNSC -0.457; TCGA KIRC -0.167; TCGA KIRP -0.343; TCGA LIHC -0.061; TCGA LUAD -0.112; TCGA LUSC -0.424; TCGA OV -0.273; TCGA PAAD -0.325; TCGA PRAD -0.089; TCGA STAD -0.47; TCGA UCEC -0.451
hsa-miR-200a-3p
ANGPTL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.638; TCGA BRCA -0.662; TCGA CESC -0.465; TCGA COAD -1.439; TCGA ESCA -0.428; TCGA HNSC -0.801; TCGA KIRP -0.325; TCGA LUAD -0.252; TCGA LUSC -0.727; TCGA OV -0.363; TCGA PAAD -0.547; TCGA PRAD -0.162; TCGA STAD -0.906; TCGA UCEC -0.596
hsa-miR-200a-3p
TTBK2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.117; TCGA BRCA -0.238; TCGA CESC -0.123; TCGA COAD -0.216; TCGA ESCA -0.173; TCGA HNSC -0.209; TCGA KIRP -0.173; TCGA LUAD -0.086; TCGA PAAD -0.149; TCGA PRAD -0.079; TCGA STAD -0.225; TCGA UCEC -0.163
hsa-miR-200a-3p
PLCL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.332; TCGA BRCA -0.18; TCGA CESC -0.425; TCGA COAD -0.393; TCGA ESCA -0.172; TCGA HNSC -0.415; TCGA LUAD -0.117; TCGA LUSC -0.374; TCGA OV -0.103; TCGA PAAD -0.316; TCGA PRAD -0.233; TCGA STAD -0.388; TCGA UCEC -0.444
hsa-miR-200a-3p
DYNC1I1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; OV; PRAD; STAD
MirTarget
TCGA BLCA -0.127; TCGA BRCA -0.246; TCGA CESC -0.236; TCGA COAD -0.611; TCGA ESCA -0.314; TCGA KIRC -0.134; TCGA KIRP -0.966; TCGA LIHC -0.274; TCGA OV -0.384; TCGA PRAD -0.069; TCGA STAD -0.564
hsa-miR-200a-3p
PRKACB
12 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.09; TCGA BRCA -0.1; TCGA CESC -0.104; TCGA HNSC -0.241; TCGA LIHC -0.076; TCGA LUAD -0.079; TCGA LUSC -0.167; TCGA OV -0.147; TCGA PRAD -0.07; TCGA THCA -0.054; TCGA STAD -0.23; TCGA UCEC -0.199
hsa-miR-200a-3p
CCDC80
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.633; TCGA BRCA -0.438; TCGA CESC -0.389; TCGA COAD -0.829; TCGA ESCA -0.521; TCGA HNSC -0.475; TCGA KIRC -0.278; TCGA KIRP -0.637; TCGA LUAD -0.297; TCGA LUSC -0.315; TCGA OV -0.361; TCGA PAAD -0.51; TCGA PRAD -0.171; TCGA STAD -0.563; TCGA UCEC -0.409
hsa-miR-200a-3p
LHFP
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.282; TCGA BRCA -0.382; TCGA CESC -0.3; TCGA COAD -0.545; TCGA ESCA -0.283; TCGA HNSC -0.35; TCGA KIRC -0.25; TCGA KIRP -0.364; TCGA LUAD -0.136; TCGA LUSC -0.4; TCGA OV -0.16; TCGA PAAD -0.3; TCGA STAD -0.312; TCGA UCEC -0.331
hsa-miR-200a-3p
TMEM110
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD
MirTarget; miRNATAP
TCGA BLCA -0.05; TCGA CESC -0.053; TCGA ESCA -0.058; TCGA HNSC -0.081; TCGA KIRP -0.115; TCGA LIHC -0.098; TCGA LUAD -0.062; TCGA LUSC -0.165; TCGA PAAD -0.107
hsa-miR-200a-3p
ACO1
10 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget
TCGA BLCA -0.118; TCGA BRCA -0.256; TCGA HNSC -0.118; TCGA KIRP -0.298; TCGA LIHC -0.09; TCGA LUAD -0.089; TCGA LUSC -0.175; TCGA PAAD -0.075; TCGA PRAD -0.05; TCGA UCEC -0.093
hsa-miR-200a-3p
ZDHHC15
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.262; TCGA BRCA -0.165; TCGA COAD -0.712; TCGA ESCA -0.263; TCGA HNSC -0.18; TCGA LUSC -0.281; TCGA PAAD -0.139; TCGA STAD -0.5; TCGA UCEC -0.295
hsa-miR-200a-3p
PHYHIPL
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; OV; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.263; TCGA COAD -0.487; TCGA ESCA -0.188; TCGA HNSC -0.128; TCGA LUSC -0.228; TCGA OV -0.228; TCGA PRAD -0.083; TCGA STAD -0.357
hsa-miR-200a-3p
TTLL7
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; THCA; STAD
MirTarget
TCGA BLCA -0.287; TCGA BRCA -0.22; TCGA COAD -0.517; TCGA HNSC -0.241; TCGA KIRC -0.223; TCGA LIHC -0.176; TCGA LUAD -0.137; TCGA LUSC -0.217; TCGA OV -0.205; TCGA THCA -0.075; TCGA STAD -0.446
hsa-miR-200a-3p
NECAB1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.389; TCGA BRCA -0.362; TCGA CESC -0.438; TCGA COAD -0.791; TCGA ESCA -0.416; TCGA HNSC -0.213; TCGA LUAD -0.208; TCGA LUSC -0.461; TCGA OV -0.281; TCGA PAAD -0.205; TCGA STAD -0.699; TCGA UCEC -0.602
hsa-miR-200a-3p
ATXN1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.235; TCGA BRCA -0.084; TCGA CESC -0.081; TCGA COAD -0.134; TCGA ESCA -0.095; TCGA HNSC -0.183; TCGA KIRC -0.115; TCGA LUAD -0.078; TCGA PAAD -0.143; TCGA STAD -0.21; TCGA UCEC -0.104
hsa-miR-200a-3p
GSN
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.243; TCGA BRCA -0.311; TCGA COAD -0.162; TCGA ESCA -0.176; TCGA HNSC -0.082; TCGA KIRC -0.122; TCGA LUSC -0.154; TCGA PRAD -0.074; TCGA STAD -0.327; TCGA UCEC -0.202
hsa-miR-200a-3p
ST3GAL3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.138; TCGA BRCA -0.107; TCGA CESC -0.079; TCGA COAD -0.162; TCGA ESCA -0.241; TCGA HNSC -0.059; TCGA LIHC -0.113; TCGA OV -0.061; TCGA PAAD -0.127; TCGA STAD -0.323; TCGA UCEC -0.165
hsa-miR-200a-3p
GIT2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.063; TCGA BRCA -0.081; TCGA CESC -0.072; TCGA COAD -0.084; TCGA ESCA -0.08; TCGA HNSC -0.092; TCGA KIRC -0.216; TCGA KIRP -0.065; TCGA LUAD -0.07; TCGA LUSC -0.123; TCGA PAAD -0.148; TCGA STAD -0.126; TCGA UCEC -0.089
hsa-miR-200a-3p
DCUN1D3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.074; TCGA BRCA -0.163; TCGA CESC -0.085; TCGA COAD -0.078; TCGA HNSC -0.09; TCGA KIRC -0.113; TCGA KIRP -0.067; TCGA LUAD -0.12; TCGA LUSC -0.197; TCGA PAAD -0.099; TCGA STAD -0.053; TCGA UCEC -0.051
hsa-miR-200a-3p
TMEM170B
12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.241; TCGA COAD -0.199; TCGA HNSC -0.202; TCGA KIRP -0.185; TCGA LIHC -0.126; TCGA LUSC -0.125; TCGA OV -0.117; TCGA PAAD -0.177; TCGA PRAD -0.055; TCGA STAD -0.285; TCGA UCEC -0.174
hsa-miR-200a-3p
SPAG9
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.053; TCGA BRCA -0.133; TCGA CESC -0.082; TCGA COAD -0.086; TCGA HNSC -0.122; TCGA KIRC -0.055; TCGA KIRP -0.116; TCGA LUAD -0.085; TCGA LUSC -0.086; TCGA PAAD -0.105; TCGA STAD -0.089; TCGA UCEC -0.128
hsa-miR-200a-3p
PXK
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.159; TCGA BRCA -0.133; TCGA COAD -0.107; TCGA ESCA -0.053; TCGA HNSC -0.215; TCGA KIRP -0.209; TCGA LIHC -0.069; TCGA LUAD -0.159; TCGA LUSC -0.228; TCGA PAAD -0.244; TCGA PRAD -0.071; TCGA STAD -0.084; TCGA UCEC -0.172
hsa-miR-200a-3p
SDC2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.268; TCGA BRCA -0.211; TCGA CESC -0.29; TCGA COAD -0.473; TCGA ESCA -0.208; TCGA HNSC -0.419; TCGA LIHC -0.06; TCGA LUAD -0.124; TCGA LUSC -0.311; TCGA OV -0.23; TCGA PAAD -0.157; TCGA PRAD -0.095; TCGA STAD -0.267; TCGA UCEC -0.195
hsa-miR-200a-3p
APBB2
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.157; TCGA BRCA -0.076; TCGA CESC -0.125; TCGA HNSC -0.221; TCGA LUAD -0.114; TCGA LUSC -0.282; TCGA PAAD -0.11; TCGA PRAD -0.063; TCGA STAD -0.128; TCGA UCEC -0.083
hsa-miR-200a-3p
EGFR
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; STAD
MirTarget
TCGA BLCA -0.167; TCGA BRCA -0.53; TCGA CESC -0.314; TCGA ESCA -0.169; TCGA HNSC -0.186; TCGA KIRC -0.128; TCGA KIRP -0.202; TCGA LUAD -0.136; TCGA PRAD -0.071; TCGA STAD -0.15
hsa-miR-200a-3p
TSHZ3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.359; TCGA BRCA -0.242; TCGA CESC -0.252; TCGA COAD -0.515; TCGA ESCA -0.347; TCGA HNSC -0.343; TCGA KIRC -0.205; TCGA LUAD -0.233; TCGA LUSC -0.243; TCGA OV -0.132; TCGA PAAD -0.234; TCGA STAD -0.407; TCGA UCEC -0.422
hsa-miR-200a-3p
TRIM23
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.075; TCGA BRCA -0.107; TCGA CESC -0.065; TCGA COAD -0.105; TCGA ESCA -0.117; TCGA HNSC -0.137; TCGA KIRC -0.054; TCGA KIRP -0.244; TCGA LIHC -0.08; TCGA LUAD -0.076; TCGA LUSC -0.127; TCGA OV -0.108; TCGA PAAD -0.096; TCGA STAD -0.16; TCGA UCEC -0.161
hsa-miR-200a-3p
TRAM2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
MirTarget
TCGA BLCA -0.2; TCGA BRCA -0.136; TCGA CESC -0.089; TCGA COAD -0.078; TCGA HNSC -0.112; TCGA KIRC -0.139; TCGA KIRP -0.201; TCGA LUAD -0.083; TCGA LUSC -0.059; TCGA PAAD -0.184; TCGA UCEC -0.128
hsa-miR-200a-3p
IL6R
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.28; TCGA BRCA -0.235; TCGA CESC -0.19; TCGA COAD -0.203; TCGA HNSC -0.212; TCGA KIRP -0.368; TCGA LIHC -0.16; TCGA LUSC -0.313; TCGA PAAD -0.177; TCGA PRAD -0.092; TCGA STAD -0.181; TCGA UCEC -0.148
hsa-miR-200a-3p
RNF38
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.056; TCGA BRCA -0.057; TCGA CESC -0.059; TCGA HNSC -0.055; TCGA KIRP -0.065; TCGA LUSC -0.116; TCGA PAAD -0.065; TCGA STAD -0.159; TCGA UCEC -0.149
hsa-miR-200a-3p
LMO3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.317; TCGA BRCA -0.268; TCGA COAD -1.216; TCGA ESCA -0.302; TCGA KIRP -0.394; TCGA LUSC -0.369; TCGA PAAD -0.216; TCGA PRAD -0.122; TCGA STAD -0.682; TCGA UCEC -0.411
hsa-miR-200a-3p
TNS1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.437; TCGA BRCA -0.446; TCGA CESC -0.206; TCGA COAD -0.787; TCGA ESCA -0.336; TCGA HNSC -0.417; TCGA KIRP -0.178; TCGA LUSC -0.439; TCGA PAAD -0.25; TCGA PRAD -0.068; TCGA STAD -0.622; TCGA UCEC -0.388
hsa-miR-200a-3p
ZNF385D
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.367; TCGA BRCA -0.246; TCGA COAD -1.009; TCGA ESCA -0.431; TCGA HNSC -0.534; TCGA LIHC -0.421; TCGA LUAD -0.231; TCGA LUSC -0.599; TCGA OV -0.326; TCGA PAAD -0.527; TCGA PRAD -0.093; TCGA STAD -0.501; TCGA UCEC -0.312
hsa-miR-200a-3p
GAB1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.077; TCGA BRCA -0.098; TCGA CESC -0.082; TCGA ESCA -0.113; TCGA HNSC -0.147; TCGA LUAD -0.12; TCGA LUSC -0.138; TCGA OV -0.067; TCGA PAAD -0.075; TCGA STAD -0.212; TCGA UCEC -0.168
hsa-miR-200a-3p
CRYBG3
9 cancers: BLCA; BRCA; COAD; HNSC; LIHC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.066; TCGA BRCA -0.377; TCGA COAD -0.16; TCGA HNSC -0.098; TCGA LIHC -0.088; TCGA PAAD -0.125; TCGA PRAD -0.054; TCGA STAD -0.141; TCGA UCEC -0.235
hsa-miR-200a-3p
SH2B3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
MirTarget
TCGA BLCA -0.229; TCGA BRCA -0.153; TCGA CESC -0.166; TCGA COAD -0.158; TCGA HNSC -0.269; TCGA KIRC -0.313; TCGA KIRP -0.124; TCGA LUAD -0.199; TCGA LUSC -0.383; TCGA PAAD -0.251; TCGA UCEC -0.148
hsa-miR-200a-3p
HAS2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.354; TCGA BRCA -0.354; TCGA CESC -0.526; TCGA COAD -0.313; TCGA ESCA -0.304; TCGA HNSC -0.461; TCGA LUAD -0.267; TCGA LUSC -0.441; TCGA OV -0.348; TCGA PAAD -0.392; TCGA PRAD -0.087; TCGA STAD -0.096; TCGA UCEC -0.175
hsa-miR-200a-3p
CDK17
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.092; TCGA CESC -0.155; TCGA COAD -0.137; TCGA ESCA -0.147; TCGA HNSC -0.076; TCGA KIRC -0.168; TCGA KIRP -0.06; TCGA LUAD -0.12; TCGA LUSC -0.063; TCGA PAAD -0.121; TCGA STAD -0.12; TCGA UCEC -0.142
hsa-miR-200a-3p
LHX6
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.163; TCGA BRCA -0.282; TCGA CESC -0.254; TCGA COAD -0.455; TCGA ESCA -0.128; TCGA KIRC -0.266; TCGA KIRP -0.203; TCGA LUAD -0.161; TCGA PAAD -0.24; TCGA STAD -0.221; TCGA UCEC -0.148
hsa-miR-200a-3p
ABL1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.148; TCGA BRCA -0.07; TCGA CESC -0.081; TCGA ESCA -0.124; TCGA HNSC -0.168; TCGA KIRC -0.087; TCGA KIRP -0.096; TCGA LUSC -0.089; TCGA PAAD -0.098; TCGA STAD -0.203; TCGA UCEC -0.131
hsa-miR-200a-3p
NRIP3
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.053; TCGA CESC -0.135; TCGA COAD -0.317; TCGA ESCA -0.174; TCGA KIRC -0.113; TCGA KIRP -0.224; TCGA LUAD -0.12; TCGA PAAD -0.222; TCGA STAD -0.229; TCGA UCEC -0.108
hsa-miR-200a-3p
ITGAV
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.132; TCGA BRCA -0.1; TCGA CESC -0.135; TCGA COAD -0.215; TCGA ESCA -0.096; TCGA HNSC -0.175; TCGA KIRP -0.355; TCGA LUAD -0.127; TCGA PAAD -0.122; TCGA STAD -0.093; TCGA UCEC -0.114
hsa-miR-200a-3p
FAT3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.134; TCGA BRCA -0.457; TCGA CESC -0.227; TCGA COAD -0.534; TCGA ESCA -0.514; TCGA HNSC -0.417; TCGA KIRP -0.607; TCGA LUAD -0.191; TCGA LUSC -0.342; TCGA OV -0.314; TCGA PAAD -0.414; TCGA PRAD -0.15; TCGA STAD -0.814; TCGA UCEC -0.361
hsa-miR-200a-3p
KIAA0408
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BLCA -0.48; TCGA BRCA -0.901; TCGA COAD -0.797; TCGA ESCA -0.607; TCGA HNSC -0.609; TCGA LUSC -0.775; TCGA PAAD -0.593; TCGA PRAD -0.278; TCGA STAD -0.657
hsa-miR-200a-3p
PRKD1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.136; TCGA BRCA -0.349; TCGA CESC -0.197; TCGA COAD -0.724; TCGA ESCA -0.322; TCGA HNSC -0.245; TCGA LUAD -0.086; TCGA LUSC -0.266; TCGA OV -0.235; TCGA PAAD -0.218; TCGA STAD -0.358; TCGA UCEC -0.266
hsa-miR-200a-3p
CD274
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
MirTarget
TCGA BLCA -0.32; TCGA BRCA -0.105; TCGA CESC -0.349; TCGA COAD -0.253; TCGA ESCA -0.197; TCGA HNSC -0.28; TCGA KIRP -0.667; TCGA LUAD -0.46; TCGA LUSC -0.375; TCGA PAAD -0.253; TCGA PRAD -0.069; TCGA THCA -0.063
hsa-miR-200a-3p
STX2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.364; TCGA BRCA -0.127; TCGA CESC -0.089; TCGA COAD -0.216; TCGA ESCA -0.137; TCGA HNSC -0.19; TCGA KIRC -0.13; TCGA LUAD -0.085; TCGA LUSC -0.298; TCGA OV -0.087; TCGA PAAD -0.12; TCGA PRAD -0.085; TCGA STAD -0.25; TCGA UCEC -0.232
hsa-miR-200a-3p
PLEK
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
MirTarget
TCGA BLCA -0.442; TCGA BRCA -0.098; TCGA CESC -0.271; TCGA COAD -0.325; TCGA ESCA -0.182; TCGA HNSC -0.319; TCGA KIRC -0.368; TCGA KIRP -0.389; TCGA LUAD -0.255; TCGA LUSC -0.439; TCGA PAAD -0.529; TCGA PRAD -0.063
hsa-miR-200a-3p
SLC16A7
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; OV; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.19; TCGA BRCA -0.577; TCGA COAD -0.451; TCGA HNSC -0.231; TCGA KIRP -0.587; TCGA OV -0.241; TCGA PRAD -0.108; TCGA THCA -0.072; TCGA STAD -0.278; TCGA UCEC -0.353
hsa-miR-200a-3p
STAT5B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.166; TCGA CESC -0.14; TCGA COAD -0.108; TCGA ESCA -0.063; TCGA HNSC -0.147; TCGA LUAD -0.057; TCGA LUSC -0.138; TCGA PAAD -0.104; TCGA STAD -0.194; TCGA UCEC -0.215
hsa-miR-200a-3p
PPM1K
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.217; TCGA BRCA -0.064; TCGA CESC -0.149; TCGA COAD -0.161; TCGA HNSC -0.15; TCGA KIRP -0.3; TCGA LIHC -0.058; TCGA LUAD -0.113; TCGA LUSC -0.305; TCGA PAAD -0.278; TCGA PRAD -0.062; TCGA STAD -0.254; TCGA UCEC -0.249
hsa-miR-200a-3p
GJC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.223; TCGA BRCA -0.145; TCGA CESC -0.241; TCGA COAD -0.45; TCGA ESCA -0.244; TCGA HNSC -0.275; TCGA KIRC -0.556; TCGA KIRP -0.344; TCGA LUAD -0.163; TCGA LUSC -0.141; TCGA OV -0.224; TCGA PAAD -0.233; TCGA PRAD -0.118; TCGA STAD -0.438; TCGA UCEC -0.399
hsa-miR-200a-3p
SCHIP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; OV; PAAD; UCEC
MirTarget
TCGA BLCA -0.203; TCGA BRCA -0.134; TCGA CESC -0.105; TCGA COAD -0.459; TCGA ESCA -0.287; TCGA HNSC -0.1; TCGA LIHC -0.068; TCGA LUAD -0.168; TCGA OV -0.123; TCGA PAAD -0.216; TCGA UCEC -0.178
hsa-miR-200a-3p
FRMD4A
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.152; TCGA CESC -0.1; TCGA COAD -0.206; TCGA ESCA -0.148; TCGA HNSC -0.134; TCGA LUAD -0.168; TCGA LUSC -0.22; TCGA PAAD -0.303; TCGA STAD -0.227
hsa-miR-200a-3p
FAM20C
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; STAD; UCEC
MirTarget
TCGA BLCA -0.436; TCGA BRCA -0.09; TCGA CESC -0.117; TCGA COAD -0.439; TCGA ESCA -0.235; TCGA HNSC -0.191; TCGA LUSC -0.126; TCGA STAD -0.219; TCGA UCEC -0.079
hsa-miR-200a-3p
MBNL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.14; TCGA BRCA -0.153; TCGA CESC -0.096; TCGA COAD -0.084; TCGA ESCA -0.128; TCGA HNSC -0.075; TCGA KIRC -0.114; TCGA KIRP -0.09; TCGA LUAD -0.082; TCGA PAAD -0.179; TCGA PRAD -0.056; TCGA STAD -0.175; TCGA UCEC -0.131
hsa-miR-200a-3p
TNS3
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD
MirTarget; miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.146; TCGA CESC -0.095; TCGA COAD -0.132; TCGA HNSC -0.407; TCGA KIRP -0.124; TCGA LUAD -0.193; TCGA LUSC -0.476; TCGA PAAD -0.149
hsa-miR-200a-3p
SULF2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; UCEC
MirTarget
TCGA BLCA -0.409; TCGA CESC -0.356; TCGA COAD -0.227; TCGA ESCA -0.204; TCGA HNSC -0.302; TCGA KIRC -0.213; TCGA LUAD -0.144; TCGA OV -0.184; TCGA PAAD -0.175; TCGA PRAD -0.062; TCGA UCEC -0.216
hsa-miR-200a-3p
OSBPL8
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.083; TCGA BRCA -0.097; TCGA CESC -0.098; TCGA COAD -0.091; TCGA ESCA -0.068; TCGA HNSC -0.136; TCGA KIRP -0.19; TCGA LUAD -0.131; TCGA OV -0.088; TCGA PAAD -0.172; TCGA STAD -0.061; TCGA UCEC -0.134
hsa-miR-200a-3p
JAZF1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.36; TCGA BRCA -0.187; TCGA CESC -0.256; TCGA COAD -0.444; TCGA ESCA -0.179; TCGA HNSC -0.265; TCGA KIRC -0.248; TCGA KIRP -0.227; TCGA LIHC -0.08; TCGA LUAD -0.083; TCGA LUSC -0.27; TCGA PAAD -0.122; TCGA PRAD -0.091; TCGA STAD -0.271; TCGA UCEC -0.213
hsa-miR-200a-3p
BICD2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.081; TCGA CESC -0.237; TCGA COAD -0.092; TCGA ESCA -0.297; TCGA LUAD -0.092; TCGA OV -0.052; TCGA PAAD -0.21; TCGA STAD -0.175; TCGA UCEC -0.094
hsa-miR-200a-3p
SAMD8
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.089; TCGA BRCA -0.171; TCGA COAD -0.125; TCGA HNSC -0.106; TCGA KIRP -0.21; TCGA LUAD -0.159; TCGA PRAD -0.06; TCGA STAD -0.085; TCGA UCEC -0.051
hsa-miR-200a-3p
GLI2
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.402; TCGA BRCA -0.277; TCGA COAD -0.555; TCGA ESCA -0.231; TCGA KIRC -0.317; TCGA KIRP -0.274; TCGA PAAD -0.258; TCGA STAD -0.266; TCGA UCEC -0.434
hsa-miR-200a-3p
PDGFRA
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.3; TCGA BRCA -0.404; TCGA CESC -0.228; TCGA COAD -0.414; TCGA HNSC -0.419; TCGA LUAD -0.223; TCGA LUSC -0.389; TCGA OV -0.176; TCGA PAAD -0.496; TCGA PRAD -0.105; TCGA STAD -0.132; TCGA UCEC -0.347
hsa-miR-200a-3p
PPFIBP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.153; TCGA BRCA -0.148; TCGA CESC -0.12; TCGA COAD -0.121; TCGA ESCA -0.11; TCGA HNSC -0.204; TCGA LUAD -0.212; TCGA LUSC -0.157; TCGA PAAD -0.092; TCGA PRAD -0.059; TCGA STAD -0.105; TCGA UCEC -0.092
hsa-miR-200a-3p
KCTD20
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.102; TCGA BRCA -0.137; TCGA COAD -0.062; TCGA HNSC -0.131; TCGA KIRC -0.124; TCGA KIRP -0.212; TCGA LUAD -0.096; TCGA LUSC -0.113; TCGA PAAD -0.189; TCGA PRAD -0.056; TCGA STAD -0.114; TCGA UCEC -0.137
hsa-miR-200a-3p
CHRDL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.745; TCGA BRCA -0.746; TCGA CESC -0.591; TCGA COAD -1.515; TCGA ESCA -0.744; TCGA HNSC -0.672; TCGA KIRP -0.727; TCGA LUAD -0.202; TCGA LUSC -0.778; TCGA OV -0.431; TCGA PAAD -0.814; TCGA PRAD -0.158; TCGA STAD -0.946; TCGA UCEC -0.751
hsa-miR-200a-3p
SCN2B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.599; TCGA BRCA -0.627; TCGA CESC -0.497; TCGA COAD -1.043; TCGA ESCA -0.496; TCGA HNSC -0.531; TCGA LUAD -0.195; TCGA LUSC -0.542; TCGA PAAD -0.374; TCGA STAD -0.794; TCGA UCEC -0.649
hsa-miR-200a-3p
SLC25A46
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; UCEC
MirTarget
TCGA BLCA -0.09; TCGA BRCA -0.109; TCGA CESC -0.051; TCGA HNSC -0.162; TCGA KIRP -0.239; TCGA LIHC -0.081; TCGA LUAD -0.091; TCGA LUSC -0.101; TCGA OV -0.057; TCGA PRAD -0.055; TCGA UCEC -0.052
hsa-miR-200a-3p
NFASC
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.237; TCGA BRCA -0.074; TCGA CESC -0.367; TCGA COAD -0.379; TCGA ESCA -0.507; TCGA HNSC -0.138; TCGA LUSC -0.277; TCGA PRAD -0.073; TCGA STAD -0.639; TCGA UCEC -0.349
hsa-miR-200a-3p
COL15A1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.308; TCGA BRCA -0.24; TCGA CESC -0.262; TCGA COAD -0.464; TCGA HNSC -0.441; TCGA KIRC -0.439; TCGA KIRP -0.315; TCGA LUAD -0.254; TCGA LUSC -0.447; TCGA OV -0.127; TCGA PAAD -0.266; TCGA PRAD -0.113; TCGA STAD -0.219; TCGA UCEC -0.287
hsa-miR-200a-3p
WNK1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.086; TCGA BRCA -0.062; TCGA CESC -0.105; TCGA COAD -0.082; TCGA ESCA -0.081; TCGA HNSC -0.167; TCGA KIRP -0.225; TCGA LUAD -0.071; TCGA PRAD -0.075; TCGA STAD -0.115; TCGA UCEC -0.073
hsa-miR-200a-3p
HGF
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.566; TCGA BRCA -0.396; TCGA CESC -0.281; TCGA COAD -0.596; TCGA HNSC -0.464; TCGA KIRP -0.352; TCGA LUAD -0.253; TCGA LUSC -0.653; TCGA OV -0.21; TCGA PAAD -0.52; TCGA PRAD -0.107; TCGA STAD -0.181; TCGA UCEC -0.3
hsa-miR-200a-3p
CYP26B1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.365; TCGA BRCA -0.396; TCGA CESC -0.299; TCGA COAD -0.282; TCGA ESCA -0.219; TCGA HNSC -0.33; TCGA KIRP -0.182; TCGA LUAD -0.201; TCGA LUSC -0.243; TCGA OV -0.345; TCGA PAAD -0.329; TCGA UCEC -0.29
hsa-miR-200a-3p
CNTN1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.634; TCGA BRCA -0.448; TCGA CESC -0.288; TCGA COAD -1.123; TCGA ESCA -0.863; TCGA LUAD -0.338; TCGA PRAD -0.121; TCGA STAD -0.9; TCGA UCEC -0.226
hsa-miR-200a-3p
DOCK4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.153; TCGA BRCA -0.186; TCGA CESC -0.292; TCGA COAD -0.296; TCGA ESCA -0.086; TCGA HNSC -0.244; TCGA KIRC -0.177; TCGA KIRP -0.177; TCGA LUAD -0.167; TCGA LUSC -0.339; TCGA PAAD -0.194; TCGA PRAD -0.06; TCGA STAD -0.13; TCGA UCEC -0.24
hsa-miR-200a-3p
OSBPL6
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PRAD; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.557; TCGA BRCA -0.118; TCGA CESC -0.258; TCGA COAD -0.373; TCGA ESCA -0.625; TCGA HNSC -0.081; TCGA KIRP -0.7; TCGA LUSC -0.177; TCGA OV -0.406; TCGA PRAD -0.05; TCGA THCA -0.09; TCGA STAD -0.335
hsa-miR-200a-3p
ZC3H12C
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.078; TCGA BRCA -0.25; TCGA CESC -0.109; TCGA HNSC -0.151; TCGA KIRP -0.165; TCGA LUAD -0.101; TCGA LUSC -0.112; TCGA PAAD -0.11; TCGA STAD -0.168; TCGA UCEC -0.182
hsa-miR-200a-3p
FRMD6
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.134; TCGA BRCA -0.164; TCGA CESC -0.466; TCGA COAD -0.614; TCGA ESCA -0.497; TCGA HNSC -0.112; TCGA KIRC -0.211; TCGA LUAD -0.234; TCGA OV -0.176; TCGA PAAD -0.333; TCGA STAD -0.389; TCGA UCEC -0.38
hsa-miR-200a-3p
TMEM130
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC
MirTarget
TCGA BLCA -0.246; TCGA BRCA -0.141; TCGA CESC -0.277; TCGA COAD -0.904; TCGA ESCA -0.362; TCGA HNSC -0.35; TCGA LUSC -0.535; TCGA OV -0.165; TCGA STAD -0.549; TCGA UCEC -0.196
hsa-miR-200a-3p
LTBP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.191; TCGA BRCA -0.156; TCGA CESC -0.109; TCGA COAD -0.439; TCGA ESCA -0.329; TCGA HNSC -0.327; TCGA LUAD -0.154; TCGA LUSC -0.108; TCGA PAAD -0.239; TCGA PRAD -0.063; TCGA STAD -0.364; TCGA UCEC -0.099
hsa-miR-200a-3p
OLFM1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.361; TCGA BRCA -0.161; TCGA CESC -0.257; TCGA COAD -0.566; TCGA ESCA -0.345; TCGA LUSC -0.246; TCGA PRAD -0.084; TCGA THCA -0.088; TCGA STAD -0.306; TCGA UCEC -0.496
hsa-miR-200a-3p
LRRC8A
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; OV; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.095; TCGA CESC -0.096; TCGA ESCA -0.114; TCGA KIRC -0.15; TCGA KIRP -0.108; TCGA LUAD -0.056; TCGA OV -0.071; TCGA STAD -0.05; TCGA UCEC -0.068
hsa-miR-200a-3p
HIPK3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.205; TCGA BRCA -0.242; TCGA COAD -0.17; TCGA ESCA -0.074; TCGA HNSC -0.372; TCGA KIRP -0.271; TCGA LUAD -0.132; TCGA LUSC -0.161; TCGA PRAD -0.143; TCGA STAD -0.202; TCGA UCEC -0.164
hsa-miR-200a-3p
PCDH9
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.521; TCGA BRCA -0.554; TCGA COAD -0.721; TCGA ESCA -0.504; TCGA HNSC -0.495; TCGA KIRP -0.288; TCGA LUAD -0.237; TCGA LUSC -0.575; TCGA OV -0.458; TCGA PAAD -0.445; TCGA STAD -0.721; TCGA UCEC -0.246
hsa-miR-200a-3p
FOXN3
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.111; TCGA BRCA -0.309; TCGA COAD -0.126; TCGA ESCA -0.115; TCGA HNSC -0.144; TCGA KIRC -0.107; TCGA KIRP -0.111; TCGA LIHC -0.074; TCGA LUAD -0.066; TCGA OV -0.067; TCGA PAAD -0.194; TCGA PRAD -0.075; TCGA STAD -0.218; TCGA UCEC -0.211
hsa-miR-200a-3p
SCN4A
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.184; TCGA BRCA -0.496; TCGA COAD -0.497; TCGA ESCA -0.165; TCGA HNSC -0.93; TCGA KIRP -0.318; TCGA LIHC -0.178; TCGA LUSC -0.182; TCGA OV -0.348; TCGA PAAD -0.494; TCGA PRAD -0.214; TCGA STAD -0.243; TCGA UCEC -0.187
hsa-miR-200a-3p
AGPAT4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.202; TCGA BRCA -0.179; TCGA CESC -0.17; TCGA COAD -0.316; TCGA ESCA -0.156; TCGA HNSC -0.167; TCGA LUAD -0.116; TCGA LUSC -0.193; TCGA PAAD -0.134; TCGA STAD -0.212; TCGA UCEC -0.076
hsa-miR-200a-3p
GAB2
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.069; TCGA BRCA -0.078; TCGA HNSC -0.218; TCGA KIRC -0.153; TCGA KIRP -0.182; TCGA LUSC -0.38; TCGA PAAD -0.07; TCGA STAD -0.084; TCGA UCEC -0.208
hsa-miR-200a-3p
CELF2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.42; TCGA BRCA -0.351; TCGA CESC -0.233; TCGA ESCA -0.323; TCGA HNSC -0.337; TCGA KIRC -0.138; TCGA LUSC -0.493; TCGA PAAD -0.517; TCGA PRAD -0.107; TCGA STAD -0.402; TCGA UCEC -0.26
hsa-miR-200a-3p
NAV3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.528; TCGA BRCA -0.286; TCGA CESC -0.336; TCGA COAD -0.743; TCGA ESCA -0.476; TCGA HNSC -0.497; TCGA KIRC -0.331; TCGA LUAD -0.314; TCGA LUSC -0.495; TCGA OV -0.129; TCGA PAAD -0.424; TCGA STAD -0.418; TCGA UCEC -0.365
hsa-miR-200a-3p
CYLD
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.156; TCGA BRCA -0.055; TCGA CESC -0.094; TCGA COAD -0.104; TCGA ESCA -0.145; TCGA HNSC -0.149; TCGA KIRP -0.106; TCGA LUAD -0.058; TCGA LUSC -0.219; TCGA PAAD -0.124; TCGA STAD -0.113; TCGA UCEC -0.076
hsa-miR-200a-3p
CD59
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD
mirMAP
TCGA BLCA -0.136; TCGA BRCA -0.088; TCGA CESC -0.177; TCGA COAD -0.1; TCGA ESCA -0.105; TCGA HNSC -0.144; TCGA LUAD -0.073; TCGA LUSC -0.185; TCGA STAD -0.13
hsa-miR-200a-3p
SIGLEC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.459; TCGA BRCA -0.101; TCGA CESC -0.356; TCGA COAD -0.564; TCGA ESCA -0.333; TCGA HNSC -0.366; TCGA KIRC -0.522; TCGA KIRP -0.513; TCGA LUAD -0.268; TCGA LUSC -0.555; TCGA PAAD -0.425; TCGA STAD -0.162
hsa-miR-200a-3p
IRAK3
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUSC; PAAD; PRAD; UCEC
mirMAP
TCGA BLCA -0.235; TCGA BRCA -0.318; TCGA COAD -0.386; TCGA HNSC -0.135; TCGA KIRC -0.195; TCGA LUSC -0.284; TCGA PAAD -0.175; TCGA PRAD -0.071; TCGA UCEC -0.238
hsa-miR-200a-3p
GRAP2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
mirMAP
TCGA BLCA -0.349; TCGA BRCA -0.123; TCGA CESC -0.239; TCGA HNSC -0.151; TCGA KIRC -0.355; TCGA LUAD -0.104; TCGA LUSC -0.395; TCGA PAAD -0.381; TCGA UCEC -0.12
hsa-miR-200a-3p
RASA4
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.107; TCGA BRCA -0.114; TCGA CESC -0.2; TCGA COAD -0.223; TCGA ESCA -0.15; TCGA HNSC -0.201; TCGA KIRC -0.135; TCGA LUSC -0.19; TCGA STAD -0.192; TCGA UCEC -0.24
hsa-miR-200a-3p
PPARGC1A
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUSC; OV; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.453; TCGA BRCA -0.314; TCGA CESC -0.242; TCGA HNSC -0.367; TCGA KIRP -0.277; TCGA LUSC -0.24; TCGA OV -0.549; TCGA THCA -0.152; TCGA STAD -0.132; TCGA UCEC -0.259
hsa-miR-200a-3p
BACH2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.458; TCGA BRCA -0.288; TCGA CESC -0.216; TCGA COAD -0.587; TCGA ESCA -0.366; TCGA HNSC -0.293; TCGA KIRP -0.55; TCGA LUAD -0.175; TCGA OV -0.231; TCGA PAAD -0.477; TCGA STAD -0.269; TCGA UCEC -0.334
hsa-miR-200a-3p
BVES
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.416; TCGA BRCA -0.296; TCGA COAD -0.711; TCGA ESCA -0.419; TCGA HNSC -0.483; TCGA LUAD -0.209; TCGA LUSC -0.269; TCGA OV -0.171; TCGA PAAD -0.235; TCGA THCA -0.061; TCGA STAD -0.607; TCGA UCEC -0.321
hsa-miR-200a-3p
HPCAL4
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.18; TCGA CESC -0.249; TCGA ESCA -0.311; TCGA HNSC -0.257; TCGA KIRP -0.42; TCGA LUSC -0.269; TCGA PAAD -0.329; TCGA PRAD -0.134; TCGA STAD -0.489; TCGA UCEC -0.169
hsa-miR-200a-3p
RIMS3
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.209; TCGA BRCA -0.147; TCGA CESC -0.309; TCGA ESCA -0.188; TCGA HNSC -0.22; TCGA LUSC -0.299; TCGA PRAD -0.072; TCGA STAD -0.38; TCGA UCEC -0.339
hsa-miR-200a-3p
SEPT6
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD
mirMAP
TCGA BLCA -0.236; TCGA COAD -0.182; TCGA ESCA -0.155; TCGA HNSC -0.166; TCGA LUAD -0.08; TCGA LUSC -0.277; TCGA OV -0.08; TCGA PAAD -0.328; TCGA STAD -0.256
hsa-miR-200a-3p
HS3ST3B1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD
mirMAP
TCGA BLCA -0.362; TCGA BRCA -0.115; TCGA CESC -0.226; TCGA ESCA -0.182; TCGA HNSC -0.295; TCGA KIRP -0.34; TCGA LUAD -0.26; TCGA LUSC -0.162; TCGA PRAD -0.082
hsa-miR-200a-3p
HIVEP3
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; STAD
mirMAP
TCGA BLCA -0.215; TCGA CESC -0.292; TCGA COAD -0.16; TCGA ESCA -0.161; TCGA HNSC -0.223; TCGA KIRC -0.08; TCGA KIRP -0.11; TCGA LUAD -0.141; TCGA LUSC -0.257; TCGA STAD -0.074
hsa-miR-200a-3p
WDFY4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.431; TCGA BRCA -0.079; TCGA CESC -0.221; TCGA COAD -0.416; TCGA ESCA -0.229; TCGA HNSC -0.357; TCGA KIRC -0.33; TCGA KIRP -0.3; TCGA LUSC -0.623; TCGA PAAD -0.707; TCGA STAD -0.096
hsa-miR-200a-3p
MAP1B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.45; TCGA BRCA -0.287; TCGA CESC -0.353; TCGA COAD -0.586; TCGA ESCA -0.357; TCGA HNSC -0.369; TCGA KIRC -0.333; TCGA KIRP -0.609; TCGA LUAD -0.23; TCGA OV -0.177; TCGA PAAD -0.171; TCGA PRAD -0.121; TCGA THCA -0.063; TCGA STAD -0.509; TCGA UCEC -0.206
hsa-miR-200a-3p
ETS1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.131; TCGA BRCA -0.227; TCGA CESC -0.217; TCGA COAD -0.296; TCGA HNSC -0.364; TCGA KIRC -0.239; TCGA LUAD -0.224; TCGA LUSC -0.481; TCGA OV -0.088; TCGA PAAD -0.318; TCGA STAD -0.051; TCGA UCEC -0.157
hsa-miR-200a-3p
KIAA1644
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.619; TCGA BRCA -0.127; TCGA CESC -0.582; TCGA COAD -0.846; TCGA ESCA -0.452; TCGA HNSC -0.488; TCGA KIRC -0.44; TCGA KIRP -0.447; TCGA LUSC -0.47; TCGA OV -0.295; TCGA PAAD -0.281; TCGA STAD -0.633; TCGA UCEC -0.547
hsa-miR-200a-3p
NTRK3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.332; TCGA BRCA -0.338; TCGA CESC -0.368; TCGA COAD -0.856; TCGA ESCA -0.266; TCGA HNSC -0.297; TCGA LUSC -0.48; TCGA OV -0.303; TCGA PAAD -0.334; TCGA STAD -0.585; TCGA UCEC -0.391
hsa-miR-200a-3p
FTO
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.086; TCGA BRCA -0.086; TCGA CESC -0.078; TCGA COAD -0.125; TCGA ESCA -0.13; TCGA HNSC -0.152; TCGA KIRC -0.061; TCGA LIHC -0.05; TCGA LUAD -0.056; TCGA LUSC -0.135; TCGA PAAD -0.087; TCGA STAD -0.162; TCGA UCEC -0.117
hsa-miR-200a-3p
WTIP
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.089; TCGA BRCA -0.154; TCGA CESC -0.156; TCGA COAD -0.365; TCGA ESCA -0.279; TCGA HNSC -0.136; TCGA LUSC -0.294; TCGA OV -0.092; TCGA PAAD -0.187; TCGA STAD -0.264; TCGA UCEC -0.191
hsa-miR-200a-3p
COL8A1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.302; TCGA BRCA -0.162; TCGA CESC -0.31; TCGA COAD -0.765; TCGA ESCA -0.231; TCGA HNSC -0.597; TCGA KIRC -0.528; TCGA KIRP -0.406; TCGA LUAD -0.225; TCGA LUSC -0.548; TCGA OV -0.246; TCGA PAAD -0.371; TCGA PRAD -0.084; TCGA STAD -0.358
hsa-miR-200a-3p
TMEM108
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.364; TCGA BRCA -0.131; TCGA COAD -0.474; TCGA ESCA -0.334; TCGA HNSC -0.308; TCGA KIRC -0.205; TCGA KIRP -0.247; TCGA LUSC -0.192; TCGA PAAD -0.25; TCGA PRAD -0.082; TCGA STAD -0.353; TCGA UCEC -0.189
hsa-miR-200a-3p
RNF217
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; STAD
mirMAP
TCGA BLCA -0.324; TCGA BRCA -0.238; TCGA CESC -0.148; TCGA COAD -0.375; TCGA ESCA -0.485; TCGA HNSC -0.087; TCGA KIRC -0.154; TCGA KIRP -0.202; TCGA LIHC -0.164; TCGA LUAD -0.138; TCGA PAAD -0.226; TCGA STAD -0.378
hsa-miR-200a-3p
GNA12
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.168; TCGA BRCA -0.061; TCGA CESC -0.179; TCGA COAD -0.115; TCGA ESCA -0.088; TCGA HNSC -0.161; TCGA KIRC -0.138; TCGA KIRP -0.148; TCGA LUAD -0.129; TCGA LUSC -0.097; TCGA PAAD -0.147; TCGA STAD -0.094; TCGA UCEC -0.116
hsa-miR-200a-3p
CREB5
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.404; TCGA BRCA -0.33; TCGA COAD -0.311; TCGA ESCA -0.152; TCGA HNSC -0.282; TCGA KIRC -0.14; TCGA LUAD -0.111; TCGA LUSC -0.132; TCGA PAAD -0.198; TCGA STAD -0.264
hsa-miR-200a-3p
FOXO1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.081; TCGA BRCA -0.355; TCGA CESC -0.136; TCGA COAD -0.139; TCGA ESCA -0.08; TCGA HNSC -0.225; TCGA LUAD -0.058; TCGA LUSC -0.152; TCGA PAAD -0.254; TCGA STAD -0.095; TCGA UCEC -0.161
hsa-miR-200a-3p
FER
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.192; TCGA BRCA -0.237; TCGA CESC -0.189; TCGA COAD -0.16; TCGA ESCA -0.157; TCGA HNSC -0.139; TCGA KIRP -0.17; TCGA LIHC -0.055; TCGA LUAD -0.148; TCGA LUSC -0.193; TCGA PAAD -0.112; TCGA PRAD -0.057; TCGA STAD -0.188; TCGA UCEC -0.083
hsa-miR-200a-3p
WWC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.196; TCGA CESC -0.191; TCGA COAD -0.378; TCGA ESCA -0.081; TCGA HNSC -0.259; TCGA LUAD -0.171; TCGA LUSC -0.491; TCGA PAAD -0.135; TCGA STAD -0.157; TCGA UCEC -0.083
hsa-miR-200a-3p
GFRA1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.282; TCGA CESC -0.45; TCGA COAD -0.683; TCGA ESCA -0.228; TCGA HNSC -0.388; TCGA LIHC -0.241; TCGA LUSC -0.379; TCGA OV -0.441; TCGA PAAD -0.384; TCGA PRAD -0.112; TCGA STAD -0.648; TCGA UCEC -0.436
hsa-miR-200a-3p
DST
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; STAD; UCEC
mirMAP
TCGA BLCA -0.145; TCGA BRCA -0.29; TCGA CESC -0.318; TCGA COAD -0.161; TCGA ESCA -0.189; TCGA HNSC -0.135; TCGA KIRP -0.118; TCGA LUAD -0.212; TCGA STAD -0.294; TCGA UCEC -0.222
hsa-miR-200a-3p
CAMK4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.285; TCGA BRCA -0.093; TCGA CESC -0.267; TCGA COAD -0.238; TCGA ESCA -0.129; TCGA HNSC -0.205; TCGA KIRC -0.202; TCGA KIRP -0.208; TCGA LUAD -0.159; TCGA LUSC -0.221; TCGA OV -0.216; TCGA PAAD -0.249; TCGA PRAD -0.107; TCGA STAD -0.163; TCGA UCEC -0.201
hsa-miR-200a-3p
PDE1C
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.38; TCGA BRCA -0.391; TCGA COAD -0.21; TCGA HNSC -0.339; TCGA KIRP -0.515; TCGA LUAD -0.149; TCGA LUSC -0.48; TCGA PAAD -0.198; TCGA PRAD -0.202; TCGA STAD -0.4; TCGA UCEC -0.332
hsa-miR-200a-3p
PI4K2A
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.054; TCGA CESC -0.109; TCGA COAD -0.101; TCGA ESCA -0.139; TCGA HNSC -0.133; TCGA KIRP -0.211; TCGA LUAD -0.132; TCGA LUSC -0.1; TCGA PAAD -0.134; TCGA STAD -0.077
hsa-miR-200a-3p
EIF4E3
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.057; TCGA BRCA -0.148; TCGA COAD -0.11; TCGA ESCA -0.115; TCGA HNSC -0.166; TCGA LUSC -0.362; TCGA PRAD -0.072; TCGA STAD -0.221; TCGA UCEC -0.151
hsa-miR-200a-3p
HEYL
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.174; TCGA BRCA -0.054; TCGA CESC -0.27; TCGA COAD -0.321; TCGA ESCA -0.092; TCGA HNSC -0.342; TCGA KIRC -0.398; TCGA KIRP -0.212; TCGA LUAD -0.064; TCGA LUSC -0.373; TCGA PAAD -0.215; TCGA PRAD -0.05; TCGA STAD -0.206; TCGA UCEC -0.234
hsa-miR-200a-3p
CTSB
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
mirMAP
TCGA BLCA -0.213; TCGA CESC -0.098; TCGA COAD -0.152; TCGA ESCA -0.107; TCGA HNSC -0.138; TCGA KIRC -0.134; TCGA KIRP -0.309; TCGA LUAD -0.186; TCGA LUSC -0.174; TCGA PAAD -0.177
hsa-miR-200a-3p
ABCA1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
mirMAP
TCGA BLCA -0.102; TCGA BRCA -0.253; TCGA CESC -0.223; TCGA COAD -0.261; TCGA ESCA -0.237; TCGA HNSC -0.254; TCGA KIRC -0.297; TCGA KIRP -0.192; TCGA LUAD -0.179; TCGA LUSC -0.125; TCGA PAAD -0.189; TCGA STAD -0.163
hsa-miR-200a-3p
GFRA2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.366; TCGA BRCA -0.439; TCGA COAD -0.519; TCGA ESCA -0.407; TCGA HNSC -0.364; TCGA KIRC -0.174; TCGA LIHC -0.114; TCGA LUAD -0.258; TCGA LUSC -0.497; TCGA OV -0.239; TCGA PAAD -0.432; TCGA STAD -0.505; TCGA UCEC -0.339
hsa-miR-200a-3p
SHE
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.253; TCGA BRCA -0.398; TCGA CESC -0.231; TCGA COAD -0.519; TCGA ESCA -0.126; TCGA HNSC -0.341; TCGA KIRP -0.145; TCGA LUSC -0.556; TCGA OV -0.152; TCGA PAAD -0.347; TCGA PRAD -0.082; TCGA STAD -0.281; TCGA UCEC -0.38
hsa-miR-200a-3p
KCNK3
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.436; TCGA BRCA -0.246; TCGA CESC -0.231; TCGA COAD -0.934; TCGA HNSC -0.441; TCGA KIRC -0.231; TCGA KIRP -0.719; TCGA LUSC -0.488; TCGA STAD -0.714; TCGA UCEC -0.378
hsa-miR-200a-3p
ANO5
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUSC; OV; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.189; TCGA BRCA -0.311; TCGA COAD -0.567; TCGA HNSC -0.651; TCGA LIHC -0.118; TCGA LUSC -0.405; TCGA OV -0.29; TCGA THCA -0.105; TCGA STAD -0.424; TCGA UCEC -0.335
hsa-miR-200a-3p
LRRC15
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
mirMAP
TCGA BLCA -0.479; TCGA CESC -0.326; TCGA COAD -0.546; TCGA ESCA -0.241; TCGA HNSC -0.68; TCGA KIRC -0.556; TCGA KIRP -0.324; TCGA LUAD -0.269; TCGA LUSC -0.386; TCGA PAAD -0.51; TCGA UCEC -0.195
hsa-miR-200a-3p
SH3PXD2B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.148; TCGA BRCA -0.102; TCGA CESC -0.091; TCGA COAD -0.164; TCGA ESCA -0.202; TCGA HNSC -0.19; TCGA KIRC -0.423; TCGA KIRP -0.227; TCGA LUAD -0.076; TCGA LUSC -0.132; TCGA PAAD -0.237; TCGA PRAD -0.079; TCGA STAD -0.208; TCGA UCEC -0.091
hsa-miR-200a-3p
AMZ1
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
mirMAP
TCGA BLCA -0.212; TCGA CESC -0.285; TCGA ESCA -0.125; TCGA HNSC -0.166; TCGA KIRC -0.506; TCGA KIRP -0.379; TCGA LUAD -0.122; TCGA LUSC -0.452; TCGA PAAD -0.194; TCGA UCEC -0.185
hsa-miR-200a-3p
ARL10
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.211; TCGA BRCA -0.225; TCGA CESC -0.268; TCGA COAD -0.414; TCGA ESCA -0.314; TCGA HNSC -0.194; TCGA KIRC -0.111; TCGA LUAD -0.182; TCGA PAAD -0.193; TCGA STAD -0.307; TCGA UCEC -0.237
hsa-miR-200a-3p
FAM26E
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.378; TCGA BRCA -0.299; TCGA CESC -0.327; TCGA COAD -0.593; TCGA ESCA -0.222; TCGA HNSC -0.475; TCGA KIRC -0.12; TCGA KIRP -0.448; TCGA LUAD -0.272; TCGA LUSC -0.435; TCGA OV -0.112; TCGA PAAD -0.326; TCGA PRAD -0.098; TCGA STAD -0.189; TCGA UCEC -0.284
hsa-miR-200a-3p
FAM133A
9 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.297; TCGA BRCA -0.209; TCGA ESCA -0.352; TCGA LIHC -0.441; TCGA LUAD -0.288; TCGA OV -0.267; TCGA PAAD -0.183; TCGA STAD -0.491; TCGA UCEC -0.274
hsa-miR-200a-3p
ST6GALNAC3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.208; TCGA BRCA -0.326; TCGA CESC -0.297; TCGA COAD -0.15; TCGA HNSC -0.286; TCGA KIRP -0.319; TCGA LUAD -0.174; TCGA LUSC -0.38; TCGA OV -0.259; TCGA PAAD -0.198; TCGA PRAD -0.129; TCGA STAD -0.199; TCGA UCEC -0.351
hsa-miR-200a-3p
OLFML2A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.25; TCGA BRCA -0.202; TCGA CESC -0.439; TCGA COAD -0.317; TCGA ESCA -0.218; TCGA KIRC -0.534; TCGA LUAD -0.151; TCGA OV -0.16; TCGA PAAD -0.162; TCGA PRAD -0.069; TCGA STAD -0.239; TCGA UCEC -0.362
hsa-miR-200a-3p
BACE1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.188; TCGA BRCA -0.151; TCGA CESC -0.063; TCGA COAD -0.203; TCGA ESCA -0.149; TCGA HNSC -0.196; TCGA LUAD -0.141; TCGA LUSC -0.135; TCGA PAAD -0.138; TCGA STAD -0.209; TCGA UCEC -0.11
hsa-miR-200a-3p
TEAD1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.152; TCGA BRCA -0.223; TCGA CESC -0.063; TCGA COAD -0.149; TCGA ESCA -0.055; TCGA HNSC -0.214; TCGA LUAD -0.102; TCGA LUSC -0.1; TCGA PAAD -0.073; TCGA PRAD -0.073; TCGA STAD -0.316; TCGA UCEC -0.144
hsa-miR-200a-3p
PRELP
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.444; TCGA BRCA -0.401; TCGA CESC -0.311; TCGA COAD -1.083; TCGA ESCA -0.499; TCGA HNSC -0.451; TCGA KIRP -0.305; TCGA LUAD -0.134; TCGA LUSC -0.539; TCGA PAAD -0.243; TCGA STAD -0.719; TCGA UCEC -0.533
hsa-miR-200a-3p
AFAP1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.226; TCGA BRCA -0.072; TCGA CESC -0.077; TCGA ESCA -0.065; TCGA HNSC -0.172; TCGA KIRC -0.169; TCGA KIRP -0.122; TCGA LUAD -0.071; TCGA PRAD -0.053; TCGA STAD -0.179; TCGA UCEC -0.116
hsa-miR-200a-3p
SPN
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
mirMAP
TCGA BLCA -0.287; TCGA BRCA -0.064; TCGA CESC -0.18; TCGA COAD -0.235; TCGA HNSC -0.271; TCGA KIRC -0.312; TCGA KIRP -0.177; TCGA LUAD -0.215; TCGA LUSC -0.65; TCGA PAAD -0.394
hsa-miR-200a-3p
ITSN1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.073; TCGA BRCA -0.282; TCGA COAD -0.095; TCGA HNSC -0.121; TCGA KIRP -0.114; TCGA LUAD -0.085; TCGA LUSC -0.147; TCGA PAAD -0.113; TCGA PRAD -0.063; TCGA STAD -0.1; TCGA UCEC -0.118
hsa-miR-200a-3p
GIMAP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
mirMAP
TCGA BLCA -0.274; TCGA BRCA -0.196; TCGA CESC -0.333; TCGA COAD -0.35; TCGA ESCA -0.141; TCGA HNSC -0.275; TCGA KIRC -0.159; TCGA KIRP -0.203; TCGA LUAD -0.164; TCGA LUSC -0.5; TCGA PAAD -0.379; TCGA UCEC -0.272
hsa-miR-200a-3p
NEURL1B
9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.217; TCGA BRCA -0.083; TCGA ESCA -0.14; TCGA KIRC -0.216; TCGA KIRP -0.187; TCGA LUSC -0.119; TCGA PRAD -0.069; TCGA STAD -0.203; TCGA UCEC -0.18
hsa-miR-200a-3p
PLXNA4
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.52; TCGA BRCA -0.52; TCGA COAD -0.843; TCGA ESCA -0.33; TCGA HNSC -0.489; TCGA LUAD -0.149; TCGA LUSC -0.542; TCGA OV -0.227; TCGA PAAD -0.465; TCGA STAD -0.468
hsa-miR-200a-3p
MYH10
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.138; TCGA BRCA -0.148; TCGA CESC -0.204; TCGA COAD -0.422; TCGA ESCA -0.406; TCGA HNSC -0.246; TCGA KIRP -0.106; TCGA LUAD -0.15; TCGA LUSC -0.323; TCGA OV -0.102; TCGA PAAD -0.21; TCGA PRAD -0.081; TCGA STAD -0.287; TCGA UCEC -0.149
hsa-miR-200a-3p
CXCL12
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.497; TCGA BRCA -0.361; TCGA CESC -0.45; TCGA COAD -0.468; TCGA ESCA -0.309; TCGA HNSC -0.578; TCGA KIRP -0.395; TCGA LUAD -0.293; TCGA LUSC -0.564; TCGA OV -0.302; TCGA PAAD -0.649; TCGA PRAD -0.122; TCGA STAD -0.44; TCGA UCEC -0.543
hsa-miR-200a-3p
NAMPT
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD
miRNATAP
TCGA BLCA -0.164; TCGA BRCA -0.089; TCGA CESC -0.133; TCGA HNSC -0.08; TCGA KIRC -0.106; TCGA KIRP -0.163; TCGA LUAD -0.214; TCGA PAAD -0.114; TCGA PRAD -0.104
hsa-miR-200a-3p
BRMS1L
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.106; TCGA BRCA -0.06; TCGA CESC -0.066; TCGA COAD -0.109; TCGA ESCA -0.101; TCGA KIRP -0.118; TCGA OV -0.07; TCGA PAAD -0.08; TCGA PRAD -0.068; TCGA STAD -0.093; TCGA UCEC -0.118
hsa-miR-200a-3p
DLC1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.334; TCGA CESC -0.244; TCGA COAD -0.372; TCGA ESCA -0.096; TCGA HNSC -0.425; TCGA KIRC -0.103; TCGA LUSC -0.624; TCGA OV -0.126; TCGA PAAD -0.296; TCGA PRAD -0.123; TCGA STAD -0.298; TCGA UCEC -0.207
hsa-miR-200a-3p
SYNPO2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.489; TCGA BRCA -0.445; TCGA CESC -0.327; TCGA COAD -1.004; TCGA ESCA -0.438; TCGA HNSC -0.678; TCGA KIRP -0.332; TCGA LUAD -0.224; TCGA LUSC -0.309; TCGA PAAD -0.382; TCGA PRAD -0.096; TCGA THCA -0.05; TCGA STAD -0.913; TCGA UCEC -0.507
hsa-miR-200a-3p
PALM2-AKAP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.371; TCGA BRCA -0.335; TCGA CESC -0.323; TCGA COAD -0.385; TCGA ESCA -0.12; TCGA HNSC -0.38; TCGA KIRC -0.147; TCGA KIRP -0.217; TCGA LUAD -0.249; TCGA LUSC -0.546; TCGA OV -0.069; TCGA PAAD -0.306; TCGA STAD -0.258; TCGA UCEC -0.29
hsa-miR-200a-3p
NRP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.273; TCGA CESC -0.237; TCGA COAD -0.407; TCGA ESCA -0.129; TCGA HNSC -0.371; TCGA KIRC -0.234; TCGA LUAD -0.177; TCGA LUSC -0.395; TCGA PAAD -0.202; TCGA STAD -0.158; TCGA UCEC -0.164
hsa-miR-200a-3p
MAP3K3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.161; TCGA BRCA -0.135; TCGA CESC -0.12; TCGA COAD -0.239; TCGA ESCA -0.148; TCGA HNSC -0.216; TCGA LUAD -0.082; TCGA LUSC -0.251; TCGA PAAD -0.215; TCGA STAD -0.231; TCGA UCEC -0.189
hsa-miR-200a-3p
IGDCC4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.282; TCGA BRCA -0.244; TCGA CESC -0.279; TCGA COAD -0.26; TCGA ESCA -0.123; TCGA HNSC -0.58; TCGA KIRC -0.258; TCGA LUAD -0.177; TCGA LUSC -0.294; TCGA OV -0.121; TCGA PAAD -0.522; TCGA PRAD -0.137; TCGA STAD -0.158; TCGA UCEC -0.293
hsa-miR-200a-3p
PTEN
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.061; TCGA BRCA -0.109; TCGA CESC -0.073; TCGA HNSC -0.148; TCGA LUAD -0.093; TCGA LUSC -0.204; TCGA PAAD -0.126; TCGA PRAD -0.122; TCGA STAD -0.075; TCGA UCEC -0.092
hsa-miR-200a-3p
ARID5B
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.137; TCGA BRCA -0.244; TCGA CESC -0.138; TCGA COAD -0.128; TCGA ESCA -0.135; TCGA HNSC -0.131; TCGA LUAD -0.065; TCGA PAAD -0.279; TCGA STAD -0.098; TCGA UCEC -0.123
hsa-miR-200a-3p
MARCH1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.178; TCGA CESC -0.13; TCGA COAD -0.264; TCGA ESCA -0.12; TCGA HNSC -0.291; TCGA KIRC -0.191; TCGA KIRP -0.267; TCGA LUAD -0.244; TCGA LUSC -0.376; TCGA PAAD -0.453; TCGA STAD -0.057
hsa-miR-200a-3p
SOX5
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.227; TCGA BRCA -0.351; TCGA COAD -0.512; TCGA HNSC -0.276; TCGA LIHC -0.087; TCGA LUAD -0.177; TCGA LUSC -0.238; TCGA PAAD -0.141; TCGA PRAD -0.098; TCGA STAD -0.35
hsa-miR-200a-3p
ANK2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.579; TCGA BRCA -0.461; TCGA CESC -0.34; TCGA COAD -0.892; TCGA ESCA -0.386; TCGA HNSC -0.596; TCGA KIRP -0.957; TCGA LUAD -0.173; TCGA LUSC -0.583; TCGA PAAD -0.454; TCGA THCA -0.092; TCGA STAD -0.628; TCGA UCEC -0.28
hsa-miR-200a-3p
PCDH17
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.111; TCGA CESC -0.141; TCGA COAD -0.334; TCGA HNSC -0.344; TCGA KIRC -0.386; TCGA KIRP -0.412; TCGA LUAD -0.135; TCGA LUSC -0.315; TCGA OV -0.114; TCGA PAAD -0.227; TCGA STAD -0.101; TCGA UCEC -0.145
hsa-miR-200a-3p
LPP
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.194; TCGA BRCA -0.161; TCGA COAD -0.181; TCGA ESCA -0.124; TCGA HNSC -0.136; TCGA KIRP -0.17; TCGA PRAD -0.141; TCGA THCA -0.067; TCGA STAD -0.37; TCGA UCEC -0.134
hsa-miR-200a-3p
GRIN3A
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.189; TCGA BRCA -0.096; TCGA CESC -0.11; TCGA ESCA -0.097; TCGA HNSC -0.138; TCGA LUAD -0.159; TCGA LUSC -0.231; TCGA PAAD -0.21; TCGA UCEC -0.136
hsa-miR-200a-3p
CDON
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.341; TCGA BRCA -0.09; TCGA COAD -0.352; TCGA ESCA -0.133; TCGA HNSC -0.101; TCGA KIRC -0.363; TCGA KIRP -0.346; TCGA PAAD -0.253; TCGA STAD -0.496; TCGA UCEC -0.316
hsa-miR-200a-3p
SPRED1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; PRAD; UCEC
miRNATAP
TCGA BLCA -0.18; TCGA BRCA -0.132; TCGA CESC -0.093; TCGA HNSC -0.164; TCGA KIRC -0.171; TCGA LUAD -0.148; TCGA LUSC -0.195; TCGA PRAD -0.06; TCGA UCEC -0.129
hsa-miR-200a-3p
RHOBTB1
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUSC; PRAD; UCEC
miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.1; TCGA COAD -0.107; TCGA HNSC -0.342; TCGA KIRC -0.155; TCGA KIRP -0.197; TCGA LUSC -0.242; TCGA PRAD -0.058; TCGA UCEC -0.081
hsa-miR-200a-3p
MAP2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; STAD
miRNATAP
TCGA BLCA -0.22; TCGA BRCA -0.117; TCGA COAD -0.5; TCGA ESCA -0.174; TCGA HNSC -0.24; TCGA KIRP -0.22; TCGA LIHC -0.106; TCGA LUAD -0.109; TCGA LUSC -0.243; TCGA OV -0.2; TCGA PRAD -0.22; TCGA STAD -0.327
hsa-miR-200a-3p
DZIP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.268; TCGA BRCA -0.223; TCGA CESC -0.258; TCGA COAD -0.61; TCGA ESCA -0.468; TCGA HNSC -0.112; TCGA LUAD -0.139; TCGA OV -0.187; TCGA PAAD -0.246; TCGA STAD -0.427; TCGA UCEC -0.323
hsa-miR-200a-3p
TTYH2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.317; TCGA BRCA -0.165; TCGA CESC -0.404; TCGA COAD -0.36; TCGA ESCA -0.256; TCGA HNSC -0.217; TCGA KIRC -0.276; TCGA KIRP -0.34; TCGA LUAD -0.092; TCGA LUSC -0.189; TCGA OV -0.093; TCGA PAAD -0.35; TCGA PRAD -0.052; TCGA STAD -0.246; TCGA UCEC -0.355
hsa-miR-200a-3p
MAF
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.314; TCGA BRCA -0.239; TCGA CESC -0.38; TCGA COAD -0.402; TCGA ESCA -0.346; TCGA HNSC -0.215; TCGA KIRC -0.283; TCGA KIRP -0.32; TCGA LIHC -0.051; TCGA LUAD -0.126; TCGA OV -0.132; TCGA PAAD -0.251; TCGA PRAD -0.103; TCGA STAD -0.21; TCGA UCEC -0.366
hsa-miR-200a-3p
SVIL
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.227; TCGA BRCA -0.15; TCGA CESC -0.144; TCGA COAD -0.284; TCGA ESCA -0.283; TCGA HNSC -0.144; TCGA LUAD -0.093; TCGA PAAD -0.175; TCGA STAD -0.554; TCGA UCEC -0.283
hsa-miR-200a-3p
NPTX1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUSC; OV; STAD; UCEC
miRNATAP
TCGA BLCA -0.23; TCGA BRCA -0.154; TCGA CESC -0.389; TCGA COAD -1.098; TCGA ESCA -0.723; TCGA KIRP -0.395; TCGA LUSC -0.281; TCGA OV -0.19; TCGA STAD -0.958; TCGA UCEC -0.206
hsa-miR-200a-3p
RARB
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.237; TCGA BRCA -0.106; TCGA COAD -0.406; TCGA ESCA -0.178; TCGA HNSC -0.145; TCGA KIRP -0.129; TCGA OV -0.127; TCGA PAAD -0.176; TCGA PRAD -0.063; TCGA STAD -0.231; TCGA UCEC -0.158
hsa-miR-200a-3p
NRP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.45; TCGA BRCA -0.188; TCGA CESC -0.2; TCGA COAD -0.555; TCGA ESCA -0.3; TCGA HNSC -0.172; TCGA KIRC -0.354; TCGA KIRP -0.412; TCGA LUAD -0.211; TCGA LUSC -0.346; TCGA PAAD -0.201; TCGA PRAD -0.118; TCGA STAD -0.45; TCGA UCEC -0.238
hsa-miR-200a-3p
SLC6A17
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; THCA; STAD
miRNATAP
TCGA BLCA -0.296; TCGA CESC -0.314; TCGA COAD -0.549; TCGA ESCA -0.232; TCGA HNSC -0.452; TCGA KIRP -0.628; TCGA LUAD -0.281; TCGA LUSC -0.304; TCGA THCA -0.196; TCGA STAD -0.344
hsa-miR-200a-3p
PLXNC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.397; TCGA BRCA -0.192; TCGA CESC -0.266; TCGA COAD -0.562; TCGA ESCA -0.153; TCGA HNSC -0.636; TCGA KIRC -0.291; TCGA KIRP -0.58; TCGA LUAD -0.234; TCGA LUSC -0.682; TCGA PAAD -0.317; TCGA PRAD -0.114; TCGA STAD -0.083; TCGA UCEC -0.265
hsa-miR-200a-3p
MDGA1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.328; TCGA BRCA -0.145; TCGA CESC -0.172; TCGA COAD -0.491; TCGA ESCA -0.372; TCGA HNSC -0.156; TCGA KIRP -0.215; TCGA LUAD -0.262; TCGA OV -0.14; TCGA PAAD -0.39; TCGA STAD -0.349; TCGA UCEC -0.315
hsa-miR-200a-3p
SETBP1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.317; TCGA BRCA -0.138; TCGA CESC -0.272; TCGA COAD -0.503; TCGA ESCA -0.404; TCGA HNSC -0.275; TCGA PAAD -0.232; TCGA STAD -0.496; TCGA UCEC -0.273
hsa-miR-200a-3p
EGR2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.408; TCGA BRCA -0.269; TCGA CESC -0.189; TCGA COAD -0.534; TCGA ESCA -0.31; TCGA HNSC -0.253; TCGA LUAD -0.174; TCGA LUSC -0.374; TCGA PAAD -0.306; TCGA PRAD -0.09; TCGA STAD -0.162; TCGA UCEC -0.226
hsa-miR-200a-3p
EPB41L3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.245; TCGA BRCA -0.176; TCGA CESC -0.18; TCGA COAD -0.498; TCGA ESCA -0.309; TCGA HNSC -0.241; TCGA KIRP -0.225; TCGA LUAD -0.26; TCGA LUSC -0.33; TCGA PAAD -0.246; TCGA THCA -0.064; TCGA STAD -0.268; TCGA UCEC -0.272
hsa-miR-200a-3p
NMNAT2
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.251; TCGA BRCA -0.382; TCGA COAD -0.45; TCGA HNSC -0.211; TCGA KIRC -0.34; TCGA LUSC -0.424; TCGA THCA -0.105; TCGA STAD -0.333; TCGA UCEC -0.104
hsa-miR-200a-3p
KLF6
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.117; TCGA BRCA -0.181; TCGA CESC -0.213; TCGA COAD -0.076; TCGA HNSC -0.171; TCGA KIRC -0.101; TCGA LUAD -0.179; TCGA LUSC -0.392; TCGA STAD -0.051; TCGA UCEC -0.166
hsa-miR-200a-3p
COL11A1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD
miRNATAP
TCGA BLCA -0.27; TCGA CESC -0.473; TCGA COAD -0.772; TCGA ESCA -0.368; TCGA HNSC -0.617; TCGA KIRC -0.828; TCGA KIRP -0.569; TCGA LUAD -0.287; TCGA OV -0.484; TCGA PAAD -0.378
hsa-miR-200a-3p
SAMD4A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.321; TCGA BRCA -0.3; TCGA CESC -0.337; TCGA COAD -0.397; TCGA ESCA -0.161; TCGA HNSC -0.315; TCGA KIRC -0.077; TCGA KIRP -0.079; TCGA LUAD -0.207; TCGA LUSC -0.319; TCGA PAAD -0.238; TCGA STAD -0.369; TCGA UCEC -0.322
hsa-miR-200a-3p
ASTN1
11 cancers: BRCA; COAD; ESCA; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.36; TCGA COAD -0.903; TCGA ESCA -0.619; TCGA KIRP -1.238; TCGA LUAD -0.227; TCGA OV -0.296; TCGA PAAD -0.268; TCGA PRAD -0.22; TCGA THCA -0.148; TCGA STAD -0.863; TCGA UCEC -0.314
hsa-miR-200a-3p
CREB3L2
9 cancers: BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.067; TCGA COAD -0.107; TCGA ESCA -0.077; TCGA HNSC -0.215; TCGA LUSC -0.172; TCGA PAAD -0.11; TCGA PRAD -0.063; TCGA STAD -0.135; TCGA UCEC -0.143
hsa-miR-200a-3p
PRTG
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BRCA -0.283; TCGA CESC -0.382; TCGA COAD -0.68; TCGA HNSC -0.412; TCGA KIRP -0.395; TCGA LUSC -0.617; TCGA OV -0.198; TCGA PAAD -0.3; TCGA PRAD -0.117; TCGA STAD -0.368; TCGA UCEC -0.381
hsa-miR-200a-3p
ANO6
14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BRCA -0.258; TCGA CESC -0.163; TCGA COAD -0.149; TCGA ESCA -0.108; TCGA HNSC -0.242; TCGA KIRC -0.065; TCGA KIRP -0.212; TCGA LIHC -0.057; TCGA LUAD -0.193; TCGA LUSC -0.238; TCGA PAAD -0.144; TCGA PRAD -0.072; TCGA STAD -0.162; TCGA UCEC -0.23
hsa-miR-200a-3p
YWHAG
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD
MirTarget; miRNATAP
TCGA BRCA -0.093; TCGA CESC -0.102; TCGA COAD -0.063; TCGA ESCA -0.073; TCGA HNSC -0.11; TCGA KIRC -0.108; TCGA KIRP -0.133; TCGA LUAD -0.112; TCGA PRAD -0.063
hsa-miR-200a-3p
ST3GAL5
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BRCA -0.151; TCGA CESC -0.286; TCGA COAD -0.246; TCGA ESCA -0.108; TCGA HNSC -0.157; TCGA KIRC -0.143; TCGA KIRP -0.159; TCGA LUSC -0.341; TCGA OV -0.083; TCGA PAAD -0.136; TCGA STAD -0.146; TCGA UCEC -0.219
hsa-miR-200a-3p
RAB8B
12 cancers: BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.15; TCGA CESC -0.167; TCGA COAD -0.213; TCGA HNSC -0.192; TCGA KIRC -0.09; TCGA LUAD -0.199; TCGA LUSC -0.307; TCGA OV -0.077; TCGA PAAD -0.164; TCGA THCA -0.06; TCGA STAD -0.074; TCGA UCEC -0.233
hsa-miR-200a-3p
ADAM22
12 cancers: BRCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.323; TCGA COAD -0.276; TCGA HNSC -0.165; TCGA KIRP -0.715; TCGA LUAD -0.211; TCGA LUSC -0.218; TCGA OV -0.33; TCGA PAAD -0.237; TCGA PRAD -0.148; TCGA THCA -0.14; TCGA STAD -0.176; TCGA UCEC -0.274
hsa-miR-200a-3p
GLDN
9 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget
TCGA BRCA -0.425; TCGA CESC -0.165; TCGA ESCA -0.166; TCGA HNSC -0.172; TCGA LUAD -0.275; TCGA LUSC -0.212; TCGA PAAD -0.195; TCGA PRAD -0.169; TCGA STAD -0.313
hsa-miR-200a-3p
IDS
9 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
mirMAP
TCGA BRCA -0.074; TCGA COAD -0.182; TCGA HNSC -0.114; TCGA KIRC -0.083; TCGA KIRP -0.136; TCGA LUAD -0.131; TCGA LUSC -0.119; TCGA STAD -0.157; TCGA UCEC -0.095
hsa-miR-200a-3p
EHD3
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BRCA -0.071; TCGA CESC -0.204; TCGA COAD -0.38; TCGA ESCA -0.286; TCGA HNSC -0.2; TCGA LUAD -0.132; TCGA LUSC -0.085; TCGA PAAD -0.222; TCGA STAD -0.238; TCGA UCEC -0.097
hsa-miR-200a-3p
C20orf194
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BRCA -0.174; TCGA CESC -0.107; TCGA COAD -0.634; TCGA ESCA -0.263; TCGA HNSC -0.105; TCGA LUSC -0.091; TCGA PAAD -0.119; TCGA STAD -0.358; TCGA UCEC -0.161
hsa-miR-200a-3p
ZNF423
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.373; TCGA COAD -0.367; TCGA ESCA -0.274; TCGA HNSC -0.497; TCGA KIRC -0.201; TCGA LUAD -0.176; TCGA LUSC -0.49; TCGA OV -0.155; TCGA PAAD -0.275; TCGA PRAD -0.076; TCGA STAD -0.414; TCGA UCEC -0.213
hsa-miR-200a-3p
ZFP37
9 cancers: BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; STAD; UCEC
mirMAP
TCGA BRCA -0.141; TCGA CESC -0.175; TCGA COAD -0.205; TCGA ESCA -0.137; TCGA LUAD -0.119; TCGA OV -0.152; TCGA PAAD -0.161; TCGA STAD -0.174; TCGA UCEC -0.135
hsa-miR-200a-3p
SHROOM4
9 cancers: BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.267; TCGA CESC -0.119; TCGA HNSC -0.391; TCGA LUAD -0.092; TCGA LUSC -0.406; TCGA PAAD -0.254; TCGA PRAD -0.08; TCGA STAD -0.152; TCGA UCEC -0.121
hsa-miR-200a-3p
AR
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.294; TCGA CESC -0.229; TCGA COAD -0.661; TCGA ESCA -0.208; TCGA HNSC -0.598; TCGA LIHC -0.322; TCGA LUSC -0.508; TCGA PAAD -0.369; TCGA PRAD -0.094; TCGA STAD -0.615; TCGA UCEC -0.155
hsa-miR-200a-3p
PKIA
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.362; TCGA CESC -0.279; TCGA COAD -0.532; TCGA ESCA -0.251; TCGA HNSC -0.453; TCGA LUAD -0.136; TCGA OV -0.515; TCGA PRAD -0.106; TCGA STAD -0.422; TCGA UCEC -0.331
hsa-miR-200a-3p
SNAP91
9 cancers: BRCA; COAD; ESCA; KIRP; OV; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.127; TCGA COAD -0.82; TCGA ESCA -0.554; TCGA KIRP -0.49; TCGA OV -0.31; TCGA PAAD -0.327; TCGA THCA -0.107; TCGA STAD -0.793; TCGA UCEC -0.367
hsa-miR-200a-3p
RBMS1
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.203; TCGA CESC -0.201; TCGA COAD -0.517; TCGA ESCA -0.236; TCGA HNSC -0.074; TCGA LUAD -0.12; TCGA OV -0.054; TCGA PAAD -0.215; TCGA STAD -0.23; TCGA UCEC -0.185
hsa-miR-200a-3p
SLC23A2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; STAD; UCEC
miRNATAP
TCGA BRCA -0.124; TCGA CESC -0.139; TCGA COAD -0.133; TCGA ESCA -0.088; TCGA HNSC -0.103; TCGA LIHC -0.067; TCGA LUSC -0.089; TCGA STAD -0.121; TCGA UCEC -0.228
hsa-miR-200a-3p
DSTYK
9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA CESC -0.097; TCGA COAD -0.092; TCGA ESCA -0.102; TCGA HNSC -0.085; TCGA KIRP -0.101; TCGA LUSC -0.063; TCGA PAAD -0.119; TCGA STAD -0.131; TCGA UCEC -0.113
hsa-miR-200a-3p
KIF3C
11 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; STAD; UCEC
mirMAP
TCGA CESC -0.256; TCGA COAD -0.264; TCGA ESCA -0.289; TCGA HNSC -0.112; TCGA KIRC -0.197; TCGA KIRP -0.263; TCGA LUAD -0.172; TCGA OV -0.099; TCGA PAAD -0.131; TCGA STAD -0.292; TCGA UCEC -0.137
hsa-miR-200a-3p
GNA13
9 cancers: COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA COAD -0.072; TCGA HNSC -0.094; TCGA KIRC -0.117; TCGA KIRP -0.175; TCGA LUAD -0.145; TCGA LUSC -0.056; TCGA PAAD -0.149; TCGA STAD -0.053; TCGA UCEC -0.074





Enriched cancer pathways of putative targets