microRNA information: hsa-miR-200a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-200a-5p | miRbase |
| Accession: | MIMAT0001620 | miRbase |
| Precursor name: | hsa-mir-200a | miRbase |
| Precursor accession: | MI0000737 | miRbase |
| Symbol: | MIR200A | HGNC |
| RefSeq ID: | NR_029834 | GenBank |
| Sequence: | CAUCUUACCGGACAGUGCUGGA |
Reported expression in cancers: hsa-miR-200a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-200a-5p | bladder cancer | deregulation | "In other recruited 17 patients with BUC who were d ......" | 22886973 | Reverse transcription PCR; Microarray |
| hsa-miR-200a-5p | bladder cancer | deregulation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | qPCR; Microarray |
| hsa-miR-200a-5p | breast cancer | downregulation | "Expression levels of miR-200a miR-200b miR-200c mi ......" | 26201425 | qPCR |
| hsa-miR-200a-5p | breast cancer | downregulation | "Loss of expression of miR-200 family members has b ......" | 27717206 | |
| hsa-miR-200a-5p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
| hsa-miR-200a-5p | colorectal cancer | downregulation | "Here we used in situ hybridization and immunohisto ......" | 23441132 | in situ hybridization; qPCR |
| hsa-miR-200a-5p | colorectal cancer | upregulation | "The processes of EMT and metastasis are highly reg ......" | 25422078 | |
| hsa-miR-200a-5p | colorectal cancer | deregulation | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | RNA-Seq |
| hsa-miR-200a-5p | endometrial cancer | upregulation | "We evaluated the differential expressions of miRNA ......" | 21035172 | Microarray |
| hsa-miR-200a-5p | endometrial cancer | upregulation | "Using integrated statistical analyses we identifie ......" | 25750291 | |
| hsa-miR-200a-5p | endometrial cancer | upregulation | "The expression level of miR-200a was significantly ......" | 26045795 | |
| hsa-miR-200a-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
| hsa-miR-200a-5p | gastric cancer | downregulation | "Although microRNA-200 miR-200 family members are t ......" | 25502084 | |
| hsa-miR-200a-5p | gastric cancer | downregulation | "To find a potentially useful prognostic predictor ......" | 26137064 | |
| hsa-miR-200a-5p | head and neck cancer | downregulation | "The miR-200 family and miR-203 were downregulated ......" | 26882562 | |
| hsa-miR-200a-5p | kidney renal cell cancer | downregulation | "The set of miRNAs with significantly decreased exp ......" | 23074016 | |
| hsa-miR-200a-5p | kidney renal cell cancer | downregulation | "Here we report that the expression of miR-200a was ......" | 25813153 | |
| hsa-miR-200a-5p | liver cancer | downregulation | "We investigated the diagnostic impact of microRNA- ......" | 24895326 | qPCR |
| hsa-miR-200a-5p | liver cancer | downregulation | "Although microRNA-200a miR-200a is frequently down ......" | 25797260 | |
| hsa-miR-200a-5p | liver cancer | downregulation | "MiR-200 family is an important regulator of epithe ......" | 25909223 | |
| hsa-miR-200a-5p | liver cancer | downregulation | "Expression of the microRNA-200 family was investig ......" | 26447841 | qPCR |
| hsa-miR-200a-5p | lung cancer | upregulation | "Among these 28 miRNAs were up-regulated in both th ......" | 27189341 | qPCR |
| hsa-miR-200a-5p | lymphoma | downregulation | "Intriguingly both hsa-miR-363 and hsa-miR-200a bel ......" | 26893685 | |
| hsa-miR-200a-5p | melanoma | deregulation | "A functional role of microRNAs miRNAs or miRs in n ......" | 20957176 | |
| hsa-miR-200a-5p | melanoma | downregulation | "Here we demonstrate a significant correlation betw ......" | 22956368 | |
| hsa-miR-200a-5p | melanoma | upregulation | "Arsenic exposed Keratinocytes Exhibit Differential ......" | 27054085 | qPCR |
| hsa-miR-200a-5p | ovarian cancer | upregulation | "To identify the micro-ribonucleic acids miRNAs exp ......" | 24816756 | qPCR |
| hsa-miR-200a-5p | ovarian cancer | upregulation | "miR 200a overexpression in advanced ovarian carcin ......" | 25374174 | qPCR; Microarray |
| hsa-miR-200a-5p | ovarian cancer | upregulation | "The prognostic value of the miR 200 family in ovar ......" | 26910180 | |
| hsa-miR-200a-5p | prostate cancer | upregulation | "Here we demonstrate the involvement of miR-200 b i ......" | 24391862 | |
| hsa-miR-200a-5p | sarcoma | deregulation | "The most significantly downregulated miRNAs were m ......" | 24027049 | |
| hsa-miR-200a-5p | thyroid cancer | upregulation | "The miR-200 family was recently identified as a su ......" | 22797360 | |
| hsa-miR-200a-5p | thyroid cancer | downregulation | "MiR 200 Regulates Epithelial Mesenchymal Transitio ......" | 25542369 |
Reported cancer pathway affected by hsa-miR-200a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-200a-5p | breast cancer | cell cycle pathway; Apoptosis pathway | "The genes encoding microRNAs of the human miR-200 ......" | 20514023 | Luciferase |
| hsa-miR-200a-5p | breast cancer | Epithelial mesenchymal transition pathway | "Phosphoglucose isomerase/autocrine motility factor ......" | 21389093 | |
| hsa-miR-200a-5p | breast cancer | Epithelial mesenchymal transition pathway | "Global miRNA expression profiling was performed on ......" | 22294488 | |
| hsa-miR-200a-5p | breast cancer | Epithelial mesenchymal transition pathway | "Epigenetic modulation of the miR 200 family is ass ......" | 23525011 | |
| hsa-miR-200a-5p | breast cancer | Epithelial mesenchymal transition pathway | "MiR 200 can repress breast cancer metastasis throu ......" | 24037528 | |
| hsa-miR-200a-5p | breast cancer | Epithelial mesenchymal transition pathway | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | |
| hsa-miR-200a-5p | breast cancer | Wnt signaling pathway; Apoptosis pathway; Notch signaling pathway | "The miRNAs and their clusters such as the miR-200 ......" | 26712794 | |
| hsa-miR-200a-5p | colon cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200 miR 200 cluster regulation by achaete ......" | 25371200 | |
| hsa-miR-200a-5p | colon cancer | Apoptosis pathway; Notch signaling pathway | "Niclosamide inhibits colon cancer progression thro ......" | 27460529 | Flow cytometry; Cell migration assay |
| hsa-miR-200a-5p | colorectal cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "MiR 200a regulates epithelial to mesenchymal trans ......" | 24504363 | |
| hsa-miR-200a-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "Epithelial-mesenchymal transition EMT and changes ......" | 25757925 | |
| hsa-miR-200a-5p | colorectal cancer | Apoptosis pathway | "Expression of miR 200a in colorectal carcinoma cel ......" | 25818799 | Cell migration assay |
| hsa-miR-200a-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "The miR-200 family presented as the most powerful ......" | 27157610 | |
| hsa-miR-200a-5p | endometrial cancer | Epithelial mesenchymal transition pathway | "Tamoxifen represses miR 200 microRNAs and promotes ......" | 23295740 | |
| hsa-miR-200a-5p | endometrial cancer | Apoptosis pathway | "Moreover the study explored the involvement of mic ......" | 27497669 | Western blot; Wound Healing Assay |
| hsa-miR-200a-5p | gastric cancer | Epithelial mesenchymal transition pathway | "The microRNA-200 miR-200 family has been reported ......" | 22311119 | |
| hsa-miR-200a-5p | gastric cancer | Epithelial mesenchymal transition pathway | "In addition the microRNA miR-200 family plays a ce ......" | 25411357 | |
| hsa-miR-200a-5p | glioblastoma | Epithelial mesenchymal transition pathway | "NPV LDE 225 Erismodegib inhibits epithelial mesenc ......" | 23482671 | Luciferase; Western blot |
| hsa-miR-200a-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "Epithelial-mesenchymal-transition EMT is a critica ......" | 24424572 | |
| hsa-miR-200a-5p | kidney renal cell cancer | Apoptosis pathway | "MicroRNA 200a 3p suppresses tumor proliferation an ......" | 26797273 | |
| hsa-miR-200a-5p | liver cancer | cell cycle pathway | "Expression of the microRNA-200 miR-200 family has ......" | 23760980 | Flow cytometry; MTT assay |
| hsa-miR-200a-5p | liver cancer | cell cycle pathway | "microRNA 200a is an independent prognostic factor ......" | 24009066 | Western blot |
| hsa-miR-200a-5p | liver cancer | Epithelial mesenchymal transition pathway | "We investigated the diagnostic impact of microRNA- ......" | 24895326 | |
| hsa-miR-200a-5p | liver cancer | Epithelial mesenchymal transition pathway | "Overexpression of miR 200a suppresses epithelial m ......" | 25412960 | |
| hsa-miR-200a-5p | liver cancer | Epithelial mesenchymal transition pathway | "MiR-200 family is an important regulator of epithe ......" | 25909223 | |
| hsa-miR-200a-5p | liver cancer | Epithelial mesenchymal transition pathway; Apoptosis pathway | "MicroRNA 200a inhibits epithelial mesenchymal tran ......" | 26617701 | Western blot; Wound Healing Assay; MTT assay |
| hsa-miR-200a-5p | liver cancer | Epithelial mesenchymal transition pathway | "LncRNA HULC enhances epithelial mesenchymal transi ......" | 27285757 | |
| hsa-miR-200a-5p | lung cancer | Epithelial mesenchymal transition pathway | "BMP4 depletion by miR 200 inhibits tumorigenesis a ......" | 26395571 | Western blot; Luciferase |
| hsa-miR-200a-5p | lung cancer | Epithelial mesenchymal transition pathway | "Microarray analysis using 2000 probes revealed 87 ......" | 27189341 | |
| hsa-miR-200a-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "The microRNA‑200 miR-200 family is a powerful re ......" | 23708087 | Western blot |
| hsa-miR-200a-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "The difference in miRNA expression profiles betwee ......" | 26783187 | |
| hsa-miR-200a-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "Differences in miRNA expression between HGSC CCC a ......" | 24512620 | |
| hsa-miR-200a-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "Epithelial mesenchymal transition associated miRNA ......" | 24952258 | |
| hsa-miR-200a-5p | ovarian cancer | cell cycle pathway | "Upregulation of microRNA 200a associates with tumo ......" | 25997962 | Colony formation |
| hsa-miR-200a-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "The miR 200 family differentially regulates sensit ......" | 26025631 | |
| hsa-miR-200a-5p | pancreatic cancer | Epithelial mesenchymal transition pathway | "MiR 200a inhibits epithelial mesenchymal transitio ......" | 24521357 | |
| hsa-miR-200a-5p | prostate cancer | Epithelial mesenchymal transition pathway | "miR 200 regulates PDGF D mediated epithelial mesen ......" | 19544444 | |
| hsa-miR-200a-5p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-200a-5p | thyroid cancer | Epithelial mesenchymal transition pathway | "We identified two significantly decreased microRNA ......" | 20498632 | |
| hsa-miR-200a-5p | thyroid cancer | Epithelial mesenchymal transition pathway | "The miR 200 family regulates the epithelial mesenc ......" | 22797360 | Western blot |
| hsa-miR-200a-5p | thyroid cancer | Epithelial mesenchymal transition pathway | "MiR 200 Regulates Epithelial Mesenchymal Transitio ......" | 25542369 | Western blot |
Reported cancer prognosis affected by hsa-miR-200a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-200a-5p | B cell lymphoma | worse prognosis | "Inhibition of ZEB1 by miR 200 characterizes Helico ......" | 24390222 | |
| hsa-miR-200a-5p | bladder cancer | drug resistance; cell migration | "miR 200 expression regulates epithelial to mesench ......" | 19671845 | Western blot; Luciferase |
| hsa-miR-200a-5p | bladder cancer | staging; progression | "Coordinated epigenetic repression of the miR 200 f ......" | 20473948 | |
| hsa-miR-200a-5p | bladder cancer | recurrence | "Datasets of GSE20418 and GSE19717 were used for an ......" | 22961325 | |
| hsa-miR-200a-5p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
| hsa-miR-200a-5p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
| hsa-miR-200a-5p | breast cancer | metastasis | "miR 200 enhances mouse breast cancer cell coloniza ......" | 19787069 | |
| hsa-miR-200a-5p | breast cancer | progression | "The genes encoding microRNAs of the human miR-200 ......" | 20514023 | Luciferase |
| hsa-miR-200a-5p | breast cancer | motility; metastasis | "Phosphoglucose isomerase/autocrine motility factor ......" | 21389093 | |
| hsa-miR-200a-5p | breast cancer | metastasis | "Decreased expression of miRNAs of the miR-200 fami ......" | 21682933 | |
| hsa-miR-200a-5p | breast cancer | metastasis; staging; progression | "Global miRNA expression profiling was performed on ......" | 22294488 | |
| hsa-miR-200a-5p | breast cancer | differentiation | "In order to identify which miRNAs are involved in ......" | 22562546 | |
| hsa-miR-200a-5p | breast cancer | differentiation | "As the family of miR-200 microRNAs has been shown ......" | 23112837 | |
| hsa-miR-200a-5p | breast cancer | metastasis; drug resistance | "MicroRNA 200a promotes anoikis resistance and meta ......" | 23340296 | Luciferase; Colony formation |
| hsa-miR-200a-5p | breast cancer | progression | "Epigenetic modulation of the miR 200 family is ass ......" | 23525011 | |
| hsa-miR-200a-5p | breast cancer | drug resistance; progression | "Reduced expression of miR 200 family members contr ......" | 23626803 | |
| hsa-miR-200a-5p | breast cancer | metastasis | "Whole genome miR array analysis using PELP1-overex ......" | 23975430 | |
| hsa-miR-200a-5p | breast cancer | metastasis; staging; poor survival | "MiR 200 can repress breast cancer metastasis throu ......" | 24037528 | |
| hsa-miR-200a-5p | breast cancer | progression | "Loss of microRNA 200a expression correlates with t ......" | 24280074 | |
| hsa-miR-200a-5p | breast cancer | metastasis | "The expression of miRNAs in patients with primary ......" | 24846313 | |
| hsa-miR-200a-5p | breast cancer | metastasis; cell migration | "The microRNA-200 miR-200 family is found to inhibi ......" | 24925028 | |
| hsa-miR-200a-5p | breast cancer | metastasis; progression | "Members of three miRNA families i.e miR-17 miR-200 ......" | 25001613 | |
| hsa-miR-200a-5p | breast cancer | worse prognosis | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | |
| hsa-miR-200a-5p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-200a-5p | breast cancer | drug resistance | "Therefore we investigated the role of known EMT re ......" | 25746005 | |
| hsa-miR-200a-5p | breast cancer | progression | "ADAM12 L is a direct target of the miR 29 and miR ......" | 25886595 | Western blot; Luciferase |
| hsa-miR-200a-5p | breast cancer | metastasis | "The upregulation of fibronectin and lysyl oxidase ......" | 26068592 | |
| hsa-miR-200a-5p | breast cancer | poor survival; cell migration; metastasis | "miR 200a inhibits migration of triple negative bre ......" | 26088362 | |
| hsa-miR-200a-5p | breast cancer | metastasis | "These included miR-141 miR-144 miR-193b miR-200a m ......" | 26785733 | |
| hsa-miR-200a-5p | breast cancer | differentiation | "miR 9 and miR 200 Regulate PDGFRβ Mediated Endoth ......" | 27402080 | |
| hsa-miR-200a-5p | breast cancer | progression; poor survival | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
| hsa-miR-200a-5p | breast cancer | poor survival | "In this multicenter study a 10-miRNA classifier in ......" | 27566954 | |
| hsa-miR-200a-5p | breast cancer | drug resistance | "Loss of expression of miR-200 family members has b ......" | 27717206 | |
| hsa-miR-200a-5p | breast cancer | drug resistance | "Specifically we will discuss key miRNAs involved i ......" | 27721895 | |
| hsa-miR-200a-5p | cervical and endocervical cancer | poor survival; motility | "Using an established PCR-based miRNA assay to anal ......" | 20124485 | |
| hsa-miR-200a-5p | cervical and endocervical cancer | staging; progression | "An initial screening of miRNA expression was perfo ......" | 26171195 | |
| hsa-miR-200a-5p | colon cancer | progression | "Niclosamide inhibits colon cancer progression thro ......" | 27460529 | Flow cytometry; Cell migration assay |
| hsa-miR-200a-5p | colorectal cancer | metastasis | "Applying real-time PCR we detected the expression ......" | 21827717 | |
| hsa-miR-200a-5p | colorectal cancer | metastasis | "Although the microRNA-200 miR-200 family is a cruc ......" | 22735571 | |
| hsa-miR-200a-5p | colorectal cancer | metastasis; staging | "Here we used in situ hybridization and immunohisto ......" | 23441132 | |
| hsa-miR-200a-5p | colorectal cancer | staging; metastasis | "In the first phase we selected candidate miRNAs as ......" | 23982750 | |
| hsa-miR-200a-5p | colorectal cancer | worse prognosis; poor survival | "MiR 200a regulates epithelial to mesenchymal trans ......" | 24504363 | |
| hsa-miR-200a-5p | colorectal cancer | poor survival; staging | "Role of miR 200 family members in survival of colo ......" | 24510588 | |
| hsa-miR-200a-5p | colorectal cancer | metastasis | "The processes of EMT and metastasis are highly reg ......" | 25422078 | |
| hsa-miR-200a-5p | colorectal cancer | drug resistance | "Epithelial-mesenchymal transition EMT and changes ......" | 25757925 | |
| hsa-miR-200a-5p | colorectal cancer | metastasis | "Expression of miR 200a in colorectal carcinoma cel ......" | 25818799 | Cell migration assay |
| hsa-miR-200a-5p | colorectal cancer | metastasis | "MiR 200 suppresses metastases of colorectal cancer ......" | 26242262 | Luciferase |
| hsa-miR-200a-5p | colorectal cancer | worse prognosis | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | |
| hsa-miR-200a-5p | colorectal cancer | worse prognosis; poor survival | "The miR-200 family presented as the most powerful ......" | 27157610 | |
| hsa-miR-200a-5p | colorectal cancer | worse prognosis | "Plasma miR 122 and miR 200 family are prognostic m ......" | 27632639 | |
| hsa-miR-200a-5p | endometrial cancer | tumorigenesis | "We compared the expression profiles of 723 human m ......" | 21897839 | |
| hsa-miR-200a-5p | endometrial cancer | motility; drug resistance | "Tamoxifen represses miR 200 microRNAs and promotes ......" | 23295740 | |
| hsa-miR-200a-5p | endometrial cancer | tumorigenesis | "The miRNA profiles were analyzed by miRNA microarr ......" | 24742567 | |
| hsa-miR-200a-5p | endometrial cancer | metastasis; poor survival | "The expression level of miR-200a was significantly ......" | 26045795 | |
| hsa-miR-200a-5p | endometrial cancer | metastasis | "The abnormal expression of the long noncoding RNA ......" | 27693631 | |
| hsa-miR-200a-5p | esophageal cancer | poor survival | "In this study we selected 10 miRNAs and analyzed t ......" | 20309880 | |
| hsa-miR-200a-5p | gastric cancer | tumorigenesis | "The effect of microRNA abnormalities in carcinogen ......" | 20484038 | |
| hsa-miR-200a-5p | gastric cancer | differentiation | "The microRNA-200 miR-200 family has been reported ......" | 22311119 | |
| hsa-miR-200a-5p | gastric cancer | worse prognosis | "Integrated microRNA network analyses identify a po ......" | 24352645 | |
| hsa-miR-200a-5p | gastric cancer | metastasis | "In addition the microRNA miR-200 family plays a ce ......" | 25411357 | |
| hsa-miR-200a-5p | gastric cancer | tumorigenesis; progression | "Although microRNA-200 miR-200 family members are t ......" | 25502084 | Wound Healing Assay |
| hsa-miR-200a-5p | gastric cancer | staging; metastasis | "In the first step of this study preliminary experi ......" | 26233325 | |
| hsa-miR-200a-5p | glioblastoma | metastasis | "We determined CSF levels of several cancer-associa ......" | 22492962 | |
| hsa-miR-200a-5p | head and neck cancer | metastasis; tumorigenesis | "Epithelial-mesenchymal-transition EMT is a critica ......" | 24424572 | |
| hsa-miR-200a-5p | kidney renal cell cancer | progression; tumorigenesis | "MicroRNA-429 miR-429 a short noncoding RNA belongi ......" | 25953723 | |
| hsa-miR-200a-5p | kidney renal cell cancer | staging | "Comparisons of RCC and BC expression signatures re ......" | 27357429 | |
| hsa-miR-200a-5p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
| hsa-miR-200a-5p | liver cancer | cell migration | "MicroRNA 200a and 200b mediated hepatocellular car ......" | 22868917 | Cell migration assay |
| hsa-miR-200a-5p | liver cancer | metastasis | "Epigenetic activation of the MiR 200 family contri ......" | 23222811 | |
| hsa-miR-200a-5p | liver cancer | drug resistance | "Expression of the microRNA-200 miR-200 family has ......" | 23760980 | Flow cytometry; MTT assay |
| hsa-miR-200a-5p | liver cancer | metastasis; progression | "The aim of this study was to assess the role of th ......" | 24135722 | |
| hsa-miR-200a-5p | liver cancer | staging; progression | "An expression analysis of miR 200a in serum and li ......" | 25203708 | |
| hsa-miR-200a-5p | liver cancer | poor survival; worse prognosis | "Eleven miRNAs miR- miR-19a miR-101-3p miR-199a-5p ......" | 25275448 | |
| hsa-miR-200a-5p | liver cancer | worse prognosis; metastasis; progression; poor survival | "miR 200a suppresses cell growth and migration by t ......" | 25482402 | |
| hsa-miR-200a-5p | liver cancer | metastasis | "MicroRNA 200a suppresses metastatic potential of s ......" | 25797260 | |
| hsa-miR-200a-5p | liver cancer | tumorigenesis; cell migration; metastasis | "MiR-200 family is an important regulator of epithe ......" | 25909223 | |
| hsa-miR-200a-5p | liver cancer | metastasis; tumorigenesis | "LncRNA HULC enhances epithelial mesenchymal transi ......" | 27285757 | |
| hsa-miR-200a-5p | lung cancer | metastasis; worse prognosis; tumorigenesis | "miR 200 Inhibits lung adenocarcinoma cell invasion ......" | 21115742 | |
| hsa-miR-200a-5p | lung cancer | metastasis | "The Notch ligand Jagged2 promotes lung adenocarcin ......" | 21403400 | |
| hsa-miR-200a-5p | lung cancer | differentiation | "The rBM 3-D culture-specific miRNA profile was hig ......" | 23036707 | |
| hsa-miR-200a-5p | lung cancer | metastasis | "Loss of miR-200s has been shown to enhance cancer ......" | 24791940 | |
| hsa-miR-200a-5p | lung cancer | metastasis; cell migration | "The miR 200 family and the miR 183~96~182 cluster ......" | 25798833 | |
| hsa-miR-200a-5p | lung cancer | staging; tumorigenesis | "MicroRNA-200 miR-200 has emerged as a regulator of ......" | 26314828 | |
| hsa-miR-200a-5p | lung cancer | metastasis; tumorigenesis | "BMP4 depletion by miR 200 inhibits tumorigenesis a ......" | 26395571 | Western blot; Luciferase |
| hsa-miR-200a-5p | lung cancer | staging | "Microarray analysis using 2000 probes revealed 87 ......" | 27189341 | |
| hsa-miR-200a-5p | lung cancer | progression | "Interestingly mir-200 family mir-200a mir-200b and ......" | 27695346 | |
| hsa-miR-200a-5p | lung squamous cell cancer | metastasis; immune resistance | "The microRNA‑200 miR-200 family is a powerful re ......" | 23708087 | Western blot |
| hsa-miR-200a-5p | lung squamous cell cancer | worse prognosis; staging | "The miRNA family miR-200 has been associated with ......" | 25003366 | |
| hsa-miR-200a-5p | lung squamous cell cancer | drug resistance; cell migration | "MicroRNA 200a Targets EGFR and c Met to Inhibit Mi ......" | 26184032 | |
| hsa-miR-200a-5p | lung squamous cell cancer | progression; tumorigenesis | "The microRNA miR-200 family has been demonstrated ......" | 27602157 | |
| hsa-miR-200a-5p | lymphoma | progression | "The profiles of miRNAs in conjunctival MALT lympho ......" | 22183793 | Luciferase |
| hsa-miR-200a-5p | melanoma | metastasis; progression; cell migration | "A functional role of microRNAs miRNAs or miRs in n ......" | 20957176 | |
| hsa-miR-200a-5p | melanoma | progression; metastasis | "Loss of microRNA 200a and c and microRNA 203 expre ......" | 22956368 | |
| hsa-miR-200a-5p | melanoma | tumorigenesis | "Arsenic exposed Keratinocytes Exhibit Differential ......" | 27054085 | |
| hsa-miR-200a-5p | ovarian cancer | worse prognosis | "The microRNA expression profiles were examined usi ......" | 18451233 | |
| hsa-miR-200a-5p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
| hsa-miR-200a-5p | ovarian cancer | staging; poor survival; recurrence; cell migration | "A miR 200 microRNA cluster as prognostic marker in ......" | 19501389 | |
| hsa-miR-200a-5p | ovarian cancer | tumorigenesis | "Regulation of miR 200 family microRNAs and ZEB tra ......" | 19854497 | Luciferase |
| hsa-miR-200a-5p | ovarian cancer | worse prognosis | "We highlight the role of the let-7 and miR-200 fam ......" | 20083225 | |
| hsa-miR-200a-5p | ovarian cancer | progression; poor survival; drug resistance | "The miR 200 family controls beta tubulin III expre ......" | 21051560 | |
| hsa-miR-200a-5p | ovarian cancer | progression | "MicroRNA 200a inhibits CD133/1+ ovarian cancer ste ......" | 21529905 | Western blot; Luciferase; Wound Healing Assay |
| hsa-miR-200a-5p | ovarian cancer | poor survival; recurrence | "In this study miR-187 and miR-200a were found to b ......" | 21725366 | |
| hsa-miR-200a-5p | ovarian cancer | worse prognosis; staging | "Two families of miRNAs miR-200 and let-7 are frequ ......" | 23237306 | |
| hsa-miR-200a-5p | ovarian cancer | staging | "The biphasic expression pattern of miR 200a and E ......" | 23888941 | |
| hsa-miR-200a-5p | ovarian cancer | drug resistance | "Sequence variation among members of the miR 200 mi ......" | 24447705 | |
| hsa-miR-200a-5p | ovarian cancer | poor survival; progression; worse prognosis | "The role of miR 200a in vasculogenic mimicry and i ......" | 24503464 | Western blot; Luciferase |
| hsa-miR-200a-5p | ovarian cancer | progression; poor survival | "Differences in miRNA expression between HGSC CCC a ......" | 24512620 | |
| hsa-miR-200a-5p | ovarian cancer | metastasis; recurrence | "We recently determined that the ectopic over-expre ......" | 24802724 | |
| hsa-miR-200a-5p | ovarian cancer | metastasis; drug resistance | "For example deficiencies of enzymes including Dice ......" | 24822185 | |
| hsa-miR-200a-5p | ovarian cancer | progression; metastasis | "Epithelial mesenchymal transition associated miRNA ......" | 24952258 | |
| hsa-miR-200a-5p | ovarian cancer | poor survival; staging; progression | "Clinicopathological and prognostic implications of ......" | 24966949 | |
| hsa-miR-200a-5p | ovarian cancer | drug resistance | "Involvement of miR 200a in chemosensitivity regula ......" | 25327865 | Western blot; Luciferase |
| hsa-miR-200a-5p | ovarian cancer | staging; progression | "miR 200a overexpression in advanced ovarian carcin ......" | 25374174 | |
| hsa-miR-200a-5p | ovarian cancer | poor survival | "The authors used quantitative polymerase chain rea ......" | 25556270 | Western blot |
| hsa-miR-200a-5p | ovarian cancer | drug resistance | "Upregulation of microRNA 200a associates with tumo ......" | 25997962 | Colony formation |
| hsa-miR-200a-5p | ovarian cancer | progression; staging; worse prognosis; poor survival | "Expression of serum miR 200a miR 200b and miR 200c ......" | 26063644 | |
| hsa-miR-200a-5p | ovarian cancer | progression; poor survival | "The prognostic value of the miR 200 family in ovar ......" | 26910180 | |
| hsa-miR-200a-5p | ovarian cancer | malignant trasformation; staging; metastasis | "Diagnostic and prognostic relevance of circulating ......" | 26943577 | |
| hsa-miR-200a-5p | ovarian cancer | metastasis | "The miR-200 family especially miR-200c has been sh ......" | 27601996 | |
| hsa-miR-200a-5p | ovarian cancer | poor survival | "Furthermore some of the identified DNA-methylated ......" | 27746113 | |
| hsa-miR-200a-5p | ovarian cancer | malignant trasformation | "Circulating Cell Free miR 373 miR 200a miR 200b an ......" | 27753009 | |
| hsa-miR-200a-5p | pancreatic cancer | metastasis | "Additionally the miR-200 family regulates several ......" | 24040120 | Luciferase |
| hsa-miR-200a-5p | pancreatic cancer | cell migration | "MiR 200a inhibits epithelial mesenchymal transitio ......" | 24521357 | |
| hsa-miR-200a-5p | prostate cancer | staging | "Biochemical relapse following radical prostatectom ......" | 22161972 | |
| hsa-miR-200a-5p | prostate cancer | metastasis | "Regulation of epithelial plasticity by miR 424 and ......" | 24193225 | |
| hsa-miR-200a-5p | prostate cancer | metastasis; progression | "Here we demonstrate the involvement of miR-200 b i ......" | 24391862 | |
| hsa-miR-200a-5p | prostate cancer | poor survival | "Non-responders to docetaxel and patients with shor ......" | 24714754 | |
| hsa-miR-200a-5p | prostate cancer | progression; tumorigenesis | "Expression of 1205 human miRNAs and miRNA*s were e ......" | 25768283 | |
| hsa-miR-200a-5p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-200a-5p | sarcoma | tumorigenesis | "MiR-141 which belong to miR-200 family take a part ......" | 24307282 | |
| hsa-miR-200a-5p | thyroid cancer | cell migration | "However specific miRNAs are downregulated in ATC s ......" | 25202329 |
Reported gene related to hsa-miR-200a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-200a-5p | breast cancer | CDH1 | "β1 integrin inhibition elicits a prometastatic sw ......" | 24518294 |
| hsa-miR-200a-5p | breast cancer | CDH1 | "These findings are surprising since the miR-200 fa ......" | 19787069 |
| hsa-miR-200a-5p | breast cancer | CDH1 | "Here we demonstrate that the tumor suppressive miR ......" | 26062653 |
| hsa-miR-200a-5p | breast cancer | CDH1 | "We establish that miR-200a directs cell migration ......" | 26088362 |
| hsa-miR-200a-5p | endometrial cancer | CDH1 | "Moreover the study explored the involvement of mic ......" | 27497669 |
| hsa-miR-200a-5p | gastric cancer | CDH1 | "E-cadherin expression was partially restored by tr ......" | 20484038 |
| hsa-miR-200a-5p | liver cancer | CDH1 | "Spearman's Rho analysis revealed a significant neg ......" | 24895326 |
| hsa-miR-200a-5p | liver cancer | CDH1 | "We found that overexpression of miR-200 family mem ......" | 22868917 |
| hsa-miR-200a-5p | lung cancer | CDH1 | "However the expression of miR-200a was not signifi ......" | 27189341 |
| hsa-miR-200a-5p | melanoma | CDH1 | "MiR-200 in situ hybridization and E-cadherin immun ......" | 22956368 |
| hsa-miR-200a-5p | ovarian cancer | CDH1 | "The biphasic expression pattern of miR 200a and E ......" | 23888941 |
| hsa-miR-200a-5p | ovarian cancer | CDH1 | "Our findings showed that miR-101 represents a redu ......" | 24677166 |
| hsa-miR-200a-5p | ovarian cancer | CDH1 | "MicroRNA 200a inhibits CD133/1+ ovarian cancer ste ......" | 21529905 |
| hsa-miR-200a-5p | pancreatic cancer | CDH1 | "In a panel of 23 pancreatic cell lines we observed ......" | 20551052 |
| hsa-miR-200a-5p | thyroid cancer | CDH1 | "Restoration of miR-200 expression by pre-miR-200a/ ......" | 25542369 |
| hsa-miR-200a-5p | B cell lymphoma | ZEB1 | "Inhibition of ZEB1 by miR 200 characterizes Helico ......" | 24390222 |
| hsa-miR-200a-5p | bladder cancer | ZEB1 | "ZEB1 is also known to repress miR-200c-141 transcr ......" | 20473948 |
| hsa-miR-200a-5p | breast cancer | ZEB1 | "Conversely ectopic expression of miR-200 inhibited ......" | 27402080 |
| hsa-miR-200a-5p | breast cancer | ZEB1 | "Concomitant with miR-200 decrease there was an inc ......" | 23626803 |
| hsa-miR-200a-5p | breast cancer | ZEB1 | "MiR 200 can repress breast cancer metastasis throu ......" | 24037528 |
| hsa-miR-200a-5p | colorectal cancer | ZEB1 | "MiR 200 suppresses metastases of colorectal cancer ......" | 26242262 |
| hsa-miR-200a-5p | endometrial cancer | ZEB1 | "This finding was accompanied by a sharp downregula ......" | 23743934 |
| hsa-miR-200a-5p | head and neck cancer | ZEB1 | "Furthermore our data suggest that the promoter hyp ......" | 24424572 |
| hsa-miR-200a-5p | ovarian cancer | ZEB1 | "We used qRT-PCR to examine expression of the miR-2 ......" | 19854497 |
| hsa-miR-200a-5p | ovarian cancer | ZEB1 | "GRHL2 miR 200 ZEB1 maintains the epithelial status ......" | 26887977 |
| hsa-miR-200a-5p | prostate cancer | ZEB1 | "Recent studies have shown that the miR-200 family ......" | 19544444 |
| hsa-miR-200a-5p | sarcoma | ZEB1 | "This circuit comprises the microRNA 200 miR-200 fa ......" | 27402864 |
| hsa-miR-200a-5p | sarcoma | ZEB1 | "Moreover a series of loss-of-function and gain-of- ......" | 24815002 |
| hsa-miR-200a-5p | breast cancer | ZEB2 | "This switch involved activation of the transformin ......" | 24518294 |
| hsa-miR-200a-5p | breast cancer | ZEB2 | "These findings are surprising since the miR-200 fa ......" | 19787069 |
| hsa-miR-200a-5p | head and neck cancer | ZEB2 | "Furthermore our data suggest that the promoter hyp ......" | 24424572 |
| hsa-miR-200a-5p | liver cancer | ZEB2 | "MicroRNA 200a suppresses metastatic potential of s ......" | 25797260 |
| hsa-miR-200a-5p | ovarian cancer | ZEB2 | "We used qRT-PCR to examine expression of the miR-2 ......" | 19854497 |
| hsa-miR-200a-5p | ovarian cancer | ZEB2 | "MicroRNA 200a inhibits CD133/1+ ovarian cancer ste ......" | 21529905 |
| hsa-miR-200a-5p | prostate cancer | ZEB2 | "Recent studies have shown that the miR-200 family ......" | 19544444 |
| hsa-miR-200a-5p | sarcoma | ZEB2 | "Moreover a series of loss-of-function and gain-of- ......" | 24815002 |
| hsa-miR-200a-5p | breast cancer | EPHA2 | "Our studies propose EphA2 as a novel and important ......" | 22562546 |
| hsa-miR-200a-5p | breast cancer | EPHA2 | "miR 200a inhibits migration of triple negative bre ......" | 26088362 |
| hsa-miR-200a-5p | ovarian cancer | EPHA2 | "In addition our results suggested that miR-200a in ......" | 24503464 |
| hsa-miR-200a-5p | endometrial cancer | PTEN | "PTEN might be a potential target of miR-141 and mi ......" | 24742567 |
| hsa-miR-200a-5p | pancreatic cancer | PTEN | "Re expression of miR 200 by novel approaches regul ......" | 22637745 |
| hsa-miR-200a-5p | pancreatic cancer | PTEN | "Anti tumor activity of a novel compound CDF is med ......" | 21408027 |
| hsa-miR-200a-5p | liver cancer | VIM | "Spearman's Rho analysis revealed a significant neg ......" | 24895326 |
| hsa-miR-200a-5p | prostate cancer | VIM | "In contrast mesenchymal markers fibronectin and vi ......" | 24391862 |
| hsa-miR-200a-5p | thyroid cancer | VIM | "Restoration of miR-200 expression by pre-miR-200a/ ......" | 25542369 |
| hsa-miR-200a-5p | liver cancer | AFP | "Real-time quantitative PCR and enzyme-linked immun ......" | 25203708 |
| hsa-miR-200a-5p | liver cancer | AFP | "Multivariate analysis demonstrated that AFP satell ......" | 25275448 |
| hsa-miR-200a-5p | thyroid cancer | ATM | "However specific miRNAs are downregulated in ATC s ......" | 25202329 |
| hsa-miR-200a-5p | thyroid cancer | ATM | "This study was set to study the molecular mechanis ......" | 25542369 |
| hsa-miR-200a-5p | pancreatic cancer | CD44 | "Pancreatic cancer cells with EMT phenotype display ......" | 24521357 |
| hsa-miR-200a-5p | pancreatic cancer | CD44 | "In the current study we showed for the first time ......" | 21408027 |
| hsa-miR-200a-5p | bladder cancer | EGFR | "Protein expression and signaling pathway modulatio ......" | 19671845 |
| hsa-miR-200a-5p | lung squamous cell cancer | EGFR | "MicroRNA 200a Targets EGFR and c Met to Inhibit Mi ......" | 26184032 |
| hsa-miR-200a-5p | ovarian cancer | GRHL2 | "GRHL2 miR 200 ZEB1 maintains the epithelial status ......" | 26887977 |
| hsa-miR-200a-5p | sarcoma | GRHL2 | "This circuit comprises the microRNA 200 miR-200 fa ......" | 27402864 |
| hsa-miR-200a-5p | breast cancer | KEAP1 | "miR 200a regulates Nrf2 activation by targeting Ke ......" | 21926171 |
| hsa-miR-200a-5p | esophageal cancer | KEAP1 | "MSA could also significantly induce miR-200a expre ......" | 26341629 |
| hsa-miR-200a-5p | lung cancer | QRSL1 | "It was reported that miR-200 can activate PI3K/AKT ......" | 26314828 |
| hsa-miR-200a-5p | lung cancer | QRSL1 | "Mechanistically Jagged2 was found to promote metas ......" | 21403400 |
| hsa-miR-200a-5p | breast cancer | TAM | "miR-200 family expression was progressively reduce ......" | 23626803 |
| hsa-miR-200a-5p | endometrial cancer | TAM | "When treated with TAM ECC-1 and Ishikawa cells wer ......" | 23295740 |
| hsa-miR-200a-5p | ovarian cancer | ABCB6 | "Furthermore miR-200a regulation of chemoresistance ......" | 25327865 |
| hsa-miR-200a-5p | ovarian cancer | ABCG2 | "Finally the interaction between miR-200a and ABCG2 ......" | 25327865 |
| hsa-miR-200a-5p | ovarian cancer | ABCG4 | "Furthermore miR-200a regulation of chemoresistance ......" | 25327865 |
| hsa-miR-200a-5p | breast cancer | ADAM12 | "ADAM12 L is a direct target of the miR 29 and miR ......" | 25886595 |
| hsa-miR-200a-5p | lung cancer | AKT2 | "These results suggest that AKT2 can regulate miR-2 ......" | 27189341 |
| hsa-miR-200a-5p | prostate cancer | AR | "We identified miR-200 b as a downstream target of ......" | 24391862 |
| hsa-miR-200a-5p | lung squamous cell cancer | ATRX | "Additionally miR-200 family downregulates HNRNPR3 ......" | 23708087 |
| hsa-miR-200a-5p | B cell lymphoma | BCL6 | "In 30 H pylori-positive and 30 H pylori-negative g ......" | 24390222 |
| hsa-miR-200a-5p | lung cancer | BMP4 | "BMP4 depletion by miR 200 inhibits tumorigenesis a ......" | 26395571 |
| hsa-miR-200a-5p | colon cancer | CCL16 | "This observation indicates a common molecular axis ......" | 25832648 |
| hsa-miR-200a-5p | lymphoma | CCNE2 | "Targetscan analysis suggested cyclin E2 as potenti ......" | 22183793 |
| hsa-miR-200a-5p | pancreatic cancer | CD24 | "Pancreatic cancer cells with EMT phenotype display ......" | 24521357 |
| hsa-miR-200a-5p | colorectal cancer | CD2AP | "Importantly epigenetic silencing of the miR-200 fa ......" | 27157610 |
| hsa-miR-200a-5p | liver cancer | CDK6 | "microRNA 200a is an independent prognostic factor ......" | 24009066 |
| hsa-miR-200a-5p | melanoma | CHL1 | "Overall our findings call into question the genera ......" | 20957176 |
| hsa-miR-200a-5p | thyroid cancer | CHST14 | "We identified two significantly decreased microRNA ......" | 20498632 |
| hsa-miR-200a-5p | liver cancer | CXCL1 | "Using computational analysis we identified the mic ......" | 27542259 |
| hsa-miR-200a-5p | prostate cancer | DICER1 | "These findings suggest possibilities that miR-200a ......" | 25768283 |
| hsa-miR-200a-5p | bladder cancer | EGF | "miR 200 expression regulates epithelial to mesench ......" | 19671845 |
| hsa-miR-200a-5p | pancreatic cancer | EPCAM | "In the current study we showed for the first time ......" | 21408027 |
| hsa-miR-200a-5p | breast cancer | FERMT2 | "Here we report that Kindlin 2 markedly downregulat ......" | 23483548 |
| hsa-miR-200a-5p | lung cancer | FLT1 | "Forced miR-200 expression suppressed Flt1 levels i ......" | 21115742 |
| hsa-miR-200a-5p | prostate cancer | FN1 | "In contrast mesenchymal markers fibronectin and vi ......" | 24391862 |
| hsa-miR-200a-5p | lung cancer | FOXF2 | "The miR 200 family and the miR 183~96~182 cluster ......" | 25798833 |
| hsa-miR-200a-5p | breast cancer | FOXM1 | "SUMOylation of FOXM1B alters its transcriptional a ......" | 24918286 |
| hsa-miR-200a-5p | lung cancer | GATA3 | "Reciprocally miR-200 inhibited expression of Gata3 ......" | 21403400 |
| hsa-miR-200a-5p | breast cancer | GJA1 | "Identification of miR 200a as a novel suppressor o ......" | 26283635 |
| hsa-miR-200a-5p | prostate cancer | GNA13 | "MicroRNA 182 and microRNA 200a control G protein s ......" | 23329838 |
| hsa-miR-200a-5p | prostate cancer | GNB2 | "MicroRNA 182 and microRNA 200a control G protein s ......" | 23329838 |
| hsa-miR-200a-5p | liver cancer | H19 | "Epigenetic activation of the MiR 200 family contri ......" | 23222811 |
| hsa-miR-200a-5p | liver cancer | HDAC4 | "Furthermore our results suggested that the histone ......" | 21837748 |
| hsa-miR-200a-5p | lung squamous cell cancer | HFE | "Additionally miR-200 family downregulates HNRNPR3 ......" | 23708087 |
| hsa-miR-200a-5p | lung squamous cell cancer | HMI | "The miR-200 family and these potential targets are ......" | 23708087 |
| hsa-miR-200a-5p | liver cancer | HULC | "LncRNA HULC enhances epithelial mesenchymal transi ......" | 27285757 |
| hsa-miR-200a-5p | lung cancer | IRS1 | "Taken together our results suggest that miR-200 ma ......" | 26314828 |
| hsa-miR-200a-5p | breast cancer | ITGA9 | "β1 integrin inhibition elicits a prometastatic sw ......" | 24518294 |
| hsa-miR-200a-5p | lung cancer | JAG2 | "The Notch ligand Jagged2 promotes lung adenocarcin ......" | 21403400 |
| hsa-miR-200a-5p | endometrial cancer | KCNE1 | "Furthermore it was observed that the expression pa ......" | 26788150 |
| hsa-miR-200a-5p | esophageal cancer | KLF4 | "Moreover MSA-induced miR-200a expression was depen ......" | 26341629 |
| hsa-miR-200a-5p | breast cancer | LOC100128922 | "Identification of miR 200a as a novel suppressor o ......" | 26283635 |
| hsa-miR-200a-5p | liver cancer | MACC1 | "miR 200a suppresses cell growth and migration by t ......" | 25482402 |
| hsa-miR-200a-5p | endometrial cancer | MALAT1 | "The abnormal expression of the long noncoding RNA ......" | 27693631 |
| hsa-miR-200a-5p | breast cancer | MAPK8 | "SUMOylation of FOXM1B alters its transcriptional a ......" | 24918286 |
| hsa-miR-200a-5p | lung squamous cell cancer | MET | "MicroRNA 200a Targets EGFR and c Met to Inhibit Mi ......" | 26184032 |
| hsa-miR-200a-5p | pancreatic cancer | MMP14 | "Re expression of miR 200 by novel approaches regul ......" | 22637745 |
| hsa-miR-200a-5p | ovarian cancer | MMP2 | "Interestingly our findings show that catalpol trea ......" | 25347277 |
| hsa-miR-200a-5p | breast cancer | MSN | "MiR 200 can repress breast cancer metastasis throu ......" | 24037528 |
| hsa-miR-200a-5p | endometrial cancer | MYC | "Tamoxifen represses miR 200 microRNAs and promotes ......" | 23295740 |
| hsa-miR-200a-5p | lymphoma | PCNA | "Targetscan analysis suggested cyclin E2 as potenti ......" | 22183793 |
| hsa-miR-200a-5p | prostate cancer | PDGFD | "miR 200 regulates PDGF D mediated epithelial mesen ......" | 19544444 |
| hsa-miR-200a-5p | breast cancer | PELP1 | "Whole genome miR array analysis using PELP1-overex ......" | 23975430 |
| hsa-miR-200a-5p | breast cancer | PHLDA3 | "Our data indicate that Kindlin 2 plays a novel rol ......" | 23483548 |
| hsa-miR-200a-5p | pancreatic cancer | PTGS2 | "In a xenograft mouse model of human PC CDF treatme ......" | 21408027 |
| hsa-miR-200a-5p | breast cancer | SGSM3 | "The genes encoding microRNAs of the human miR-200 ......" | 20514023 |
| hsa-miR-200a-5p | breast cancer | SLC10A4 | "Here we investigated P4 downregulation of miR-141 ......" | 25241899 |
| hsa-miR-200a-5p | colorectal cancer | SNAI1 | "EMT-TFs and microRNAs such as ZEB1/2 and miR-200 o ......" | 27573895 |
| hsa-miR-200a-5p | kidney renal cell cancer | SPAG9 | "MicroRNA 200a 3p suppresses tumor proliferation an ......" | 26797273 |
| hsa-miR-200a-5p | endometrial cancer | SPEN | "This finding was accompanied by a sharp downregula ......" | 23743934 |
| hsa-miR-200a-5p | breast cancer | TFAM | "In this study we showed that miR-200a expression l ......" | 24684598 |
| hsa-miR-200a-5p | thyroid cancer | TGFB1 | "Inhibition of TGFbeta receptor 1 TGFBR1 in these c ......" | 20498632 |
| hsa-miR-200a-5p | kidney renal cell cancer | TGFB2 | "Tumor suppressive microRNA 200a inhibits renal cel ......" | 25813153 |
| hsa-miR-200a-5p | thyroid cancer | TGFBR1 | "Inhibition of TGFbeta receptor 1 TGFBR1 in these c ......" | 20498632 |
| hsa-miR-200a-5p | endometrial cancer | TIMP2 | "We found that miR-200b repressed TIMP2 expression ......" | 23205572 |
| hsa-miR-200a-5p | esophageal cancer | TPO | "MSA could also significantly induce miR-200a expre ......" | 26341629 |
| hsa-miR-200a-5p | bladder cancer | TWIST1 | "In addition we observe that the mesoderm transcrip ......" | 20473948 |
| hsa-miR-200a-5p | kidney renal cell cancer | VEGFA | "We also found strong anti-correlation between VEGF ......" | 20420713 |
| hsa-miR-200a-5p | breast cancer | YAP1 | "MicroRNA 200a promotes anoikis resistance and meta ......" | 23340296 |
| hsa-miR-200a-5p | lung cancer | ZFPM2 | "It was reported that miR-200 can activate PI3K/AKT ......" | 26314828 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-200a-5p | AFF3 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.493; TCGA CESC -0.373; TCGA COAD -0.616; TCGA ESCA -0.419; TCGA HNSC -0.219; TCGA KIRC -0.274; TCGA KIRP -0.339; TCGA LUSC -0.677; TCGA PAAD -0.439; TCGA PRAD -0.212; TCGA STAD -0.562; TCGA UCEC -0.3 |
hsa-miR-200a-5p | THBS1 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.397; TCGA CESC -0.486; TCGA COAD -0.523; TCGA ESCA -0.391; TCGA HNSC -0.494; TCGA LUAD -0.193; TCGA LUSC -0.436; TCGA OV -0.201; TCGA PAAD -0.254; TCGA STAD -0.284; TCGA UCEC -0.342 |
hsa-miR-200a-5p | TXLNB | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.385; TCGA CESC -0.364; TCGA COAD -0.615; TCGA ESCA -0.466; TCGA HNSC -0.647; TCGA KIRC -0.435; TCGA LUAD -0.196; TCGA LUSC -0.133; TCGA PAAD -0.471; TCGA STAD -0.502; TCGA UCEC -0.374 |
hsa-miR-200a-5p | CRIM1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.054; TCGA BRCA -0.195; TCGA CESC -0.256; TCGA COAD -0.112; TCGA ESCA -0.124; TCGA HNSC -0.225; TCGA KIRP -0.111; TCGA LUAD -0.142; TCGA LUSC -0.219; TCGA OV -0.14; TCGA STAD -0.182; TCGA UCEC -0.234 |
hsa-miR-200a-5p | RFTN2 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.148; TCGA BRCA -0.309; TCGA CESC -0.188; TCGA COAD -0.381; TCGA HNSC -0.184; TCGA KIRC -0.109; TCGA LUAD -0.167; TCGA LUSC -0.242; TCGA OV -0.112; TCGA PAAD -0.142; TCGA STAD -0.2; TCGA UCEC -0.35 |
hsa-miR-200a-5p | ST6GALNAC3 | 12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.225; TCGA BRCA -0.333; TCGA CESC -0.37; TCGA HNSC -0.315; TCGA KIRP -0.32; TCGA LUAD -0.139; TCGA LUSC -0.415; TCGA OV -0.155; TCGA PAAD -0.128; TCGA PRAD -0.137; TCGA STAD -0.204; TCGA UCEC -0.41 |
hsa-miR-200a-5p | EID1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.071; TCGA BRCA -0.085; TCGA CESC -0.09; TCGA COAD -0.156; TCGA ESCA -0.093; TCGA HNSC -0.161; TCGA KIRP -0.086; TCGA LIHC -0.068; TCGA LUAD -0.061; TCGA PAAD -0.08; TCGA STAD -0.266; TCGA UCEC -0.168 |
hsa-miR-200a-5p | STX2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.4; TCGA BRCA -0.124; TCGA CESC -0.182; TCGA COAD -0.195; TCGA ESCA -0.174; TCGA HNSC -0.245; TCGA KIRC -0.133; TCGA KIRP -0.078; TCGA LUAD -0.105; TCGA LUSC -0.371; TCGA OV -0.142; TCGA PAAD -0.142; TCGA PRAD -0.11; TCGA STAD -0.268; TCGA UCEC -0.266 |
hsa-miR-200a-5p | HCFC2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.124; TCGA BRCA -0.106; TCGA CESC -0.11; TCGA COAD -0.142; TCGA ESCA -0.13; TCGA HNSC -0.129; TCGA LUAD -0.06; TCGA LUSC -0.123; TCGA OV -0.076; TCGA PAAD -0.119; TCGA STAD -0.232; TCGA UCEC -0.189 |
hsa-miR-200a-5p | RIMKLB | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.202; TCGA BRCA -0.104; TCGA CESC -0.144; TCGA COAD -0.649; TCGA ESCA -0.385; TCGA KIRC -0.083; TCGA KIRP -0.097; TCGA LUSC -0.101; TCGA PAAD -0.17; TCGA STAD -0.349; TCGA UCEC -0.065 |
hsa-miR-200a-5p | NCF2 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD | MirTarget | TCGA BLCA -0.415; TCGA CESC -0.126; TCGA COAD -0.253; TCGA ESCA -0.26; TCGA HNSC -0.128; TCGA KIRC -0.332; TCGA KIRP -0.236; TCGA LUAD -0.28; TCGA LUSC -0.451; TCGA PAAD -0.232 |
hsa-miR-200a-5p | MBNL1 | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.14; TCGA BRCA -0.132; TCGA CESC -0.086; TCGA ESCA -0.144; TCGA KIRC -0.128; TCGA KIRP -0.069; TCGA LUAD -0.085; TCGA PAAD -0.117; TCGA STAD -0.191; TCGA UCEC -0.146 |
hsa-miR-200a-5p | RORA | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.161; TCGA BRCA -0.135; TCGA COAD -0.434; TCGA ESCA -0.254; TCGA HNSC -0.121; TCGA LIHC -0.101; TCGA LUSC -0.1; TCGA OV -0.146; TCGA PAAD -0.19; TCGA STAD -0.282; TCGA UCEC -0.237 |
hsa-miR-200a-5p | FZD1 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.114; TCGA COAD -0.283; TCGA ESCA -0.144; TCGA HNSC -0.155; TCGA KIRC -0.237; TCGA LUAD -0.074; TCGA OV -0.126; TCGA PAAD -0.116; TCGA STAD -0.126; TCGA UCEC -0.118 |
hsa-miR-200a-5p | KLF9 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.377; TCGA BRCA -0.285; TCGA CESC -0.213; TCGA COAD -0.342; TCGA ESCA -0.246; TCGA HNSC -0.267; TCGA LIHC -0.17; TCGA LUAD -0.201; TCGA LUSC -0.415; TCGA OV -0.177; TCGA PAAD -0.211; TCGA PRAD -0.052; TCGA STAD -0.405; TCGA UCEC -0.305 |
hsa-miR-200a-5p | ATP8B4 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.395; TCGA BRCA -0.246; TCGA CESC -0.354; TCGA COAD -0.21; TCGA ESCA -0.27; TCGA HNSC -0.254; TCGA KIRP -0.115; TCGA LUAD -0.115; TCGA LUSC -0.311; TCGA OV -0.172; TCGA PAAD -0.339; TCGA PRAD -0.137; TCGA STAD -0.154; TCGA UCEC -0.351 |
hsa-miR-200a-5p | COPS8 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.105; TCGA COAD -0.078; TCGA ESCA -0.071; TCGA HNSC -0.098; TCGA KIRC -0.068; TCGA KIRP -0.191; TCGA PAAD -0.065; TCGA PRAD -0.051; TCGA STAD -0.08; TCGA UCEC -0.063 |
hsa-miR-200a-5p | ZC3H12C | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.088; TCGA BRCA -0.238; TCGA CESC -0.17; TCGA ESCA -0.122; TCGA HNSC -0.101; TCGA KIRP -0.129; TCGA LUAD -0.104; TCGA LUSC -0.111; TCGA OV -0.116; TCGA PAAD -0.102; TCGA STAD -0.183; TCGA UCEC -0.227 |
hsa-miR-200a-5p | MCC | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.069; TCGA BRCA -0.152; TCGA CESC -0.424; TCGA COAD -0.532; TCGA ESCA -0.405; TCGA LUAD -0.182; TCGA OV -0.234; TCGA PAAD -0.209; TCGA STAD -0.366; TCGA UCEC -0.258 |
hsa-miR-200a-5p | GAS7 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.498; TCGA BRCA -0.243; TCGA CESC -0.432; TCGA COAD -0.657; TCGA ESCA -0.392; TCGA HNSC -0.394; TCGA KIRP -0.196; TCGA LUAD -0.235; TCGA LUSC -0.534; TCGA OV -0.145; TCGA PAAD -0.309; TCGA STAD -0.395; TCGA UCEC -0.246 |
hsa-miR-200a-5p | FGFR1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD | mirMAP | TCGA BLCA -0.446; TCGA BRCA -0.216; TCGA CESC -0.15; TCGA COAD -0.557; TCGA ESCA -0.353; TCGA HNSC -0.348; TCGA KIRC -0.117; TCGA KIRP -0.196; TCGA LUAD -0.2; TCGA LUSC -0.106; TCGA PAAD -0.213; TCGA PRAD -0.112; TCGA STAD -0.428 |
hsa-miR-200a-5p | HEPH | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.411; TCGA BRCA -0.081; TCGA CESC -0.395; TCGA HNSC -0.399; TCGA KIRC -0.097; TCGA KIRP -0.251; TCGA LUSC -0.34; TCGA PRAD -0.12; TCGA STAD -0.123; TCGA UCEC -0.317 |
hsa-miR-200a-5p | PTGS1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD | mirMAP | TCGA BLCA -0.732; TCGA CESC -0.452; TCGA COAD -0.383; TCGA ESCA -0.29; TCGA HNSC -0.189; TCGA LUAD -0.177; TCGA LUSC -0.355; TCGA PAAD -0.272; TCGA PRAD -0.133; TCGA STAD -0.329 |
hsa-miR-200a-5p | CBL | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.083; TCGA BRCA -0.063; TCGA CESC -0.071; TCGA COAD -0.067; TCGA ESCA -0.05; TCGA KIRC -0.1; TCGA LUAD -0.111; TCGA LUSC -0.05; TCGA PAAD -0.086; TCGA STAD -0.081; TCGA UCEC -0.102 |
hsa-miR-200a-5p | QKI | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.115; TCGA BRCA -0.224; TCGA CESC -0.187; TCGA COAD -0.416; TCGA ESCA -0.315; TCGA HNSC -0.188; TCGA KIRC -0.112; TCGA KIRP -0.132; TCGA LUAD -0.221; TCGA LUSC -0.181; TCGA OV -0.122; TCGA PAAD -0.222; TCGA STAD -0.279; TCGA UCEC -0.2 |
hsa-miR-200a-5p | IGFBP5 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.435; TCGA BRCA -0.166; TCGA CESC -0.291; TCGA COAD -0.738; TCGA ESCA -0.276; TCGA HNSC -0.292; TCGA OV -0.231; TCGA STAD -0.352; TCGA UCEC -0.347 |
hsa-miR-200a-5p | KLF12 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.284; TCGA BRCA -0.063; TCGA COAD -0.347; TCGA ESCA -0.261; TCGA HNSC -0.137; TCGA LIHC -0.095; TCGA LUAD -0.089; TCGA LUSC -0.179; TCGA OV -0.088; TCGA PAAD -0.209; TCGA PRAD -0.099; TCGA STAD -0.287; TCGA UCEC -0.201 |
hsa-miR-200a-5p | SEPT7 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.09; TCGA CESC -0.084; TCGA COAD -0.107; TCGA ESCA -0.096; TCGA HNSC -0.074; TCGA KIRC -0.122; TCGA OV -0.06; TCGA PAAD -0.068; TCGA STAD -0.143; TCGA UCEC -0.131 |
hsa-miR-200a-5p | FOXP2 | 9 cancers: BLCA; BRCA; COAD; ESCA; OV; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.347; TCGA BRCA -0.455; TCGA COAD -0.892; TCGA ESCA -0.542; TCGA OV -0.433; TCGA PAAD -0.249; TCGA THCA -0.119; TCGA STAD -0.795; TCGA UCEC -0.621 |
hsa-miR-200a-5p | TMOD2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.149; TCGA BRCA -0.18; TCGA CESC -0.3; TCGA COAD -0.424; TCGA ESCA -0.149; TCGA HNSC -0.229; TCGA KIRC -0.153; TCGA LUAD -0.188; TCGA LUSC -0.352; TCGA OV -0.19; TCGA PAAD -0.199; TCGA STAD -0.319; TCGA UCEC -0.402 |
hsa-miR-200a-5p | NOTCH2 | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.167; TCGA COAD -0.132; TCGA ESCA -0.132; TCGA LUAD -0.064; TCGA LUSC -0.114; TCGA OV -0.075; TCGA PAAD -0.175; TCGA STAD -0.173; TCGA UCEC -0.09 |
hsa-miR-200a-5p | IL6ST | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.32; TCGA BRCA -0.105; TCGA COAD -0.23; TCGA ESCA -0.142; TCGA HNSC -0.245; TCGA LUAD -0.123; TCGA LUSC -0.397; TCGA OV -0.148; TCGA STAD -0.231; TCGA UCEC -0.216 |
hsa-miR-200a-5p | DZIP1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.274; TCGA BRCA -0.181; TCGA CESC -0.295; TCGA COAD -0.659; TCGA ESCA -0.519; TCGA HNSC -0.164; TCGA LUAD -0.131; TCGA OV -0.121; TCGA PAAD -0.277; TCGA STAD -0.45; TCGA UCEC -0.367 |
hsa-miR-200a-5p | TTLL7 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; STAD | mirMAP | TCGA BLCA -0.281; TCGA BRCA -0.16; TCGA COAD -0.375; TCGA ESCA -0.218; TCGA HNSC -0.275; TCGA KIRC -0.287; TCGA LIHC -0.169; TCGA LUAD -0.148; TCGA LUSC -0.29; TCGA THCA -0.094; TCGA STAD -0.499 |
hsa-miR-200a-5p | ENTPD1 | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.209; TCGA CESC -0.188; TCGA COAD -0.275; TCGA ESCA -0.116; TCGA HNSC -0.131; TCGA KIRC -0.211; TCGA KIRP -0.067; TCGA LUAD -0.123; TCGA LUSC -0.23; TCGA OV -0.101; TCGA PAAD -0.191; TCGA PRAD -0.084; TCGA STAD -0.167; TCGA UCEC -0.183 |
hsa-miR-200a-5p | NTRK3 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.369; TCGA BRCA -0.311; TCGA CESC -0.48; TCGA COAD -0.983; TCGA ESCA -0.477; TCGA HNSC -0.415; TCGA LUAD -0.259; TCGA LUSC -0.602; TCGA OV -0.432; TCGA PAAD -0.34; TCGA PRAD -0.088; TCGA STAD -0.617; TCGA UCEC -0.467 |
hsa-miR-200a-5p | ABL2 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD | mirMAP | TCGA BLCA -0.147; TCGA CESC -0.122; TCGA COAD -0.194; TCGA ESCA -0.124; TCGA HNSC -0.164; TCGA KIRC -0.221; TCGA LUAD -0.11; TCGA LUSC -0.159; TCGA PAAD -0.159 |
hsa-miR-200a-5p | RNF217 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; PAAD; STAD | mirMAP | TCGA BLCA -0.32; TCGA BRCA -0.185; TCGA COAD -0.476; TCGA ESCA -0.517; TCGA KIRC -0.124; TCGA LIHC -0.16; TCGA LUAD -0.124; TCGA PAAD -0.163; TCGA STAD -0.392 |
hsa-miR-200a-5p | GFRA1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.306; TCGA CESC -0.606; TCGA COAD -0.811; TCGA ESCA -0.453; TCGA HNSC -0.392; TCGA LIHC -0.272; TCGA LUSC -0.416; TCGA OV -0.45; TCGA PAAD -0.243; TCGA PRAD -0.101; TCGA STAD -0.717; TCGA UCEC -0.522 |
hsa-miR-200a-5p | CAMK4 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.273; TCGA CESC -0.231; TCGA COAD -0.213; TCGA ESCA -0.18; TCGA KIRC -0.202; TCGA LUAD -0.131; TCGA LUSC -0.184; TCGA OV -0.176; TCGA STAD -0.167; TCGA UCEC -0.224 |
hsa-miR-200a-5p | MMP16 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.32; TCGA BRCA -0.157; TCGA CESC -0.396; TCGA COAD -0.566; TCGA ESCA -0.218; TCGA HNSC -0.574; TCGA KIRC -0.845; TCGA LUSC -0.225; TCGA OV -0.374; TCGA PAAD -0.166; TCGA PRAD -0.1; TCGA STAD -0.346; TCGA UCEC -0.286 |
hsa-miR-200a-5p | FBXO32 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.31; TCGA CESC -0.262; TCGA COAD -0.447; TCGA ESCA -0.33; TCGA HNSC -0.296; TCGA KIRC -0.12; TCGA KIRP -0.267; TCGA LIHC -0.082; TCGA THCA -0.06; TCGA STAD -0.52; TCGA UCEC -0.267 |
hsa-miR-200a-5p | PALM2-AKAP2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.4; TCGA BRCA -0.33; TCGA CESC -0.388; TCGA COAD -0.44; TCGA ESCA -0.2; TCGA HNSC -0.423; TCGA KIRC -0.158; TCGA KIRP -0.173; TCGA LUAD -0.28; TCGA LUSC -0.637; TCGA OV -0.148; TCGA PAAD -0.244; TCGA STAD -0.274; TCGA UCEC -0.325 |
hsa-miR-200a-5p | SYNPO2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.531; TCGA BRCA -0.391; TCGA CESC -0.421; TCGA COAD -1.172; TCGA ESCA -0.619; TCGA HNSC -0.636; TCGA LUAD -0.271; TCGA LUSC -0.227; TCGA OV -0.199; TCGA PAAD -0.276; TCGA STAD -0.977; TCGA UCEC -0.564 |
hsa-miR-200a-5p | FAM26E | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.413; TCGA BRCA -0.228; TCGA CESC -0.415; TCGA COAD -0.65; TCGA ESCA -0.265; TCGA HNSC -0.542; TCGA KIRC -0.126; TCGA KIRP -0.336; TCGA LUAD -0.264; TCGA LUSC -0.363; TCGA OV -0.122; TCGA PAAD -0.221; TCGA PRAD -0.083; TCGA STAD -0.163; TCGA UCEC -0.312 |
hsa-miR-200a-5p | PLCXD3 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.155; TCGA BRCA -0.588; TCGA CESC -0.261; TCGA COAD -1.047; TCGA ESCA -0.457; TCGA LUSC -0.692; TCGA PRAD -0.148; TCGA STAD -0.695; TCGA UCEC -0.584 |
hsa-miR-200a-5p | TCF4 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.245; TCGA BRCA -0.228; TCGA CESC -0.125; TCGA COAD -0.488; TCGA ESCA -0.213; TCGA HNSC -0.212; TCGA KIRC -0.295; TCGA LUAD -0.182; TCGA OV -0.167; TCGA PAAD -0.235; TCGA STAD -0.221; TCGA UCEC -0.254 |
hsa-miR-200a-5p | ITGA1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.3; TCGA BRCA -0.217; TCGA CESC -0.273; TCGA COAD -0.164; TCGA ESCA -0.128; TCGA HNSC -0.319; TCGA KIRC -0.216; TCGA KIRP -0.267; TCGA LIHC -0.08; TCGA LUAD -0.15; TCGA LUSC -0.414; TCGA OV -0.12; TCGA PRAD -0.094; TCGA STAD -0.337; TCGA UCEC -0.137 |
hsa-miR-200a-5p | ZNF788 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.236; TCGA CESC -0.315; TCGA COAD -0.33; TCGA ESCA -0.332; TCGA HNSC -0.264; TCGA LUAD -0.119; TCGA LUSC -0.251; TCGA PAAD -0.173; TCGA STAD -0.259; TCGA UCEC -0.113 |
hsa-miR-200a-5p | AKAP2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BLCA -0.552; TCGA BRCA -0.285; TCGA CESC -0.479; TCGA COAD -0.435; TCGA ESCA -0.216; TCGA HNSC -0.563; TCGA LUAD -0.334; TCGA LUSC -0.75; TCGA OV -0.177; TCGA PAAD -0.222; TCGA UCEC -0.463 |
hsa-miR-200a-5p | KCTD7 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.125; TCGA BRCA -0.059; TCGA CESC -0.108; TCGA COAD -0.244; TCGA ESCA -0.109; TCGA LUSC -0.105; TCGA OV -0.138; TCGA PAAD -0.123; TCGA STAD -0.26; TCGA UCEC -0.231 |
hsa-miR-200a-5p | HIVEP3 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; STAD; UCEC | miRNATAP | TCGA BLCA -0.23; TCGA CESC -0.285; TCGA ESCA -0.163; TCGA HNSC -0.158; TCGA KIRC -0.082; TCGA LUAD -0.124; TCGA LUSC -0.229; TCGA OV -0.134; TCGA STAD -0.063; TCGA UCEC -0.062 |
hsa-miR-200a-5p | ZEB2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.444; TCGA BRCA -0.306; TCGA CESC -0.376; TCGA COAD -0.48; TCGA ESCA -0.3; TCGA HNSC -0.471; TCGA KIRC -0.198; TCGA LUAD -0.254; TCGA LUSC -0.529; TCGA OV -0.176; TCGA PAAD -0.309; TCGA PRAD -0.066; TCGA STAD -0.26; TCGA UCEC -0.374 |
hsa-miR-200a-5p | KLF7 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; STAD; UCEC | miRNATAP | TCGA BLCA -0.167; TCGA BRCA -0.135; TCGA CESC -0.16; TCGA COAD -0.4; TCGA ESCA -0.322; TCGA HNSC -0.128; TCGA KIRC -0.148; TCGA LUSC -0.166; TCGA OV -0.105; TCGA STAD -0.225; TCGA UCEC -0.2 |
hsa-miR-200a-5p | DLC1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.18; TCGA BRCA -0.306; TCGA CESC -0.326; TCGA COAD -0.352; TCGA ESCA -0.186; TCGA HNSC -0.457; TCGA LUAD -0.167; TCGA LUSC -0.691; TCGA OV -0.147; TCGA PAAD -0.266; TCGA PRAD -0.113; TCGA STAD -0.311; TCGA UCEC -0.25 |
hsa-miR-200a-5p | SLC39A14 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.307; TCGA BRCA -0.076; TCGA CESC -0.118; TCGA HNSC -0.218; TCGA KIRC -0.422; TCGA KIRP -0.41; TCGA LIHC -0.068; TCGA PRAD -0.071; TCGA THCA -0.09; TCGA UCEC -0.087 |
hsa-miR-200a-5p | TEAD1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.16; TCGA BRCA -0.176; TCGA CESC -0.079; TCGA COAD -0.196; TCGA ESCA -0.071; TCGA HNSC -0.13; TCGA LUAD -0.086; TCGA LUSC -0.08; TCGA STAD -0.332; TCGA UCEC -0.154 |
hsa-miR-200a-5p | SLITRK4 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.387; TCGA BRCA -0.23; TCGA CESC -0.424; TCGA ESCA -0.407; TCGA HNSC -0.779; TCGA LUAD -0.288; TCGA LUSC -0.261; TCGA OV -0.283; TCGA PAAD -0.264; TCGA STAD -0.53; TCGA UCEC -0.282 |
hsa-miR-200a-5p | KLF6 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.117; TCGA BRCA -0.171; TCGA CESC -0.206; TCGA ESCA -0.09; TCGA HNSC -0.171; TCGA LUAD -0.185; TCGA LUSC -0.459; TCGA STAD -0.066; TCGA UCEC -0.166 |
hsa-miR-200a-5p | NOVA1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.359; TCGA BRCA -0.369; TCGA CESC -0.428; TCGA COAD -1.056; TCGA ESCA -0.646; TCGA HNSC -0.313; TCGA KIRC -0.167; TCGA LUSC -0.216; TCGA OV -0.344; TCGA PAAD -0.478; TCGA STAD -0.712; TCGA UCEC -0.565 |
hsa-miR-200a-5p | MAF | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.342; TCGA BRCA -0.25; TCGA CESC -0.431; TCGA COAD -0.396; TCGA ESCA -0.38; TCGA HNSC -0.292; TCGA KIRC -0.364; TCGA KIRP -0.305; TCGA LIHC -0.053; TCGA LUAD -0.142; TCGA OV -0.269; TCGA PAAD -0.214; TCGA PRAD -0.125; TCGA STAD -0.23; TCGA UCEC -0.416 |
hsa-miR-200a-5p | CCDC88A | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.282; TCGA BRCA -0.132; TCGA CESC -0.134; TCGA COAD -0.46; TCGA ESCA -0.155; TCGA HNSC -0.11; TCGA KIRC -0.296; TCGA KIRP -0.128; TCGA LUAD -0.174; TCGA LUSC -0.119; TCGA OV -0.1; TCGA PAAD -0.166; TCGA STAD -0.199; TCGA UCEC -0.23 |
hsa-miR-200a-5p | NLGN1 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; STAD; UCEC | miRNATAP | TCGA BLCA -0.298; TCGA BRCA -0.516; TCGA COAD -1.164; TCGA ESCA -0.527; TCGA HNSC -0.168; TCGA KIRC -0.149; TCGA KIRP -0.264; TCGA STAD -0.818; TCGA UCEC -0.478 |
hsa-miR-200a-5p | KIAA0355 | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BRCA -0.119; TCGA CESC -0.104; TCGA COAD -0.114; TCGA ESCA -0.076; TCGA HNSC -0.093; TCGA KIRC -0.056; TCGA LUAD -0.076; TCGA LUSC -0.188; TCGA PAAD -0.085; TCGA STAD -0.099; TCGA UCEC -0.119 |
hsa-miR-200a-5p | ZFAND5 | 10 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.113; TCGA ESCA -0.111; TCGA HNSC -0.069; TCGA KIRP -0.105; TCGA LIHC -0.113; TCGA LUAD -0.055; TCGA LUSC -0.118; TCGA PAAD -0.053; TCGA STAD -0.155; TCGA UCEC -0.053 |
hsa-miR-200a-5p | GLDN | 9 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD | mirMAP | TCGA BRCA -0.502; TCGA COAD -0.225; TCGA ESCA -0.181; TCGA HNSC -0.237; TCGA KIRP -0.243; TCGA LUAD -0.352; TCGA LUSC -0.37; TCGA PRAD -0.211; TCGA STAD -0.348 |
hsa-miR-200a-5p | ZNF677 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.26; TCGA CESC -0.377; TCGA COAD -0.661; TCGA ESCA -0.414; TCGA HNSC -0.251; TCGA LUSC -0.434; TCGA OV -0.095; TCGA PAAD -0.227; TCGA STAD -0.447; TCGA UCEC -0.31 |
hsa-miR-200a-5p | AR | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; STAD | miRNATAP | TCGA BRCA -0.129; TCGA CESC -0.287; TCGA COAD -0.631; TCGA ESCA -0.347; TCGA HNSC -0.398; TCGA LIHC -0.335; TCGA LUSC -0.426; TCGA PAAD -0.216; TCGA STAD -0.655 |
Enriched cancer pathways of putative targets