microRNA information: hsa-miR-200c-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-200c-3p | miRbase |
Accession: | MIMAT0000617 | miRbase |
Precursor name: | hsa-mir-200c | miRbase |
Precursor accession: | MI0000650 | miRbase |
Symbol: | MIR200C | HGNC |
RefSeq ID: | NR_029779 | GenBank |
Sequence: | UAAUACUGCCGGGUAAUGAUGGA |
Reported expression in cancers: hsa-miR-200c-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-200c-3p | bladder cancer | upregulation | "MicroRNA expression signatures of bladder cancer r ......" | 21464941 | RNA-Seq |
hsa-miR-200c-3p | bladder cancer | deregulation | "In other recruited 17 patients with BUC who were d ......" | 22886973 | Reverse transcription PCR; Microarray |
hsa-miR-200c-3p | bladder cancer | downregulation | "MicroRNA-200c miR-200c is one of the short noncodi ......" | 25367080 | Reverse transcription PCR; qPCR |
hsa-miR-200c-3p | bladder cancer | downregulation | "Moreover miR-155 was downregulated whereas miR-200 ......" | 26927195 | |
hsa-miR-200c-3p | bladder cancer | upregulation | "MiR-200c exhibits a disordered expression in many ......" | 27574450 | Reverse transcription PCR |
hsa-miR-200c-3p | breast cancer | downregulation | "Down regulation of microRNA 200c is associated wit ......" | 22101791 | qPCR |
hsa-miR-200c-3p | breast cancer | downregulation | "The expression profiles of miR-9 miR-21 miR-30a mi ......" | 25013435 | Reverse transcription PCR |
hsa-miR-200c-3p | breast cancer | downregulation | "Circulating miR 200c and miR 141 and outcomes in p ......" | 25885099 | Reverse transcription PCR |
hsa-miR-200c-3p | breast cancer | downregulation | "Expression levels of miR-200a miR-200b miR-200c mi ......" | 26201425 | qPCR |
hsa-miR-200c-3p | breast cancer | downregulation | "The microRNA miR-200c is involved in the tumorigen ......" | 26392416 | qPCR; Microarray; in situ hybridization |
hsa-miR-200c-3p | colorectal cancer | upregulation | "The increased expression of miR-200c miR-221 and m ......" | 21873159 | |
hsa-miR-200c-3p | colorectal cancer | upregulation | "Furthermore PZH treatment upregulated the expressi ......" | 25422078 | |
hsa-miR-200c-3p | endometrial cancer | upregulation | "We evaluated the differential expressions of miRNA ......" | 21035172 | Microarray |
hsa-miR-200c-3p | endometrial cancer | upregulation | "Increased expression of miR-200c was recently repo ......" | 22015043 | qPCR |
hsa-miR-200c-3p | esophageal cancer | upregulation | "Circulating miR 200c levels significantly predict ......" | 23838916 | qPCR |
hsa-miR-200c-3p | gastric cancer | downregulation | "miR 200b and miR 200c as prognostic factors and me ......" | 23995857 | qPCR; Microarray |
hsa-miR-200c-3p | gastric cancer | downregulation | "Here we report that the miR-200 family members miR ......" | 25502084 | |
hsa-miR-200c-3p | gastric cancer | downregulation | "Serum miR 200c expression level as a prognostic bi ......" | 26662382 | qPCR |
hsa-miR-200c-3p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
hsa-miR-200c-3p | kidney renal cell cancer | downregulation | "Genome wide microRNA expression profiling in renal ......" | 18925646 | Microarray; qPCR |
hsa-miR-200c-3p | kidney renal cell cancer | downregulation | "We analyzed 70 matched pairs of clear cell renal c ......" | 21784468 | qPCR; Microarray |
hsa-miR-200c-3p | kidney renal cell cancer | downregulation | "microRNA 200c modulates the epithelial to mesenchy ......" | 23754305 | Microarray |
hsa-miR-200c-3p | kidney renal cell cancer | downregulation | "Integrated analyses allow understanding the interp ......" | 26002553 | |
hsa-miR-200c-3p | kidney renal cell cancer | downregulation | "In this study miRNA expression profiles were deter ......" | 26248649 | Microarray |
hsa-miR-200c-3p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
hsa-miR-200c-3p | liver cancer | downregulation | "The expressions of miR-200c and miR-141 were downr ......" | 24135722 | |
hsa-miR-200c-3p | lung cancer | upregulation | "High expression of serum miR 21 and tumor miR 200c ......" | 21516486 | Microarray; Reverse transcription PCR; qPCR |
hsa-miR-200c-3p | lung squamous cell cancer | downregulation | "Loss of miR 200c expression induces an aggressive ......" | 20696752 | |
hsa-miR-200c-3p | lung squamous cell cancer | downregulation | "The ectopic miR-200c increased the radiosensitivit ......" | 24205206 | |
hsa-miR-200c-3p | melanoma | downregulation | "Differential expression of microRNAs during melano ......" | 22223089 | Microarray |
hsa-miR-200c-3p | melanoma | downregulation | "miR 200c inhibits melanoma progression and drug re ......" | 22982443 | |
hsa-miR-200c-3p | ovarian cancer | downregulation | "Association between miR 200c and the survival of p ......" | 21345725 | Reverse transcription PCR; qPCR; Microarray |
hsa-miR-200c-3p | ovarian cancer | downregulation | "Restoration of miR 200c to ovarian cancer reduces ......" | 23074172 | |
hsa-miR-200c-3p | pancreatic cancer | upregulation | "MicroRNA hsa miR 200c is an independent prognostic ......" | 20579395 | |
hsa-miR-200c-3p | pancreatic cancer | upregulation | "miR 139 and miR 200c regulate pancreatic cancer en ......" | 25955258 | Microarray; qPCR |
hsa-miR-200c-3p | pancreatic cancer | upregulation | "MicroRNA 200c as a Prognostic Biomarker for Pancre ......" | 26493507 | |
hsa-miR-200c-3p | prostate cancer | downregulation | "Consequently miR-200c was downregulated in ERG-pos ......" | 24186205 | |
hsa-miR-200c-3p | prostate cancer | downregulation | "Among them 10 paired HGPIN and PCa were prepared t ......" | 27017949 | qPCR; Microarray |
Reported cancer pathway affected by hsa-miR-200c-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-200c-3p | breast cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "miR 200c at the nexus of epithelial mesenchymal tr ......" | 21682933 | |
hsa-miR-200c-3p | breast cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c represses migration and invasion of ......" | 22144583 | |
hsa-miR-200c-3p | breast cancer | Epithelial mesenchymal transition pathway; Apoptosis pathway | "miR 200c enhances radiosensitivity of human breast ......" | 22991189 | |
hsa-miR-200c-3p | breast cancer | Apoptosis pathway | "In addition our analysis showed inverse expression ......" | 24039897 | Luciferase |
hsa-miR-200c-3p | breast cancer | Epithelial mesenchymal transition pathway | "miR 200c inhibits metastasis of breast cancer cell ......" | 24710933 | Luciferase; Western blot; Transwell assay; Wound Healing Assay |
hsa-miR-200c-3p | breast cancer | Apoptosis pathway | "microRNA 200c downregulates XIAP expression to sup ......" | 24821285 | Luciferase; Western blot |
hsa-miR-200c-3p | breast cancer | Epithelial mesenchymal transition pathway | "Overexpression of microRNA 200c predicts poor outc ......" | 25329395 | |
hsa-miR-200c-3p | breast cancer | cell cycle pathway | "We demonstrate that resveratrol regulates apoptoti ......" | 26890143 | |
hsa-miR-200c-3p | colon cancer | Apoptosis pathway | "The roles of miR 200c in colon cancer and associat ......" | 24682933 | Western blot |
hsa-miR-200c-3p | colon cancer | Apoptosis pathway | "By performing MTT wound-healing and Transwell migr ......" | 27460529 | Flow cytometry; Cell migration assay |
hsa-miR-200c-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Induction of epithelial mesenchymal transition and ......" | 25757925 | |
hsa-miR-200c-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "The analysis of microRNAs miR 200C and miR 145 exp ......" | 26335822 | |
hsa-miR-200c-3p | esophageal cancer | PI3K/Akt signaling pathway | "Overexpression of miR 200c induces chemoresistance ......" | 21248297 | Western blot |
hsa-miR-200c-3p | gastric cancer | Apoptosis pathway | "Enhancement of radiotherapy efficacy by miR 200c l ......" | 24872697 | |
hsa-miR-200c-3p | gastric cancer | Epithelial mesenchymal transition pathway | "Ubiquitin ligase Cbl b represses IGF I induced epi ......" | 24885194 | |
hsa-miR-200c-3p | head and neck cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c attenuates tumour growth and metasta ......" | 21294122 | Luciferase |
hsa-miR-200c-3p | head and neck cancer | Epithelial mesenchymal transition pathway | "Among several miRNAs in which the expression was a ......" | 21899661 | |
hsa-miR-200c-3p | head and neck cancer | Epithelial mesenchymal transition pathway | "In addition miR-21 let-7 miR-107 miR-138 and miR-2 ......" | 23340306 | |
hsa-miR-200c-3p | kidney renal cell cancer | Apoptosis pathway | "MiR 200c sensitizes clear cell renal cell carcinom ......" | 25150313 | |
hsa-miR-200c-3p | kidney renal cell cancer | cell cycle pathway | "miR 200c Targets CDK2 and Suppresses Tumorigenesis ......" | 26248649 | Luciferase |
hsa-miR-200c-3p | lung cancer | cell cycle pathway; Apoptosis pathway | "Over expression of miR 200c suppresses invasion an ......" | 27432063 | Western blot |
hsa-miR-200c-3p | lung cancer | Apoptosis pathway | "Electroneutral composite polymersomes self assembl ......" | 27541441 | |
hsa-miR-200c-3p | lung cancer | Epithelial mesenchymal transition pathway | "miR 200c regulates crizotinib resistant ALK positi ......" | 27666124 | Luciferase |
hsa-miR-200c-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 | Luciferase; Western blot; Cell migration assay |
hsa-miR-200c-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Growing evidence indicates that miR-200c is involv ......" | 24997798 | Luciferase; Western blot |
hsa-miR-200c-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c inhibits the metastasis of non small ......" | 26935975 | Luciferase; Western blot |
hsa-miR-200c-3p | ovarian cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c overexpression inhibits tumorigenici ......" | 23842108 | |
hsa-miR-200c-3p | ovarian cancer | Epithelial mesenchymal transition pathway | "Both resistant variants display a strong epithelia ......" | 26025631 | |
hsa-miR-200c-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Cell cycle distribution and apoptosis were examine ......" | 19112422 | Flow cytometry |
hsa-miR-200c-3p | pancreatic cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c overexpression plays an inhibitory r ......" | 26081037 | Colony formation |
hsa-miR-200c-3p | prostate cancer | cell cycle pathway | "Furthermore miR-200c served as an important mediat ......" | 25017995 | Western blot; Luciferase |
hsa-miR-200c-3p | prostate cancer | Epithelial mesenchymal transition pathway | "Effects of miR 200c on the migration and invasion ......" | 25363395 | Cell migration assay; Western blot |
hsa-miR-200c-3p | prostate cancer | Apoptosis pathway | "Regulation of miR 200c and miR 141 by Methylation ......" | 27198154 | |
hsa-miR-200c-3p | sarcoma | cell cycle pathway | "The regulatory function of miR 200c on inflammator ......" | 25305131 | Western blot |
Reported cancer prognosis affected by hsa-miR-200c-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-200c-3p | B cell lymphoma | poor survival | "High expression of microRNA 200c predicts poor cli ......" | 23232598 | |
hsa-miR-200c-3p | bladder cancer | staging; progression | "Moreover we report that miR-200c expression is sig ......" | 20473948 | |
hsa-miR-200c-3p | bladder cancer | progression; tumorigenesis | "miR 200c inhibits invasion migration and prolifera ......" | 25367080 | Western blot; Luciferase |
hsa-miR-200c-3p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
hsa-miR-200c-3p | bladder cancer | cell migration | "MiR 200c promotes bladder cancer cell migration an ......" | 27574450 | Transwell assay; Luciferase; Western blot |
hsa-miR-200c-3p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
hsa-miR-200c-3p | breast cancer | progression | "Recent evidence demonstrates that up-regulation of ......" | 19839049 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "miR 200c at the nexus of epithelial mesenchymal tr ......" | 21682933 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "Down regulation of microRNA 200c is associated wit ......" | 22101791 | Flow cytometry |
hsa-miR-200c-3p | breast cancer | cell migration; drug resistance; metastasis | "MicroRNA 200c represses migration and invasion of ......" | 22144583 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "miR 200c targets a NF κB up regulated TrkB/NTF3 a ......" | 23185507 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "miR 200c sensitizes breast cancer cells to doxorub ......" | 23209748 | |
hsa-miR-200c-3p | breast cancer | cell migration | "Analysis of the miRNA expression identified 11 miR ......" | 23497265 | |
hsa-miR-200c-3p | breast cancer | metastasis | "It has been reported that microRNA-200c miRNA-200c ......" | 23546450 | |
hsa-miR-200c-3p | breast cancer | metastasis | "Overexpressions of microRNA 9 and microRNA 200c in ......" | 23617747 | |
hsa-miR-200c-3p | breast cancer | cell migration; drug resistance | "Previously we reported that the expression of miR- ......" | 23626803 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "In addition our analysis showed inverse expression ......" | 24039897 | Luciferase |
hsa-miR-200c-3p | breast cancer | metastasis; drug resistance | "MiR 200c suppresses TGF β signaling and counterac ......" | 24615544 | |
hsa-miR-200c-3p | breast cancer | metastasis; progression | "miR 200c inhibits metastasis of breast cancer cell ......" | 24710933 | Luciferase; Western blot; Transwell assay; Wound Healing Assay |
hsa-miR-200c-3p | breast cancer | metastasis | "Induction of the mesenchymal to epithelial transit ......" | 24729530 | |
hsa-miR-200c-3p | breast cancer | metastasis | "The expression profiles of miR-9 miR-21 miR-30a mi ......" | 25013435 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "MiR 200c inhibits autophagy and enhances radiosens ......" | 25044403 | |
hsa-miR-200c-3p | breast cancer | cell migration; poor survival; metastasis; recurrence; staging | "Overexpression of microRNA 200c predicts poor outc ......" | 25329395 | |
hsa-miR-200c-3p | breast cancer | metastasis | "BRCA mutations cause reduction in miR 200c express ......" | 25445393 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
hsa-miR-200c-3p | breast cancer | motility | "Expression of miR 200c in claudin low breast cance ......" | 25746005 | |
hsa-miR-200c-3p | breast cancer | staging; progression; poor survival | "Circulating miR 200c and miR 141 and outcomes in p ......" | 25885099 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
hsa-miR-200c-3p | breast cancer | drug resistance | "Furthermore several studies have documented that s ......" | 26310899 | |
hsa-miR-200c-3p | breast cancer | progression; tumorigenesis; poor survival | "miR 200c inhibits breast cancer proliferation by t ......" | 26392416 | Luciferase |
hsa-miR-200c-3p | breast cancer | tumorigenesis | "Essential role of miR 200c in regulating self rene ......" | 26400441 | Western blot; Luciferase |
hsa-miR-200c-3p | breast cancer | metastasis | "These included miR-141 miR-144 miR-193b miR-200a m ......" | 26785733 | |
hsa-miR-200c-3p | breast cancer | metastasis | "We evaluated the expression levels of miR-21 miR-1 ......" | 27197674 | |
hsa-miR-200c-3p | breast cancer | cell migration | "Another study suggested that ERM expression was re ......" | 27276064 | Transwell assay; Wound Healing Assay |
hsa-miR-200c-3p | breast cancer | poor survival | "In this multicenter study a 10-miRNA classifier in ......" | 27566954 | |
hsa-miR-200c-3p | breast cancer | metastasis | "Epigenetic Silencing of miR 200c in Breast Cancer ......" | 27717206 | |
hsa-miR-200c-3p | colon cancer | tumorigenesis | "To further investigate the in vivo biological sign ......" | 18172508 | |
hsa-miR-200c-3p | colon cancer | metastasis | "miR 200c inhibits invasion and migration in human ......" | 22407310 | |
hsa-miR-200c-3p | colon cancer | worse prognosis; metastasis; poor survival; staging | "The roles of miR 200c in colon cancer and associat ......" | 24682933 | Western blot |
hsa-miR-200c-3p | colorectal cancer | poor survival | "Ten miRNAs hsa-let-7b hsa-let-7g hsa-miR-15b hsa-m ......" | 18079988 | |
hsa-miR-200c-3p | colorectal cancer | metastasis | "Applying real-time PCR we detected the expression ......" | 21827717 | |
hsa-miR-200c-3p | colorectal cancer | progression | "The quantitative analysis by stem loop real time P ......" | 22562822 | |
hsa-miR-200c-3p | colorectal cancer | metastasis | "MicroRNA 200c modulates epithelial to mesenchymal ......" | 22735571 | |
hsa-miR-200c-3p | colorectal cancer | metastasis; staging; worse prognosis; recurrence | "Serum miR 200c is a novel prognostic and metastasi ......" | 23982750 | |
hsa-miR-200c-3p | colorectal cancer | staging; poor survival | "Tumor tissue samples were obtained from 127 surgic ......" | 24510588 | |
hsa-miR-200c-3p | colorectal cancer | metastasis | "Regulation of colorectal carcinoma stemness growth ......" | 24658157 | Luciferase |
hsa-miR-200c-3p | colorectal cancer | drug resistance | "Induction of epithelial mesenchymal transition and ......" | 25757925 | |
hsa-miR-200c-3p | colorectal cancer | worse prognosis | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | |
hsa-miR-200c-3p | colorectal cancer | metastasis | "Investigating intra tumor heterogeneity and expres ......" | 27565378 | |
hsa-miR-200c-3p | esophageal cancer | drug resistance; poor survival | "Overexpression of miR 200c induces chemoresistance ......" | 21248297 | Western blot |
hsa-miR-200c-3p | esophageal cancer | worse prognosis; drug resistance; progression; poor survival | "Circulating miR 200c levels significantly predict ......" | 23838916 | |
hsa-miR-200c-3p | gastric cancer | staging; progression; poor survival; metastasis | "Circulating miR 200c as a diagnostic and prognosti ......" | 22954417 | |
hsa-miR-200c-3p | gastric cancer | drug resistance | "MicroRNA 200c regulates the sensitivity of chemoth ......" | 23821457 | Luciferase; Western blot |
hsa-miR-200c-3p | gastric cancer | progression; worse prognosis; staging; metastasis; poor survival | "miR 200b and miR 200c as prognostic factors and me ......" | 23995857 | Luciferase; Cell proliferation assay; Cell migration assay; Cell Proliferation Assay |
hsa-miR-200c-3p | gastric cancer | poor survival | "RNA and protein expression were analyzed by RT-PCR ......" | 24352645 | |
hsa-miR-200c-3p | gastric cancer | drug resistance | "Enhancement of radiotherapy efficacy by miR 200c l ......" | 24872697 | |
hsa-miR-200c-3p | gastric cancer | staging; poor survival | "Here we report that the miR-200 family members miR ......" | 25502084 | Wound Healing Assay |
hsa-miR-200c-3p | gastric cancer | staging; metastasis | "In the first step of this study preliminary experi ......" | 26233325 | |
hsa-miR-200c-3p | gastric cancer | poor survival; staging; worse prognosis | "Serum miR 200c expression level as a prognostic bi ......" | 26662382 | |
hsa-miR-200c-3p | gastric cancer | progression; tumorigenesis | "Epigenetically deregulated miR 200c is involved in ......" | 27498672 | Luciferase |
hsa-miR-200c-3p | head and neck cancer | metastasis; malignant trasformation; poor survival | "MicroRNA 200c attenuates tumour growth and metasta ......" | 21294122 | Luciferase |
hsa-miR-200c-3p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
hsa-miR-200c-3p | kidney papillary renal cell cancer | staging; poor survival; progression | "In the training stage the expression levels of 12 ......" | 25906110 | |
hsa-miR-200c-3p | kidney renal cell cancer | metastasis; malignant trasformation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
hsa-miR-200c-3p | kidney renal cell cancer | metastasis | "microRNA 200c modulates the epithelial to mesenchy ......" | 23754305 | |
hsa-miR-200c-3p | kidney renal cell cancer | drug resistance | "MiR 200c sensitizes clear cell renal cell carcinom ......" | 25150313 | |
hsa-miR-200c-3p | kidney renal cell cancer | drug resistance | "Loss of miR 200c up regulates CYP1B1 and confers d ......" | 25860934 | |
hsa-miR-200c-3p | kidney renal cell cancer | poor survival | "Using vote-counting strategy and robust rank aggre ......" | 25974855 | |
hsa-miR-200c-3p | kidney renal cell cancer | metastasis; poor survival | "Integrated analyses allow understanding the interp ......" | 26002553 | |
hsa-miR-200c-3p | kidney renal cell cancer | tumorigenesis; progression | "miR 200c Targets CDK2 and Suppresses Tumorigenesis ......" | 26248649 | Luciferase |
hsa-miR-200c-3p | kidney renal cell cancer | metastasis | "In addition miR-200c can partly reverse the MALAT1 ......" | 26461224 | |
hsa-miR-200c-3p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
hsa-miR-200c-3p | liver cancer | poor survival | "The expressions of miR-200c and miR-141 were downr ......" | 24135722 | |
hsa-miR-200c-3p | lung cancer | worse prognosis; poor survival | "High expression of serum miR 21 and tumor miR 200c ......" | 21516486 | |
hsa-miR-200c-3p | lung cancer | drug resistance | "Therapeutic delivery of miR 200c enhances radiosen ......" | 24791940 | |
hsa-miR-200c-3p | lung cancer | drug resistance; cell migration | "Over expression of miR 200c suppresses invasion an ......" | 27432063 | Western blot |
hsa-miR-200c-3p | lung cancer | drug resistance | "Electroneutral composite polymersomes self assembl ......" | 27541441 | |
hsa-miR-200c-3p | lung squamous cell cancer | metastasis; differentiation | "Loss of miR 200c expression induces an aggressive ......" | 20696752 | |
hsa-miR-200c-3p | lung squamous cell cancer | poor survival | "Using a linear combination of the miR CT values wi ......" | 24007627 | |
hsa-miR-200c-3p | lung squamous cell cancer | poor survival | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 | Luciferase; Western blot; Cell migration assay |
hsa-miR-200c-3p | lung squamous cell cancer | progression; tumorigenesis; metastasis; staging | "Growing evidence indicates that miR-200c is involv ......" | 24997798 | Luciferase; Western blot |
hsa-miR-200c-3p | lung squamous cell cancer | staging; poor survival; cell migration | "miR 141 and miR 200c as markers of overall surviva ......" | 25003366 | |
hsa-miR-200c-3p | lung squamous cell cancer | worse prognosis; poor survival; tumor size | "Expression of microRNA miR 126 and miR 200c is ass ......" | 25124149 | |
hsa-miR-200c-3p | lung squamous cell cancer | progression; poor survival; staging | "miR 200c overexpression is associated with better ......" | 25277203 | |
hsa-miR-200c-3p | lung squamous cell cancer | metastasis; malignant trasformation; progression | "MicroRNA 200c inhibits the metastasis of non small ......" | 26935975 | Luciferase; Western blot |
hsa-miR-200c-3p | lung squamous cell cancer | poor survival | "The 3-miRNA panel expression miR-192 miR-200c and ......" | 27153322 | |
hsa-miR-200c-3p | lung squamous cell cancer | drug resistance | "Associating drug response with micro-RNA expressio ......" | 27247353 | |
hsa-miR-200c-3p | melanoma | progression; staging | "Differential expression of microRNAs during melano ......" | 22223089 | Colony formation |
hsa-miR-200c-3p | melanoma | metastasis | "Here we demonstrate a significant correlation betw ......" | 22956368 | |
hsa-miR-200c-3p | melanoma | progression; drug resistance; metastasis | "miR 200c inhibits melanoma progression and drug re ......" | 22982443 | |
hsa-miR-200c-3p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
hsa-miR-200c-3p | ovarian cancer | drug resistance | "In a well-characterized series of 72 ovarian carci ......" | 21051560 | |
hsa-miR-200c-3p | ovarian cancer | staging; poor survival | "Association between miR 200c and the survival of p ......" | 21345725 | |
hsa-miR-200c-3p | ovarian cancer | staging; worse prognosis; drug resistance; progression | "Restoration of miR 200c to ovarian cancer reduces ......" | 23074172 | |
hsa-miR-200c-3p | ovarian cancer | worse prognosis; drug resistance | "MiR 200c and HuR in ovarian cancer; This study ass ......" | 23394580 | |
hsa-miR-200c-3p | ovarian cancer | metastasis | "MicroRNA 200c overexpression inhibits tumorigenici ......" | 23842108 | |
hsa-miR-200c-3p | ovarian cancer | progression; poor survival | "Global miRNA expression analysis of serous and cle ......" | 24512620 | |
hsa-miR-200c-3p | ovarian cancer | progression | "The aberrant expression of the miR-200 family miR- ......" | 24952258 | |
hsa-miR-200c-3p | ovarian cancer | poor survival; progression | "Expression levels of members in the miR-200 family ......" | 24966949 | |
hsa-miR-200c-3p | ovarian cancer | metastasis; staging; cell migration | "miR 200c modulates ovarian cancer cell metastasis ......" | 25052237 | Luciferase; Western blot |
hsa-miR-200c-3p | ovarian cancer | staging; poor survival; worse prognosis | "MicroRNA 200c and microRNA 141 as potential diagno ......" | 25636451 | |
hsa-miR-200c-3p | ovarian cancer | drug resistance | "Both resistant variants display a strong epithelia ......" | 26025631 | |
hsa-miR-200c-3p | ovarian cancer | progression; metastasis; worse prognosis; poor survival | "Expression of serum miR 200a miR 200b and miR 200c ......" | 26063644 | |
hsa-miR-200c-3p | ovarian cancer | poor survival; metastasis | "MicroRNA 200c and microRNA 31 regulate proliferati ......" | 26260454 | Colony formation |
hsa-miR-200c-3p | ovarian cancer | progression; poor survival | "Subgroup analysis revealed that there was a signif ......" | 26910180 | |
hsa-miR-200c-3p | ovarian cancer | malignant trasformation; staging; metastasis; poor survival; progression | "Diagnostic and prognostic relevance of circulating ......" | 26943577 | |
hsa-miR-200c-3p | ovarian cancer | metastasis | "miR 200c Regulation of Metastases in Ovarian Cance ......" | 27601996 | |
hsa-miR-200c-3p | ovarian cancer | malignant trasformation | "Circulating Cell Free miR 373 miR 200a miR 200b an ......" | 27753009 | |
hsa-miR-200c-3p | pancreatic cancer | poor survival; worse prognosis | "MicroRNA hsa miR 200c is an independent prognostic ......" | 20579395 | |
hsa-miR-200c-3p | pancreatic cancer | cell migration | "miR 139 and miR 200c regulate pancreatic cancer en ......" | 25955258 | |
hsa-miR-200c-3p | pancreatic cancer | tumorigenesis; drug resistance | "MicroRNA 200c overexpression plays an inhibitory r ......" | 26081037 | Colony formation |
hsa-miR-200c-3p | pancreatic cancer | drug resistance; poor survival | "MicroRNA 200c overexpression inhibits chemoresista ......" | 26261532 | Colony formation |
hsa-miR-200c-3p | pancreatic cancer | poor survival; worse prognosis | "MicroRNA 200c as a Prognostic Biomarker for Pancre ......" | 26493507 | |
hsa-miR-200c-3p | prostate cancer | drug resistance | "To distinguish the presence of cancer stem cell li ......" | 22768203 | Flow cytometry |
hsa-miR-200c-3p | prostate cancer | drug resistance | "Epithelial to mesenchymal transition leads to doce ......" | 23041061 | |
hsa-miR-200c-3p | prostate cancer | tumorigenesis; cell migration; motility | "TMPRSS2 ERG gene fusions induce prostate tumorigen ......" | 24186205 | |
hsa-miR-200c-3p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
hsa-miR-200c-3p | prostate cancer | progression | "Furthermore miR-200c served as an important mediat ......" | 25017995 | Western blot; Luciferase |
hsa-miR-200c-3p | sarcoma | progression | "The regulatory function of miR 200c on inflammator ......" | 25305131 | Western blot |
hsa-miR-200c-3p | sarcoma | metastasis; progression | "miR 200c and phospho AKT as prognostic factors and ......" | 27155790 |
Reported gene related to hsa-miR-200c-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-200c-3p | bladder cancer | CDH1 | "miR-200c over-expression resulted in conspicuous d ......" | 25367080 |
hsa-miR-200c-3p | breast cancer | CDH1 | "Overexpression of miR-200c enhanced the expression ......" | 24754877 |
hsa-miR-200c-3p | breast cancer | CDH1 | "This chromatin modifications were paralleled by an ......" | 27717206 |
hsa-miR-200c-3p | breast cancer | CDH1 | "MicroRNA-200c miR-200c has been shown to suppress ......" | 22144583 |
hsa-miR-200c-3p | breast cancer | CDH1 | "We investigated the expressions of miR-9 and miR-2 ......" | 23617747 |
hsa-miR-200c-3p | colorectal cancer | CDH1 | "Overexpression of miR-200c in CRC cell lines cause ......" | 22735571 |
hsa-miR-200c-3p | gastric cancer | CDH1 | "We also found that miR-200c and miR-141 directly t ......" | 25502084 |
hsa-miR-200c-3p | head and neck cancer | CDH1 | "Accordingly the enforced expression of miR-200c an ......" | 24424572 |
hsa-miR-200c-3p | kidney renal cell cancer | CDH1 | "Overexpression of miR-200c in SN12-PM6 and 786-0 c ......" | 23754305 |
hsa-miR-200c-3p | lung squamous cell cancer | CDH1 | "Reintroduction of miR-200c into highly invasive/ag ......" | 20696752 |
hsa-miR-200c-3p | melanoma | CDH1 | "In addition miR-200c overexpression significantly ......" | 22982443 |
hsa-miR-200c-3p | ovarian cancer | CDH1 | "However the stable overexpression of the miR-200c ......" | 23842108 |
hsa-miR-200c-3p | ovarian cancer | CDH1 | "Overexpression of miR-200c regulated E-cadherin an ......" | 25052237 |
hsa-miR-200c-3p | pancreatic cancer | CDH1 | "Especially the expression of miR-200c has been sho ......" | 20579395 |
hsa-miR-200c-3p | sarcoma | CDH1 | "Transient transfection of RMS cells with a miR-200 ......" | 23000453 |
hsa-miR-200c-3p | breast cancer | ZEB1 | "miR-200c has been shown to regulate the epithelial ......" | 24710933 |
hsa-miR-200c-3p | breast cancer | ZEB1 | "MiR 200c suppresses TGF β signaling and counterac ......" | 24615544 |
hsa-miR-200c-3p | breast cancer | ZEB1 | "Of this family miR-200c has garnered particular at ......" | 21682933 |
hsa-miR-200c-3p | breast cancer | ZEB1 | "Epigenetic Silencing of miR 200c in Breast Cancer ......" | 27717206 |
hsa-miR-200c-3p | breast cancer | ZEB1 | "Concomitant with the increase in miR-200b and miR- ......" | 23626803 |
hsa-miR-200c-3p | colon cancer | ZEB1 | "miR 200c inhibits invasion and migration in human ......" | 22407310 |
hsa-miR-200c-3p | head and neck cancer | ZEB1 | "Accordingly the enforced expression of miR-200c an ......" | 24424572 |
hsa-miR-200c-3p | kidney renal cell cancer | ZEB1 | "Overexpression of miR-200c in SN12-PM6 and 786-0 c ......" | 23754305 |
hsa-miR-200c-3p | lung cancer | ZEB1 | "miR 200c regulates crizotinib resistant ALK positi ......" | 27666124 |
hsa-miR-200c-3p | prostate cancer | ZEB1 | "Furthermore miR-200c was found to be important in ......" | 24186205 |
hsa-miR-200c-3p | breast cancer | ZEB2 | "miR-200c has been shown to regulate the epithelial ......" | 24710933 |
hsa-miR-200c-3p | breast cancer | ZEB2 | "Of this family miR-200c has garnered particular at ......" | 21682933 |
hsa-miR-200c-3p | gastric cancer | ZEB2 | "Two gastric cancer cell lines were treated with IG ......" | 24885194 |
hsa-miR-200c-3p | kidney renal cell cancer | ZEB2 | "We established by quantitative RT-PCR that in CCCs ......" | 18925646 |
hsa-miR-200c-3p | lung squamous cell cancer | ZEB2 | "MicroRNA 200c inhibits the metastasis of non small ......" | 26935975 |
hsa-miR-200c-3p | ovarian cancer | ZEB2 | "miR 200c modulates ovarian cancer cell metastasis ......" | 25052237 |
hsa-miR-200c-3p | breast cancer | BMI1 | "miR 200c sensitizes breast cancer cells to doxorub ......" | 23209748 |
hsa-miR-200c-3p | breast cancer | BMI1 | "Expression of BMI1 a known regulator of stem cell ......" | 19665978 |
hsa-miR-200c-3p | breast cancer | BMI1 | "MiR-200c and miR-203 overexpression in breast canc ......" | 24039897 |
hsa-miR-200c-3p | head and neck cancer | BMI1 | "In this study the expression of miR200c in the reg ......" | 21294122 |
hsa-miR-200c-3p | breast cancer | VIM | "Overexpression of miR-200c enhanced the expression ......" | 24754877 |
hsa-miR-200c-3p | colorectal cancer | VIM | "Overexpression of miR-200c in CRC cell lines cause ......" | 22735571 |
hsa-miR-200c-3p | ovarian cancer | VIM | "However the stable overexpression of the miR-200c ......" | 23842108 |
hsa-miR-200c-3p | ovarian cancer | VIM | "Overexpression of miR-200c regulated E-cadherin an ......" | 25052237 |
hsa-miR-200c-3p | breast cancer | KRAS | "miR 200c inhibits breast cancer proliferation by t ......" | 26392416 |
hsa-miR-200c-3p | colorectal cancer | KRAS | "Oncogenic KRAS regulates miR 200c and miR 221/222 ......" | 21873159 |
hsa-miR-200c-3p | colorectal cancer | KRAS | "We previously found that oncogenic KRAS induces in ......" | 22641662 |
hsa-miR-200c-3p | colon cancer | TP53 | "In conclusion miR-200c functions as an oncogene in ......" | 24682933 |
hsa-miR-200c-3p | colorectal cancer | TP53 | "Sequencing analysis revealed that hsa-miR-181b p = ......" | 18079988 |
hsa-miR-200c-3p | lung cancer | TP53 | "RT-PCR and Western blot assays showed that the exp ......" | 27432063 |
hsa-miR-200c-3p | gastric cancer | DNMT3A | "Epigenetically deregulated miR 200c is involved in ......" | 27498672 |
hsa-miR-200c-3p | prostate cancer | DNMT3A | "The biological significance of miR-200c and miR-14 ......" | 27198154 |
hsa-miR-200c-3p | bladder cancer | E2F3 | "miR 200c inhibits invasion migration and prolifera ......" | 25367080 |
hsa-miR-200c-3p | prostate cancer | E2F3 | "Furthermore miR-200c served as an important mediat ......" | 25017995 |
hsa-miR-200c-3p | glioblastoma | EGFR | "Correlation between EGFR amplification and the exp ......" | 25058589 |
hsa-miR-200c-3p | lung squamous cell cancer | EGFR | "miR 200c overexpression is associated with better ......" | 25277203 |
hsa-miR-200c-3p | lung cancer | EZH2 | "Furthermore miR-200c overexpression significantly ......" | 27432063 |
hsa-miR-200c-3p | prostate cancer | EZH2 | "Furthermore miR-200c served as an important mediat ......" | 25017995 |
hsa-miR-200c-3p | ovarian cancer | MUC16 | "The increased levels of miR-200b and miR-200c were ......" | 26943577 |
hsa-miR-200c-3p | pancreatic cancer | MUC16 | "MicroRNA 200c modulates the expression of MUC4 and ......" | 24204560 |
hsa-miR-200c-3p | breast cancer | NTRK2 | "miR 200c sensitizes breast cancer cells to doxorub ......" | 23209748 |
hsa-miR-200c-3p | ovarian cancer | NTRK2 | "miR-200c also targets TrkB a mediator of resistanc ......" | 23074172 |
hsa-miR-200c-3p | breast cancer | PDCD10 | "Furthermore miR-200c negatively regulated programm ......" | 26400441 |
hsa-miR-200c-3p | breast cancer | PDCD10 | "Through dual-luciferase method it was verified tha ......" | 25566594 |
hsa-miR-200c-3p | breast cancer | PRDX2 | "Demethylating agent 5-aza-2'-deoxycytidine 5-aza-d ......" | 23626803 |
hsa-miR-200c-3p | lung cancer | PRDX2 | "We found that miR-200c overexpression increased ce ......" | 24791940 |
hsa-miR-200c-3p | colon cancer | PTEN | "In conclusion miR-200c functions as an oncogene in ......" | 24682933 |
hsa-miR-200c-3p | pancreatic cancer | PTEN | "Forced over-expression or silencing of miR-200c fo ......" | 22637745 |
hsa-miR-200c-3p | bladder cancer | RECK | "MiR 200c promotes bladder cancer cell migration an ......" | 27574450 |
hsa-miR-200c-3p | lung cancer | RECK | "Finally we demonstrated that expression of miR-200 ......" | 24647918 |
hsa-miR-200c-3p | ovarian cancer | TUBB3 | "miR-200c increases sensitivity to taxanes in vitro ......" | 23074172 |
hsa-miR-200c-3p | ovarian cancer | TUBB3 | "This study assessed the role of miR-200c as regula ......" | 23394580 |
hsa-miR-200c-3p | breast cancer | VEGFA | "Analysis revealed a negative correlation between m ......" | 25445393 |
hsa-miR-200c-3p | lung squamous cell cancer | VEGFA | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 |
hsa-miR-200c-3p | lung cancer | ALK | "miR 200c regulates crizotinib resistant ALK positi ......" | 27666124 |
hsa-miR-200c-3p | endometrial cancer | BRD7 | "The interactions between MicroRNA 200c and BRD7 in ......" | 22015043 |
hsa-miR-200c-3p | colon cancer | CCL16 | "Loss of exosomal transferred miR-200c in resistant ......" | 25832648 |
hsa-miR-200c-3p | gastric cancer | CD44 | "In addition to radioenhancement miR-200c nanoparti ......" | 24872697 |
hsa-miR-200c-3p | lung squamous cell cancer | CDH2 | "Reintroduction of miR-200c into highly invasive/ag ......" | 20696752 |
hsa-miR-200c-3p | kidney renal cell cancer | CDK2 | "miR 200c Targets CDK2 and Suppresses Tumorigenesis ......" | 26248649 |
hsa-miR-200c-3p | breast cancer | CFL2 | "We characterized one of the target genes of miR-20 ......" | 23497265 |
hsa-miR-200c-3p | kidney renal cell cancer | CYP1B1 | "Loss of miR 200c up regulates CYP1B1 and confers d ......" | 25860934 |
hsa-miR-200c-3p | lung squamous cell cancer | DCR | "In 66 NSCLC patients with wild-type EGFR high leve ......" | 25277203 |
hsa-miR-200c-3p | B cell lymphoma | DDIT3 | "This study presents microRNA-200c expression data ......" | 23232598 |
hsa-miR-200c-3p | breast cancer | DICER1 | "In contrast miR-200c which promotes an epithelial ......" | 21761362 |
hsa-miR-200c-3p | prostate cancer | DNMT1 | "In PC3 cells miR-200c and miR-141 expression is su ......" | 27198154 |
hsa-miR-200c-3p | prostate cancer | DUSP3 | "All patients with VHR PCa in the study had elevate ......" | 27601638 |
hsa-miR-200c-3p | gastric cancer | EFNA1 | "G A variant in miR 200c binding site of EFNA1 alte ......" | 23065816 |
hsa-miR-200c-3p | ovarian cancer | ELAVL1 | "MiR 200c and HuR in ovarian cancer; Crosslinking-c ......" | 23394580 |
hsa-miR-200c-3p | prostate cancer | EPCAM | "Oppositely re-induction of the epithelial phenotyp ......" | 24992580 |
hsa-miR-200c-3p | prostate cancer | ERG | "TMPRSS2 ERG gene fusions induce prostate tumorigen ......" | 24186205 |
hsa-miR-200c-3p | breast cancer | ESR1 | "Further miR-200b and miR-200c overexpression sensi ......" | 23626803 |
hsa-miR-200c-3p | breast cancer | ETV5 | "Another study suggested that ERM expression was re ......" | 27276064 |
hsa-miR-200c-3p | breast cancer | FHOD1 | "MicroRNA 200c represses migration and invasion of ......" | 22144583 |
hsa-miR-200c-3p | gastric cancer | GDF15 | "Circulating levels of GDF15 MMP7 and miR 200c as a ......" | 24947260 |
hsa-miR-200c-3p | breast cancer | GLA | "Here we found that GLA attenuated the migratory an ......" | 24754877 |
hsa-miR-200c-3p | ovarian cancer | HEY | "Stable overexpression of miR-200c was obtained in ......" | 23394580 |
hsa-miR-200c-3p | head and neck cancer | HGF | "Among several miRNAs in which the expression was a ......" | 21899661 |
hsa-miR-200c-3p | breast cancer | HMGB1 | "miR 200c inhibits metastasis of breast cancer cell ......" | 24710933 |
hsa-miR-200c-3p | kidney renal cell cancer | HMOX1 | "MiR 200c sensitizes clear cell renal cell carcinom ......" | 25150313 |
hsa-miR-200c-3p | gastric cancer | IGF1 | "Two gastric cancer cell lines were treated with IG ......" | 24885194 |
hsa-miR-200c-3p | sarcoma | IKBKB | "Additionally gain-of-function of miR-200c through ......" | 25305131 |
hsa-miR-200c-3p | sarcoma | IL8 | "Additionally gain-of-function of miR-200c through ......" | 25305131 |
hsa-miR-200c-3p | lung squamous cell cancer | KDR | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 |
hsa-miR-200c-3p | endometrial cancer | MALAT1 | "In the present study we first showed that miR-200c ......" | 27693631 |
hsa-miR-200c-3p | breast cancer | MAP1LC3A | "In 35 human breast cancer tissue samples we detect ......" | 25044403 |
hsa-miR-200c-3p | lung cancer | MAPK8 | "Finally we demonstrated that expression of miR-200 ......" | 24647918 |
hsa-miR-200c-3p | melanoma | MARCKS | "Functional target identification studies suggest t ......" | 20957176 |
hsa-miR-200c-3p | breast cancer | MKI67 | "The miR-200c levels were numerically higher in sta ......" | 25885099 |
hsa-miR-200c-3p | pancreatic cancer | MMP14 | "Forced over-expression or silencing of miR-200c fo ......" | 22637745 |
hsa-miR-200c-3p | gastric cancer | MMP7 | "Circulating levels of GDF15 MMP7 and miR 200c as a ......" | 24947260 |
hsa-miR-200c-3p | pancreatic cancer | MUC4 | "MicroRNA 200c modulates the expression of MUC4 and ......" | 24204560 |
hsa-miR-200c-3p | endometrial cancer | MYC | "MiR-200c regulated the translocation of β-catenin ......" | 22015043 |
hsa-miR-200c-3p | breast cancer | NFASC | "miR 200c targets a NF κB up regulated TrkB/NTF3 a ......" | 23185507 |
hsa-miR-200c-3p | lung squamous cell cancer | NOL3 | "The downstream regulating mechanism of miR-200c wa ......" | 24205206 |
hsa-miR-200c-3p | gastric cancer | OS9 | "There was a correlation p = 0.016 with the num ......" | 22954417 |
hsa-miR-200c-3p | gastric cancer | PAEP | "Enhancement of radiotherapy efficacy by miR 200c l ......" | 24872697 |
hsa-miR-200c-3p | breast cancer | PDCD4 | "Through dual-luciferase method it was verified tha ......" | 25566594 |
hsa-miR-200c-3p | breast cancer | PPM1F | "MicroRNA 200c represses migration and invasion of ......" | 22144583 |
hsa-miR-200c-3p | esophageal cancer | PPP2R1B | "Western blotting showed that knockdown of miR-200c ......" | 21248297 |
hsa-miR-200c-3p | gastric cancer | RND3 | "MicroRNA 200c regulates the sensitivity of chemoth ......" | 23821457 |
hsa-miR-200c-3p | prostate cancer | SEC23A | "A computational analysis predicted the 3'-UTR of t ......" | 21593139 |
hsa-miR-200c-3p | lung cancer | SESN1 | "We found that miR-200c overexpression increased ce ......" | 24791940 |
hsa-miR-200c-3p | colorectal cancer | SOX2 | "Regulation of colorectal carcinoma stemness growth ......" | 24658157 |
hsa-miR-200c-3p | breast cancer | TAM | "Further miR-200b and miR-200c overexpression sensi ......" | 23626803 |
hsa-miR-200c-3p | breast cancer | TBK1 | "Additionally we found that miR-200c directly targe ......" | 22991189 |
hsa-miR-200c-3p | prostate cancer | TMPRSS2 | "TMPRSS2 ERG gene fusions induce prostate tumorigen ......" | 24186205 |
hsa-miR-200c-3p | sarcoma | TP63 | "The regulatory function of miR 200c on inflammator ......" | 25305131 |
hsa-miR-200c-3p | breast cancer | UBQLN1 | "MiR 200c inhibits autophagy and enhances radiosens ......" | 25044403 |
hsa-miR-200c-3p | lung squamous cell cancer | USP25 | "The functions of miR-200c and USP25 in migration/i ......" | 24997798 |
hsa-miR-200c-3p | breast cancer | XIAP | "microRNA 200c downregulates XIAP expression to sup ......" | 24821285 |
hsa-miR-200c-3p | breast cancer | ZNF217 | "MiR 200c suppresses TGF β signaling and counterac ......" | 24615544 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-200c-3p | BCL2 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase; mirMAP | TCGA BLCA -0.19; TCGA BRCA -0.087; TCGA CESC -0.203; TCGA ESCA -0.227; TCGA KIRC -0.096; TCGA KIRP -0.131; TCGA LUAD -0.127; TCGA PAAD -0.401; TCGA PRAD -0.396; TCGA STAD -0.321; TCGA UCEC -0.232 |
hsa-miR-200c-3p | EDNRA | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.43; TCGA BRCA -0.238; TCGA CESC -0.48; TCGA COAD -0.372; TCGA ESCA -0.197; TCGA HNSC -0.364; TCGA KIRC -0.15; TCGA LUAD -0.375; TCGA LUSC -0.671; TCGA OV -0.311; TCGA PAAD -0.359; TCGA PRAD -0.676; TCGA THCA -0.363; TCGA STAD -0.355; TCGA UCEC -0.47 |
hsa-miR-200c-3p | FBLN5 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.4; TCGA BRCA -0.432; TCGA CESC -0.416; TCGA COAD -0.739; TCGA ESCA -0.378; TCGA HNSC -0.399; TCGA LUAD -0.236; TCGA LUSC -0.886; TCGA OV -0.124; TCGA PAAD -0.403; TCGA PRAD -0.4; TCGA THCA -0.458; TCGA STAD -0.398; TCGA UCEC -0.332 |
hsa-miR-200c-3p | FHOD1 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; OV; PAAD | miRNAWalker2 validate | TCGA BLCA -0.107; TCGA BRCA -0.114; TCGA CESC -0.074; TCGA HNSC -0.263; TCGA KIRC -0.172; TCGA LUAD -0.137; TCGA LUSC -0.431; TCGA OV -0.103; TCGA PAAD -0.153 |
hsa-miR-200c-3p | FLNA | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.573; TCGA BRCA -0.2; TCGA CESC -0.288; TCGA COAD -0.784; TCGA ESCA -0.504; TCGA HNSC -0.124; TCGA KIRC -0.076; TCGA LUAD -0.368; TCGA LUSC -0.244; TCGA OV -0.213; TCGA PAAD -0.358; TCGA PRAD -0.811; TCGA SARC -0.175; TCGA THCA -0.245; TCGA STAD -0.745; TCGA UCEC -0.376 |
hsa-miR-200c-3p | FN1 | 16 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.662; TCGA CESC -0.527; TCGA COAD -0.91; TCGA ESCA -0.526; TCGA HNSC -0.526; TCGA KIRC -0.255; TCGA LIHC -0.057; TCGA LUAD -0.472; TCGA LUSC -0.703; TCGA OV -0.298; TCGA PAAD -0.279; TCGA PRAD -0.46; TCGA SARC -0.147; TCGA THCA -0.974; TCGA STAD -0.368; TCGA UCEC -0.268 |
hsa-miR-200c-3p | KLF9 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.4; TCGA BRCA -0.37; TCGA CESC -0.245; TCGA COAD -0.382; TCGA ESCA -0.336; TCGA HNSC -0.256; TCGA LGG -0.092; TCGA LIHC -0.243; TCGA LUAD -0.141; TCGA LUSC -0.615; TCGA OV -0.141; TCGA PAAD -0.192; TCGA PRAD -0.17; TCGA SARC -0.081; TCGA STAD -0.46; TCGA UCEC -0.303 |
hsa-miR-200c-3p | KLHL20 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.078; TCGA BRCA -0.16; TCGA CESC -0.079; TCGA COAD -0.067; TCGA ESCA -0.059; TCGA HNSC -0.067; TCGA LGG -0.122; TCGA PAAD -0.07; TCGA PRAD -0.182; TCGA SARC -0.098; TCGA STAD -0.09; TCGA UCEC -0.138 |
hsa-miR-200c-3p | LPAR1 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.185; TCGA BRCA -0.351; TCGA COAD -0.414; TCGA ESCA -0.33; TCGA HNSC -0.212; TCGA LUSC -0.128; TCGA OV -0.209; TCGA PAAD -0.415; TCGA PRAD -0.542; TCGA SARC -0.112; TCGA THCA -0.213; TCGA STAD -0.389; TCGA UCEC -0.173 |
hsa-miR-200c-3p | MSN | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BLCA -0.394; TCGA BRCA -0.193; TCGA CESC -0.321; TCGA COAD -0.487; TCGA ESCA -0.284; TCGA HNSC -0.166; TCGA KIRC -0.058; TCGA LUAD -0.212; TCGA LUSC -0.315; TCGA OV -0.13; TCGA PAAD -0.319; TCGA PRAD -0.505; TCGA SARC -0.11; TCGA STAD -0.272; TCGA UCEC -0.159 |
hsa-miR-200c-3p | NTRK2 | 9 cancers: BLCA; BRCA; CESC; COAD; LGG; OV; PRAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.558; TCGA BRCA -0.54; TCGA CESC -0.454; TCGA COAD -0.62; TCGA LGG -0.189; TCGA OV -0.393; TCGA PRAD -0.724; TCGA STAD -0.5; TCGA UCEC -0.286 |
hsa-miR-200c-3p | PPM1F | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.133; TCGA BRCA -0.204; TCGA CESC -0.217; TCGA COAD -0.2; TCGA ESCA -0.1; TCGA HNSC -0.125; TCGA KIRC -0.148; TCGA LUAD -0.172; TCGA LUSC -0.14; TCGA OV -0.231; TCGA PAAD -0.216; TCGA PRAD -0.143; TCGA THCA -0.093; TCGA STAD -0.174; TCGA UCEC -0.243 |
hsa-miR-200c-3p | PTPRD | 16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.632; TCGA BRCA -0.341; TCGA CESC -0.635; TCGA ESCA -0.305; TCGA HNSC -0.474; TCGA KIRP -0.343; TCGA LGG -0.231; TCGA LUAD -0.278; TCGA LUSC -0.373; TCGA OV -0.555; TCGA PAAD -0.15; TCGA PRAD -0.258; TCGA SARC -0.306; TCGA THCA -0.563; TCGA STAD -0.311; TCGA UCEC -0.45 |
hsa-miR-200c-3p | RASSF2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.164; TCGA BRCA -0.159; TCGA CESC -0.329; TCGA COAD -0.589; TCGA ESCA -0.375; TCGA HNSC -0.27; TCGA KIRC -0.331; TCGA LGG -0.367; TCGA LUAD -0.196; TCGA LUSC -0.854; TCGA PAAD -0.52; TCGA PRAD -0.342; TCGA SARC -0.146; TCGA THCA -0.6; TCGA STAD -0.305; TCGA UCEC -0.258 |
hsa-miR-200c-3p | RIN2 | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.105; TCGA BRCA -0.108; TCGA CESC -0.121; TCGA HNSC -0.079; TCGA LGG -0.097; TCGA LUAD -0.122; TCGA LUSC -0.148; TCGA PRAD -0.194; TCGA UCEC -0.093 |
hsa-miR-200c-3p | SEPT7 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.095; TCGA BRCA -0.095; TCGA CESC -0.101; TCGA COAD -0.081; TCGA ESCA -0.107; TCGA HNSC -0.058; TCGA KIRC -0.052; TCGA LUAD -0.143; TCGA OV -0.079; TCGA PAAD -0.119; TCGA PRAD -0.182; TCGA THCA -0.098; TCGA STAD -0.13; TCGA UCEC -0.136 |
hsa-miR-200c-3p | SHC1 | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; OV; PAAD; PRAD; THCA; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.051; TCGA CESC -0.112; TCGA COAD -0.073; TCGA HNSC -0.09; TCGA KIRC -0.153; TCGA OV -0.115; TCGA PAAD -0.083; TCGA PRAD -0.061; TCGA THCA -0.065; TCGA UCEC -0.056 |
hsa-miR-200c-3p | TCF7L1 | 9 cancers: BLCA; BRCA; COAD; ESCA; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.322; TCGA BRCA -0.23; TCGA COAD -0.457; TCGA ESCA -0.304; TCGA OV -0.282; TCGA PAAD -0.18; TCGA PRAD -0.589; TCGA STAD -0.435; TCGA UCEC -0.087 |
hsa-miR-200c-3p | ZEB1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.487; TCGA BRCA -0.419; TCGA CESC -0.48; TCGA COAD -0.698; TCGA ESCA -0.458; TCGA HNSC -0.446; TCGA KIRC -0.097; TCGA LGG -0.223; TCGA LIHC -0.057; TCGA LUAD -0.333; TCGA LUSC -0.572; TCGA OV -0.356; TCGA PAAD -0.31; TCGA PRAD -0.56; TCGA SARC -0.103; TCGA THCA -0.271; TCGA STAD -0.55; TCGA UCEC -0.547 |
hsa-miR-200c-3p | ZEB2 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.505; TCGA BRCA -0.473; TCGA CESC -0.433; TCGA COAD -0.601; TCGA ESCA -0.396; TCGA HNSC -0.459; TCGA KIRC -0.108; TCGA LGG -0.126; TCGA LUAD -0.307; TCGA LUSC -0.856; TCGA OV -0.146; TCGA PAAD -0.41; TCGA PRAD -0.596; TCGA SARC -0.136; TCGA THCA -0.438; TCGA STAD -0.313; TCGA UCEC -0.395 |
hsa-miR-200c-3p | ZFPM2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.611; TCGA BRCA -0.488; TCGA CESC -0.459; TCGA COAD -0.888; TCGA ESCA -0.536; TCGA HNSC -0.56; TCGA KIRC -0.067; TCGA LGG -0.417; TCGA LUAD -0.45; TCGA LUSC -0.843; TCGA PAAD -0.5; TCGA PRAD -0.744; TCGA SARC -0.227; TCGA THCA -0.387; TCGA STAD -0.617; TCGA UCEC -0.734 |
hsa-miR-200c-3p | TIMP2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRTarBase | TCGA BLCA -0.477; TCGA BRCA -0.349; TCGA CESC -0.408; TCGA COAD -0.732; TCGA ESCA -0.383; TCGA HNSC -0.407; TCGA KIRP -0.074; TCGA LUAD -0.41; TCGA LUSC -0.683; TCGA OV -0.217; TCGA PAAD -0.236; TCGA PRAD -0.512; TCGA THCA -0.355; TCGA STAD -0.352; TCGA UCEC -0.408 |
hsa-miR-200c-3p | NCAM1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC | miRTarBase | TCGA BLCA -0.867; TCGA BRCA -0.537; TCGA CESC -0.54; TCGA COAD -0.661; TCGA ESCA -0.628; TCGA HNSC -0.738; TCGA LGG -0.241; TCGA LUAD -0.221; TCGA LUSC -0.298; TCGA PRAD -1.025; TCGA STAD -0.769; TCGA UCEC -0.621 |
hsa-miR-200c-3p | LIX1L | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.343; TCGA BRCA -0.32; TCGA CESC -0.247; TCGA COAD -0.456; TCGA ESCA -0.328; TCGA HNSC -0.257; TCGA KIRC -0.143; TCGA KIRP -0.052; TCGA LGG -0.148; TCGA LUAD -0.235; TCGA LUSC -0.355; TCGA OV -0.254; TCGA PAAD -0.216; TCGA PRAD -0.19; TCGA THCA -0.194; TCGA STAD -0.41; TCGA UCEC -0.299 |
hsa-miR-200c-3p | HLF | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.599; TCGA BRCA -0.549; TCGA CESC -0.341; TCGA COAD -0.501; TCGA ESCA -0.267; TCGA KIRP -0.124; TCGA LGG -0.26; TCGA LIHC -0.343; TCGA PRAD -0.585; TCGA STAD -0.728; TCGA UCEC -0.598 |
hsa-miR-200c-3p | AFF3 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; OV; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.594; TCGA CESC -0.552; TCGA COAD -0.749; TCGA ESCA -0.536; TCGA HNSC -0.255; TCGA KIRC -0.242; TCGA LGG -0.28; TCGA LUSC -1.018; TCGA OV -0.296; TCGA PAAD -0.529; TCGA THCA -0.832; TCGA STAD -0.668; TCGA UCEC -0.269 |
hsa-miR-200c-3p | WIPF1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.424; TCGA BRCA -0.215; TCGA CESC -0.27; TCGA COAD -0.498; TCGA ESCA -0.355; TCGA HNSC -0.269; TCGA KIRC -0.228; TCGA KIRP -0.078; TCGA LUAD -0.298; TCGA LUSC -0.549; TCGA OV -0.106; TCGA PAAD -0.402; TCGA PRAD -0.464; TCGA THCA -0.489; TCGA STAD -0.255; TCGA UCEC -0.224 |
hsa-miR-200c-3p | CNN3 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.202; TCGA BRCA -0.159; TCGA CESC -0.165; TCGA COAD -0.116; TCGA ESCA -0.197; TCGA HNSC -0.226; TCGA LIHC -0.112; TCGA LUAD -0.239; TCGA LUSC -0.309; TCGA OV -0.084; TCGA PAAD -0.259; TCGA PRAD -0.281; TCGA THCA -0.199; TCGA STAD -0.225; TCGA UCEC -0.156 |
hsa-miR-200c-3p | CEP68 | 10 cancers: BLCA; BRCA; CESC; ESCA; LGG; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.06; TCGA BRCA -0.186; TCGA CESC -0.126; TCGA ESCA -0.084; TCGA LGG -0.158; TCGA PAAD -0.087; TCGA PRAD -0.287; TCGA SARC -0.065; TCGA STAD -0.206; TCGA UCEC -0.131 |
hsa-miR-200c-3p | SYDE1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.365; TCGA BRCA -0.26; TCGA CESC -0.338; TCGA COAD -0.581; TCGA ESCA -0.345; TCGA HNSC -0.244; TCGA KIRC -0.126; TCGA LUAD -0.329; TCGA LUSC -0.395; TCGA OV -0.264; TCGA PAAD -0.258; TCGA PRAD -0.529; TCGA SARC -0.053; TCGA THCA -0.134; TCGA STAD -0.386; TCGA UCEC -0.405 |
hsa-miR-200c-3p | ABL2 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; THCA | MirTarget | TCGA BLCA -0.152; TCGA CESC -0.07; TCGA COAD -0.132; TCGA ESCA -0.126; TCGA HNSC -0.126; TCGA KIRC -0.121; TCGA LGG -0.148; TCGA LUAD -0.136; TCGA LUSC -0.141; TCGA OV -0.079; TCGA PAAD -0.132; TCGA THCA -0.13 |
hsa-miR-200c-3p | ITPR2 | 10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.148; TCGA CESC -0.134; TCGA ESCA -0.115; TCGA HNSC -0.218; TCGA LIHC -0.2; TCGA LUAD -0.142; TCGA LUSC -0.384; TCGA PAAD -0.134; TCGA STAD -0.099; TCGA UCEC -0.065 |
hsa-miR-200c-3p | CBL | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget; mirMAP | TCGA BLCA -0.106; TCGA BRCA -0.136; TCGA CESC -0.103; TCGA COAD -0.066; TCGA ESCA -0.078; TCGA KIRC -0.052; TCGA LUAD -0.173; TCGA LUSC -0.064; TCGA PAAD -0.141; TCGA PRAD -0.179; TCGA STAD -0.098; TCGA UCEC -0.135 |
hsa-miR-200c-3p | SULF1 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.499; TCGA CESC -0.36; TCGA COAD -0.912; TCGA ESCA -0.337; TCGA HNSC -0.31; TCGA KIRC -0.199; TCGA LUAD -0.384; TCGA LUSC -0.17; TCGA PAAD -0.339; TCGA PRAD -0.51; TCGA THCA -0.533; TCGA STAD -0.156; TCGA UCEC -0.099 |
hsa-miR-200c-3p | REEP1 | 9 cancers: BLCA; COAD; ESCA; LGG; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.608; TCGA COAD -0.506; TCGA ESCA -0.385; TCGA LGG -0.239; TCGA LUSC -0.517; TCGA PRAD -0.57; TCGA SARC -0.255; TCGA STAD -0.636; TCGA UCEC -0.264 |
hsa-miR-200c-3p | NOVA1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.42; TCGA BRCA -0.435; TCGA CESC -0.688; TCGA COAD -1.1; TCGA ESCA -0.664; TCGA HNSC -0.308; TCGA KIRP -0.183; TCGA LGG -0.221; TCGA LUAD -0.261; TCGA OV -0.367; TCGA PAAD -0.393; TCGA PRAD -0.415; TCGA STAD -0.76; TCGA UCEC -0.504 |
hsa-miR-200c-3p | MCFD2 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.128; TCGA BRCA -0.103; TCGA CESC -0.091; TCGA ESCA -0.056; TCGA HNSC -0.152; TCGA LIHC -0.084; TCGA LUAD -0.084; TCGA LUSC -0.092; TCGA OV -0.109; TCGA PRAD -0.071; TCGA STAD -0.084; TCGA UCEC -0.131 |
hsa-miR-200c-3p | BNC2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.7; TCGA BRCA -0.459; TCGA CESC -0.653; TCGA COAD -1.031; TCGA ESCA -0.559; TCGA HNSC -0.516; TCGA KIRP -0.105; TCGA LUAD -0.526; TCGA LUSC -0.722; TCGA OV -0.258; TCGA PAAD -0.546; TCGA PRAD -0.717; TCGA SARC -0.101; TCGA THCA -0.794; TCGA STAD -0.622; TCGA UCEC -0.698 |
hsa-miR-200c-3p | CLIC4 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.456; TCGA BRCA -0.155; TCGA CESC -0.196; TCGA COAD -0.397; TCGA ESCA -0.294; TCGA HNSC -0.143; TCGA KIRC -0.069; TCGA KIRP -0.18; TCGA LUAD -0.255; TCGA LUSC -0.296; TCGA OV -0.062; TCGA PAAD -0.269; TCGA PRAD -0.46; TCGA SARC -0.144; TCGA THCA -0.131; TCGA STAD -0.405; TCGA UCEC -0.266 |
hsa-miR-200c-3p | ETS1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.129; TCGA BRCA -0.27; TCGA CESC -0.21; TCGA COAD -0.33; TCGA ESCA -0.246; TCGA HNSC -0.296; TCGA KIRC -0.176; TCGA LGG -0.199; TCGA LUAD -0.277; TCGA LUSC -0.785; TCGA OV -0.146; TCGA PAAD -0.295; TCGA PRAD -0.325; TCGA THCA -0.255; TCGA STAD -0.068; TCGA UCEC -0.21 |
hsa-miR-200c-3p | DZIP1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.337; TCGA BRCA -0.252; TCGA CESC -0.311; TCGA COAD -0.781; TCGA ESCA -0.417; TCGA KIRP -0.079; TCGA LGG -0.165; TCGA LUAD -0.205; TCGA OV -0.287; TCGA PAAD -0.21; TCGA PRAD -0.561; TCGA THCA -0.799; TCGA STAD -0.501; TCGA UCEC -0.369 |
hsa-miR-200c-3p | VAT1L | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.303; TCGA BRCA -0.399; TCGA CESC -0.486; TCGA COAD -0.282; TCGA ESCA -0.226; TCGA HNSC -0.387; TCGA LGG -0.269; TCGA LUAD -0.544; TCGA LUSC -0.561; TCGA OV -0.309; TCGA PRAD -0.811; TCGA THCA -0.998; TCGA STAD -0.337; TCGA UCEC -0.404 |
hsa-miR-200c-3p | AMOTL2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.222; TCGA BRCA -0.286; TCGA CESC -0.134; TCGA COAD -0.181; TCGA ESCA -0.127; TCGA HNSC -0.179; TCGA LGG -0.251; TCGA LUAD -0.1; TCGA LUSC -0.298; TCGA OV -0.101; TCGA PAAD -0.188; TCGA PRAD -0.408; TCGA STAD -0.089; TCGA UCEC -0.171 |
hsa-miR-200c-3p | NDN | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.22; TCGA BRCA -0.537; TCGA CESC -0.459; TCGA COAD -0.746; TCGA ESCA -0.412; TCGA HNSC -0.358; TCGA LGG -0.135; TCGA LUAD -0.173; TCGA LUSC -0.494; TCGA PAAD -0.271; TCGA PRAD -0.331; TCGA THCA -0.157; TCGA STAD -0.55; TCGA UCEC -0.455 |
hsa-miR-200c-3p | DUSP1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.316; TCGA BRCA -0.461; TCGA CESC -0.193; TCGA COAD -0.312; TCGA ESCA -0.284; TCGA HNSC -0.172; TCGA KIRC -0.159; TCGA LIHC -0.104; TCGA LUAD -0.136; TCGA LUSC -0.768; TCGA OV -0.173; TCGA PAAD -0.326; TCGA PRAD -0.366; TCGA THCA -0.204; TCGA STAD -0.364; TCGA UCEC -0.362 |
hsa-miR-200c-3p | RAB11FIP2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.168; TCGA CESC -0.173; TCGA COAD -0.108; TCGA ESCA -0.079; TCGA HNSC -0.142; TCGA LGG -0.153; TCGA LIHC -0.057; TCGA LUAD -0.079; TCGA LUSC -0.296; TCGA PAAD -0.089; TCGA PRAD -0.229; TCGA SARC -0.051; TCGA STAD -0.15; TCGA UCEC -0.212 |
hsa-miR-200c-3p | FIGNL2 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; OV; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.295; TCGA COAD -0.409; TCGA HNSC -0.134; TCGA KIRP -0.259; TCGA LGG -0.139; TCGA OV -0.174; TCGA PAAD -0.142; TCGA THCA -0.229; TCGA UCEC -0.25 |
hsa-miR-200c-3p | GEM | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.596; TCGA BRCA -0.335; TCGA CESC -0.331; TCGA COAD -0.629; TCGA ESCA -0.361; TCGA HNSC -0.31; TCGA LUSC -0.63; TCGA OV -0.308; TCGA PAAD -0.352; TCGA PRAD -0.603; TCGA SARC -0.202; TCGA THCA -0.605; TCGA STAD -0.456; TCGA UCEC -0.419 |
hsa-miR-200c-3p | VASH1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.24; TCGA BRCA -0.145; TCGA CESC -0.253; TCGA COAD -0.445; TCGA ESCA -0.195; TCGA HNSC -0.258; TCGA KIRC -0.303; TCGA LUAD -0.19; TCGA LUSC -0.544; TCGA OV -0.184; TCGA PAAD -0.246; TCGA PRAD -0.112; TCGA THCA -0.228; TCGA STAD -0.056; TCGA UCEC -0.185 |
hsa-miR-200c-3p | RFTN2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.168; TCGA BRCA -0.45; TCGA CESC -0.273; TCGA COAD -0.406; TCGA ESCA -0.153; TCGA HNSC -0.165; TCGA LGG -0.301; TCGA LUAD -0.119; TCGA LUSC -0.447; TCGA OV -0.152; TCGA PAAD -0.214; TCGA PRAD -0.348; TCGA THCA -0.189; TCGA STAD -0.218; TCGA UCEC -0.339 |
hsa-miR-200c-3p | NPC1 | 9 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.124; TCGA COAD -0.102; TCGA KIRC -0.085; TCGA KIRP -0.081; TCGA LGG -0.055; TCGA LUAD -0.126; TCGA PRAD -0.116; TCGA SARC -0.075; TCGA THCA -0.171 |
hsa-miR-200c-3p | SLC35B4 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; OV; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.116; TCGA BRCA -0.175; TCGA CESC -0.131; TCGA COAD -0.106; TCGA ESCA -0.073; TCGA HNSC -0.086; TCGA LIHC -0.124; TCGA LUAD -0.142; TCGA OV -0.161; TCGA PAAD -0.134; TCGA THCA -0.057; TCGA STAD -0.102; TCGA UCEC -0.134 |
hsa-miR-200c-3p | SERINC1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.122; TCGA BRCA -0.155; TCGA CESC -0.103; TCGA COAD -0.137; TCGA ESCA -0.114; TCGA HNSC -0.146; TCGA LGG -0.09; TCGA LIHC -0.055; TCGA LUAD -0.089; TCGA LUSC -0.266; TCGA PRAD -0.124; TCGA SARC -0.08; TCGA STAD -0.166; TCGA UCEC -0.229 |
hsa-miR-200c-3p | CYTH3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.171; TCGA BRCA -0.231; TCGA CESC -0.142; TCGA COAD -0.238; TCGA ESCA -0.154; TCGA HNSC -0.174; TCGA LUAD -0.253; TCGA LUSC -0.233; TCGA OV -0.098; TCGA PAAD -0.24; TCGA STAD -0.153; TCGA UCEC -0.145 |
hsa-miR-200c-3p | FSTL1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.363; TCGA BRCA -0.454; TCGA CESC -0.237; TCGA COAD -0.56; TCGA ESCA -0.399; TCGA HNSC -0.377; TCGA KIRC -0.216; TCGA LUAD -0.355; TCGA LUSC -0.321; TCGA OV -0.276; TCGA PAAD -0.355; TCGA PRAD -0.147; TCGA THCA -0.306; TCGA STAD -0.349; TCGA UCEC -0.235 |
hsa-miR-200c-3p | OSTM1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.195; TCGA BRCA -0.209; TCGA CESC -0.144; TCGA COAD -0.175; TCGA ESCA -0.191; TCGA HNSC -0.195; TCGA KIRC -0.072; TCGA LUAD -0.22; TCGA LUSC -0.261; TCGA OV -0.114; TCGA PAAD -0.222; TCGA PRAD -0.152; TCGA SARC -0.138; TCGA THCA -0.143; TCGA STAD -0.221; TCGA UCEC -0.187 |
hsa-miR-200c-3p | RIMKLB | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.173; TCGA BRCA -0.078; TCGA COAD -0.677; TCGA ESCA -0.22; TCGA KIRP -0.073; TCGA LGG -0.084; TCGA PRAD -0.21; TCGA STAD -0.379; TCGA UCEC -0.071 |
hsa-miR-200c-3p | CALU | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.231; TCGA CESC -0.109; TCGA COAD -0.16; TCGA ESCA -0.164; TCGA HNSC -0.182; TCGA KIRC -0.092; TCGA LUAD -0.155; TCGA OV -0.059; TCGA PAAD -0.15; TCGA PRAD -0.125; TCGA SARC -0.111; TCGA STAD -0.096; TCGA UCEC -0.081 |
hsa-miR-200c-3p | AP1S2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.377; TCGA BRCA -0.196; TCGA CESC -0.329; TCGA COAD -0.407; TCGA ESCA -0.415; TCGA HNSC -0.344; TCGA KIRC -0.124; TCGA LUAD -0.337; TCGA LUSC -0.507; TCGA OV -0.171; TCGA PAAD -0.356; TCGA PRAD -0.324; TCGA SARC -0.181; TCGA THCA -0.295; TCGA STAD -0.447; TCGA UCEC -0.212 |
hsa-miR-200c-3p | KLHDC1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.116; TCGA BRCA -0.248; TCGA CESC -0.183; TCGA COAD -0.248; TCGA ESCA -0.243; TCGA HNSC -0.241; TCGA LGG -0.191; TCGA LIHC -0.108; TCGA LUSC -0.456; TCGA OV -0.096; TCGA PRAD -0.142; TCGA STAD -0.339; TCGA UCEC -0.32 |
hsa-miR-200c-3p | MTMR6 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.08; TCGA BRCA -0.063; TCGA CESC -0.081; TCGA ESCA -0.06; TCGA HNSC -0.097; TCGA LGG -0.069; TCGA LUSC -0.29; TCGA PRAD -0.076; TCGA STAD -0.058; TCGA UCEC -0.128 |
hsa-miR-200c-3p | TBX18 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; THCA; STAD | MirTarget | TCGA BLCA -0.476; TCGA BRCA -0.455; TCGA CESC -0.412; TCGA COAD -0.746; TCGA ESCA -0.518; TCGA HNSC -0.22; TCGA LUAD -0.33; TCGA THCA -0.738; TCGA STAD -0.469 |
hsa-miR-200c-3p | ZCCHC24 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.47; TCGA BRCA -0.468; TCGA CESC -0.45; TCGA COAD -0.654; TCGA ESCA -0.521; TCGA HNSC -0.465; TCGA LGG -0.26; TCGA LIHC -0.143; TCGA LUAD -0.224; TCGA LUSC -0.702; TCGA OV -0.382; TCGA PAAD -0.374; TCGA PRAD -0.338; TCGA SARC -0.091; TCGA THCA -0.284; TCGA STAD -0.57; TCGA UCEC -0.502 |
hsa-miR-200c-3p | NFIA | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LIHC; PAAD; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.2; TCGA BRCA -0.19; TCGA CESC -0.124; TCGA ESCA -0.147; TCGA KIRC -0.114; TCGA KIRP -0.144; TCGA LIHC -0.155; TCGA PAAD -0.141; TCGA PRAD -0.124; TCGA STAD -0.312 |
hsa-miR-200c-3p | LPIN1 | 9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.167; TCGA BRCA -0.174; TCGA HNSC -0.112; TCGA LIHC -0.099; TCGA LUAD -0.07; TCGA LUSC -0.13; TCGA PRAD -0.358; TCGA STAD -0.137; TCGA UCEC -0.087 |
hsa-miR-200c-3p | MARCH1 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.185; TCGA CESC -0.148; TCGA COAD -0.285; TCGA ESCA -0.17; TCGA HNSC -0.219; TCGA KIRC -0.14; TCGA LGG -0.204; TCGA LUAD -0.264; TCGA LUSC -0.536; TCGA PAAD -0.438; TCGA PRAD -0.2; TCGA THCA -0.539; TCGA STAD -0.065 |
hsa-miR-200c-3p | PLCL1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.409; TCGA BRCA -0.277; TCGA CESC -0.497; TCGA COAD -0.487; TCGA ESCA -0.388; TCGA HNSC -0.433; TCGA LGG -0.135; TCGA LUAD -0.138; TCGA LUSC -0.61; TCGA PAAD -0.306; TCGA PRAD -0.759; TCGA SARC -0.17; TCGA STAD -0.443; TCGA UCEC -0.501 |
hsa-miR-200c-3p | DYNC1I1 | 9 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; OV; PRAD; STAD | MirTarget | TCGA BLCA -0.198; TCGA BRCA -0.305; TCGA COAD -0.826; TCGA ESCA -0.215; TCGA LGG -0.166; TCGA LIHC -0.161; TCGA OV -0.228; TCGA PRAD -0.662; TCGA STAD -0.659 |
hsa-miR-200c-3p | RGL1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.268; TCGA BRCA -0.366; TCGA CESC -0.266; TCGA COAD -0.394; TCGA ESCA -0.245; TCGA HNSC -0.1; TCGA KIRC -0.149; TCGA KIRP -0.093; TCGA LUAD -0.221; TCGA LUSC -0.396; TCGA PAAD -0.342; TCGA PRAD -0.498; TCGA THCA -0.219; TCGA STAD -0.301; TCGA UCEC -0.171 |
hsa-miR-200c-3p | PRKACB | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.125; TCGA BRCA -0.166; TCGA CESC -0.145; TCGA ESCA -0.208; TCGA HNSC -0.21; TCGA LIHC -0.074; TCGA LUAD -0.115; TCGA LUSC -0.267; TCGA OV -0.16; TCGA STAD -0.289; TCGA UCEC -0.222 |
hsa-miR-200c-3p | SGPP1 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.173; TCGA BRCA -0.174; TCGA CESC -0.142; TCGA ESCA -0.172; TCGA HNSC -0.195; TCGA LUSC -0.342; TCGA THCA -0.064; TCGA STAD -0.124; TCGA UCEC -0.208 |
hsa-miR-200c-3p | LHFP | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.36; TCGA BRCA -0.507; TCGA CESC -0.361; TCGA COAD -0.652; TCGA ESCA -0.448; TCGA HNSC -0.357; TCGA KIRC -0.118; TCGA LUAD -0.19; TCGA LUSC -0.632; TCGA OV -0.249; TCGA PAAD -0.338; TCGA PRAD -0.285; TCGA THCA -0.318; TCGA STAD -0.359; TCGA UCEC -0.416 |
hsa-miR-200c-3p | TSC22D1 | 11 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.128; TCGA BRCA -0.117; TCGA ESCA -0.122; TCGA HNSC -0.098; TCGA LGG -0.238; TCGA LIHC -0.114; TCGA LUSC -0.234; TCGA PRAD -0.143; TCGA THCA -0.241; TCGA STAD -0.146; TCGA UCEC -0.088 |
hsa-miR-200c-3p | ZDHHC15 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.369; TCGA BRCA -0.236; TCGA CESC -0.482; TCGA COAD -0.947; TCGA ESCA -0.396; TCGA HNSC -0.214; TCGA LUAD -0.219; TCGA LUSC -0.694; TCGA OV -0.206; TCGA PRAD -0.58; TCGA STAD -0.575; TCGA UCEC -0.338 |
hsa-miR-200c-3p | SEC23A | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.213; TCGA BRCA -0.263; TCGA CESC -0.156; TCGA COAD -0.101; TCGA ESCA -0.182; TCGA HNSC -0.166; TCGA KIRC -0.099; TCGA LIHC -0.112; TCGA LUAD -0.201; TCGA LUSC -0.102; TCGA OV -0.177; TCGA PAAD -0.172; TCGA PRAD -0.471; TCGA SARC -0.091; TCGA THCA -0.19; TCGA STAD -0.214; TCGA UCEC -0.221 |
hsa-miR-200c-3p | DDIT4L | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.468; TCGA BRCA -0.403; TCGA CESC -0.292; TCGA COAD -1.084; TCGA ESCA -0.417; TCGA HNSC -0.991; TCGA LUSC -0.263; TCGA PAAD -0.341; TCGA PRAD -0.782; TCGA STAD -0.467 |
hsa-miR-200c-3p | PRKCB | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.487; TCGA BRCA -0.19; TCGA CESC -0.349; TCGA COAD -0.752; TCGA ESCA -0.484; TCGA HNSC -0.248; TCGA KIRC -0.078; TCGA LGG -0.209; TCGA LUAD -0.217; TCGA LUSC -0.805; TCGA PAAD -0.732; TCGA PRAD -0.931; TCGA THCA -0.521; TCGA STAD -0.587; TCGA UCEC -0.302 |
hsa-miR-200c-3p | ATXN1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.244; TCGA BRCA -0.106; TCGA CESC -0.179; TCGA COAD -0.167; TCGA ESCA -0.134; TCGA HNSC -0.111; TCGA KIRC -0.08; TCGA LUAD -0.138; TCGA LUSC -0.119; TCGA PAAD -0.154; TCGA PRAD -0.214; TCGA STAD -0.24; TCGA UCEC -0.135 |
hsa-miR-200c-3p | CLIP2 | 11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.176; TCGA BRCA -0.121; TCGA CESC -0.183; TCGA KIRP -0.07; TCGA LUAD -0.301; TCGA LUSC -0.117; TCGA OV -0.164; TCGA PRAD -0.361; TCGA SARC -0.05; TCGA THCA -0.291; TCGA UCEC -0.244 |
hsa-miR-200c-3p | ADCY2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.44; TCGA BRCA -0.244; TCGA CESC -0.372; TCGA COAD -0.969; TCGA ESCA -0.597; TCGA HNSC -0.615; TCGA KIRC -0.243; TCGA KIRP -0.537; TCGA LGG -0.215; TCGA PRAD -0.408; TCGA THCA -0.363; TCGA STAD -0.695; TCGA UCEC -0.614 |
hsa-miR-200c-3p | GIT2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.078; TCGA BRCA -0.1; TCGA CESC -0.068; TCGA COAD -0.081; TCGA ESCA -0.102; TCGA HNSC -0.097; TCGA KIRC -0.2; TCGA LUAD -0.092; TCGA LUSC -0.18; TCGA OV -0.067; TCGA PAAD -0.144; TCGA PRAD -0.116; TCGA STAD -0.156; TCGA UCEC -0.104 |
hsa-miR-200c-3p | PTHLH | 10 cancers: BLCA; BRCA; COAD; KIRC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.321; TCGA BRCA -0.21; TCGA COAD -0.697; TCGA KIRC -0.651; TCGA LUAD -0.242; TCGA PAAD -0.214; TCGA PRAD -0.43; TCGA THCA -0.408; TCGA STAD -0.359; TCGA UCEC -0.15 |
hsa-miR-200c-3p | THAP2 | 10 cancers: BLCA; ESCA; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.056; TCGA ESCA -0.09; TCGA LGG -0.135; TCGA LUAD -0.079; TCGA LUSC -0.123; TCGA OV -0.095; TCGA PRAD -0.052; TCGA SARC -0.082; TCGA STAD -0.158; TCGA UCEC -0.12 |
hsa-miR-200c-3p | F2RL2 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; OV; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.402; TCGA CESC -0.342; TCGA ESCA -0.193; TCGA HNSC -0.219; TCGA KIRC -0.083; TCGA LUAD -0.206; TCGA OV -0.331; TCGA THCA -0.828; TCGA STAD -0.129; TCGA UCEC -0.18 |
hsa-miR-200c-3p | DENND5A | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.25; TCGA BRCA -0.182; TCGA CESC -0.077; TCGA COAD -0.368; TCGA ESCA -0.254; TCGA HNSC -0.067; TCGA KIRC -0.098; TCGA LGG -0.22; TCGA LUAD -0.127; TCGA LUSC -0.183; TCGA OV -0.06; TCGA PAAD -0.23; TCGA PRAD -0.231; TCGA SARC -0.056; TCGA THCA -0.061; TCGA STAD -0.351; TCGA UCEC -0.142 |
hsa-miR-200c-3p | FHL1 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.778; TCGA BRCA -0.95; TCGA CESC -0.701; TCGA COAD -0.957; TCGA ESCA -0.67; TCGA HNSC -0.742; TCGA KIRC -0.247; TCGA KIRP -0.401; TCGA LGG -0.086; TCGA LUAD -0.331; TCGA LUSC -1.019; TCGA OV -0.168; TCGA PAAD -0.34; TCGA PRAD -0.901; TCGA SARC -0.167; TCGA STAD -0.888; TCGA UCEC -0.693 |
hsa-miR-200c-3p | SGIP1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.324; TCGA BRCA -0.098; TCGA CESC -0.39; TCGA COAD -0.585; TCGA ESCA -0.3; TCGA HNSC -0.238; TCGA LUAD -0.223; TCGA LUSC -0.673; TCGA PAAD -0.226; TCGA PRAD -0.211; TCGA SARC -0.215; TCGA STAD -0.307; TCGA UCEC -0.242 |
hsa-miR-200c-3p | PHF21A | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.066; TCGA CESC -0.076; TCGA COAD -0.176; TCGA ESCA -0.13; TCGA KIRC -0.09; TCGA LGG -0.151; TCGA PAAD -0.052; TCGA STAD -0.231; TCGA UCEC -0.083 |
hsa-miR-200c-3p | SPAG9 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.05; TCGA BRCA -0.146; TCGA CESC -0.077; TCGA HNSC -0.066; TCGA KIRP -0.063; TCGA LGG -0.119; TCGA LUSC -0.068; TCGA OV -0.08; TCGA PRAD -0.138; TCGA STAD -0.097; TCGA UCEC -0.148 |
hsa-miR-200c-3p | TFPI | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.206; TCGA BRCA -0.506; TCGA CESC -0.216; TCGA COAD -0.308; TCGA ESCA -0.164; TCGA HNSC -0.218; TCGA KIRC -0.147; TCGA KIRP -0.189; TCGA LIHC -0.13; TCGA LUSC -0.488; TCGA OV -0.254; TCGA PRAD -0.495; TCGA THCA -0.488; TCGA STAD -0.158; TCGA UCEC -0.428 |
hsa-miR-200c-3p | LAMC1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.19; TCGA BRCA -0.329; TCGA CESC -0.105; TCGA COAD -0.226; TCGA ESCA -0.172; TCGA HNSC -0.117; TCGA KIRC -0.093; TCGA KIRP -0.056; TCGA PAAD -0.116; TCGA PRAD -0.14; TCGA SARC -0.12; TCGA STAD -0.25 |
hsa-miR-200c-3p | JUN | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.195; TCGA BRCA -0.273; TCGA CESC -0.119; TCGA ESCA -0.11; TCGA HNSC -0.149; TCGA KIRC -0.074; TCGA LUAD -0.112; TCGA LUSC -0.194; TCGA PRAD -0.165; TCGA STAD -0.141; TCGA UCEC -0.101 |
hsa-miR-200c-3p | GPRASP2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; OV; PRAD; UCEC | MirTarget | TCGA BLCA -0.185; TCGA BRCA -0.216; TCGA CESC -0.215; TCGA COAD -0.275; TCGA ESCA -0.206; TCGA LGG -0.099; TCGA LIHC -0.171; TCGA LUAD -0.085; TCGA OV -0.203; TCGA PRAD -0.121; TCGA UCEC -0.355 |
hsa-miR-200c-3p | ITGA1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.34; TCGA BRCA -0.347; TCGA CESC -0.205; TCGA COAD -0.214; TCGA ESCA -0.273; TCGA HNSC -0.236; TCGA KIRC -0.128; TCGA LIHC -0.067; TCGA LUAD -0.169; TCGA LUSC -0.656; TCGA OV -0.142; TCGA PAAD -0.188; TCGA PRAD -0.623; TCGA SARC -0.245; TCGA STAD -0.382; TCGA UCEC -0.16 |
hsa-miR-200c-3p | TRIM23 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.082; TCGA BRCA -0.132; TCGA CESC -0.074; TCGA COAD -0.102; TCGA ESCA -0.149; TCGA HNSC -0.143; TCGA LGG -0.187; TCGA LIHC -0.088; TCGA LUAD -0.125; TCGA LUSC -0.177; TCGA OV -0.078; TCGA PRAD -0.105; TCGA SARC -0.067; TCGA STAD -0.19; TCGA UCEC -0.185 |
hsa-miR-200c-3p | NALCN | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.198; TCGA BRCA -0.195; TCGA CESC -0.4; TCGA COAD -1.173; TCGA ESCA -0.464; TCGA HNSC -0.319; TCGA LGG -0.28; TCGA LUAD -0.31; TCGA LUSC -0.857; TCGA OV -0.266; TCGA PRAD -0.312; TCGA THCA -0.536; TCGA STAD -0.413; TCGA UCEC -0.288 |
hsa-miR-200c-3p | SNAP25 | 13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.463; TCGA CESC -0.354; TCGA COAD -1.268; TCGA ESCA -0.377; TCGA KIRC -0.277; TCGA KIRP -0.382; TCGA LGG -0.425; TCGA LUSC -0.203; TCGA PRAD -0.743; TCGA SARC -0.252; TCGA THCA -0.628; TCGA STAD -0.82; TCGA UCEC -0.595 |
hsa-miR-200c-3p | ELL2 | 13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.126; TCGA BRCA -0.121; TCGA ESCA -0.143; TCGA HNSC -0.139; TCGA KIRC -0.094; TCGA LIHC -0.155; TCGA LUAD -0.105; TCGA LUSC -0.185; TCGA OV -0.152; TCGA SARC -0.091; TCGA THCA -0.09; TCGA STAD -0.196; TCGA UCEC -0.126 |
hsa-miR-200c-3p | FBXW11 | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.06; TCGA BRCA -0.078; TCGA CESC -0.058; TCGA HNSC -0.061; TCGA LGG -0.125; TCGA LUAD -0.076; TCGA LUSC -0.136; TCGA SARC -0.063; TCGA STAD -0.079; TCGA UCEC -0.1 |
hsa-miR-200c-3p | CUTC | 9 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.092; TCGA BRCA -0.152; TCGA HNSC -0.183; TCGA KIRC -0.055; TCGA LIHC -0.061; TCGA OV -0.072; TCGA PAAD -0.112; TCGA STAD -0.095; TCGA UCEC -0.054 |
hsa-miR-200c-3p | RNF38 | 11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.082; TCGA BRCA -0.065; TCGA CESC -0.109; TCGA ESCA -0.093; TCGA LGG -0.099; TCGA LUAD -0.059; TCGA LUSC -0.156; TCGA PRAD -0.143; TCGA SARC -0.081; TCGA STAD -0.18; TCGA UCEC -0.167 |
hsa-miR-200c-3p | MRVI1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.427; TCGA BRCA -0.348; TCGA CESC -0.52; TCGA COAD -0.78; TCGA ESCA -0.532; TCGA HNSC -0.285; TCGA LGG -0.307; TCGA LUAD -0.277; TCGA LUSC -0.685; TCGA OV -0.173; TCGA PAAD -0.283; TCGA PRAD -0.785; TCGA SARC -0.36; TCGA THCA -0.24; TCGA STAD -0.628; TCGA UCEC -0.454 |
hsa-miR-200c-3p | CORO1C | 14 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.289; TCGA BRCA -0.174; TCGA ESCA -0.098; TCGA KIRC -0.172; TCGA KIRP -0.13; TCGA LGG -0.166; TCGA LUAD -0.236; TCGA OV -0.06; TCGA PAAD -0.159; TCGA PRAD -0.456; TCGA SARC -0.082; TCGA THCA -0.203; TCGA STAD -0.211; TCGA UCEC -0.199 |
hsa-miR-200c-3p | CACNA1C | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.436; TCGA BRCA -0.177; TCGA CESC -0.48; TCGA COAD -0.509; TCGA ESCA -0.412; TCGA HNSC -0.311; TCGA KIRC -0.11; TCGA LGG -0.085; TCGA LUAD -0.214; TCGA LUSC -0.726; TCGA OV -0.327; TCGA PRAD -0.515; TCGA THCA -0.286; TCGA STAD -0.602; TCGA UCEC -0.423 |
hsa-miR-200c-3p | DENND5B | 13 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.389; TCGA BRCA -0.264; TCGA COAD -0.245; TCGA HNSC -0.333; TCGA LGG -0.168; TCGA LIHC -0.068; TCGA LUAD -0.18; TCGA LUSC -0.197; TCGA PAAD -0.147; TCGA PRAD -0.253; TCGA THCA -0.139; TCGA STAD -0.083; TCGA UCEC -0.232 |
hsa-miR-200c-3p | RELN | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.654; TCGA BRCA -0.83; TCGA CESC -0.468; TCGA COAD -1.264; TCGA ESCA -0.935; TCGA HNSC -0.606; TCGA KIRP -0.4; TCGA LUSC -0.973; TCGA OV -0.399; TCGA THCA -1.308; TCGA STAD -0.684; TCGA UCEC -0.462 |
hsa-miR-200c-3p | PHLDB1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.192; TCGA BRCA -0.32; TCGA CESC -0.185; TCGA COAD -0.29; TCGA ESCA -0.219; TCGA HNSC -0.301; TCGA LUAD -0.179; TCGA LUSC -0.356; TCGA OV -0.108; TCGA PAAD -0.181; TCGA PRAD -0.315; TCGA STAD -0.266; TCGA UCEC -0.1 |
hsa-miR-200c-3p | ULK2 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.073; TCGA BRCA -0.057; TCGA COAD -0.173; TCGA ESCA -0.176; TCGA KIRP -0.085; TCGA LUSC -0.115; TCGA PAAD -0.111; TCGA STAD -0.279; TCGA UCEC -0.114 |
hsa-miR-200c-3p | KIAA1462 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.391; TCGA BRCA -0.36; TCGA CESC -0.362; TCGA COAD -0.664; TCGA ESCA -0.276; TCGA HNSC -0.363; TCGA KIRC -0.12; TCGA LGG -0.183; TCGA LUAD -0.25; TCGA LUSC -0.816; TCGA OV -0.19; TCGA PAAD -0.146; TCGA PRAD -0.388; TCGA SARC -0.078; TCGA STAD -0.236; TCGA UCEC -0.475 |
hsa-miR-200c-3p | ENTPD1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; mirMAP | TCGA BLCA -0.243; TCGA BRCA -0.068; TCGA CESC -0.174; TCGA COAD -0.347; TCGA ESCA -0.207; TCGA HNSC -0.142; TCGA KIRC -0.134; TCGA LUAD -0.215; TCGA LUSC -0.385; TCGA OV -0.071; TCGA PAAD -0.306; TCGA PRAD -0.25; TCGA SARC -0.098; TCGA STAD -0.199; TCGA UCEC -0.188 |
hsa-miR-200c-3p | CDK17 | 13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.091; TCGA CESC -0.106; TCGA ESCA -0.172; TCGA HNSC -0.065; TCGA KIRC -0.101; TCGA LGG -0.06; TCGA LUAD -0.102; TCGA LUSC -0.117; TCGA PAAD -0.072; TCGA SARC -0.059; TCGA THCA -0.096; TCGA STAD -0.131; TCGA UCEC -0.176 |
hsa-miR-200c-3p | HS3ST3A1 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.629; TCGA COAD -0.564; TCGA ESCA -0.251; TCGA HNSC -0.241; TCGA LUAD -0.471; TCGA PAAD -0.256; TCGA PRAD -0.678; TCGA THCA -0.705; TCGA STAD -0.277 |
hsa-miR-200c-3p | FAT3 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.234; TCGA BRCA -0.551; TCGA CESC -0.493; TCGA COAD -0.742; TCGA ESCA -0.577; TCGA HNSC -0.304; TCGA LGG -0.195; TCGA LUAD -0.281; TCGA LUSC -0.627; TCGA OV -0.452; TCGA PAAD -0.425; TCGA PRAD -1.044; TCGA STAD -0.979; TCGA UCEC -0.454 |
hsa-miR-200c-3p | ACTC1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -1.34; TCGA BRCA -0.451; TCGA CESC -0.546; TCGA COAD -1.296; TCGA ESCA -0.588; TCGA HNSC -1.361; TCGA LUSC -0.713; TCGA OV -0.563; TCGA PAAD -0.504; TCGA PRAD -1.366; TCGA THCA -0.652; TCGA STAD -0.711; TCGA UCEC -0.406 |
hsa-miR-200c-3p | ARHGAP6 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.12; TCGA BRCA -0.455; TCGA CESC -0.509; TCGA COAD -0.336; TCGA ESCA -0.299; TCGA HNSC -0.421; TCGA LUAD -0.2; TCGA LUSC -0.966; TCGA OV -0.132; TCGA PAAD -0.118; TCGA SARC -0.111; TCGA STAD -0.355; TCGA UCEC -0.63 |
hsa-miR-200c-3p | SYNC | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.271; TCGA BRCA -0.2; TCGA CESC -0.289; TCGA COAD -0.94; TCGA ESCA -0.554; TCGA HNSC -0.502; TCGA KIRP -0.092; TCGA LUAD -0.165; TCGA LUSC -0.539; TCGA OV -0.172; TCGA PAAD -0.38; TCGA PRAD -0.367; TCGA STAD -0.18 |
hsa-miR-200c-3p | MEGF10 | 9 cancers: BLCA; CESC; COAD; LUAD; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.148; TCGA CESC -0.373; TCGA COAD -0.411; TCGA LUAD -0.413; TCGA OV -0.416; TCGA PRAD -0.182; TCGA THCA -0.404; TCGA STAD -0.377; TCGA UCEC -0.354 |
hsa-miR-200c-3p | PICALM | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.055; TCGA BRCA -0.145; TCGA CESC -0.08; TCGA ESCA -0.074; TCGA HNSC -0.055; TCGA LUAD -0.099; TCGA LUSC -0.132; TCGA PAAD -0.073; TCGA THCA -0.099; TCGA UCEC -0.093 |
hsa-miR-200c-3p | ARHGAP20 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.507; TCGA BRCA -0.693; TCGA CESC -0.516; TCGA COAD -0.782; TCGA ESCA -0.523; TCGA HNSC -0.273; TCGA LUAD -0.418; TCGA LUSC -0.709; TCGA PAAD -0.337; TCGA PRAD -0.834; TCGA SARC -0.269; TCGA STAD -0.568; TCGA UCEC -0.54 |
hsa-miR-200c-3p | ZNF423 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.12; TCGA BRCA -0.475; TCGA CESC -0.455; TCGA COAD -0.53; TCGA ESCA -0.501; TCGA HNSC -0.41; TCGA KIRC -0.055; TCGA LGG -0.28; TCGA LUAD -0.309; TCGA LUSC -0.77; TCGA OV -0.304; TCGA PAAD -0.336; TCGA PRAD -0.56; TCGA THCA -0.161; TCGA STAD -0.494; TCGA UCEC -0.265 |
hsa-miR-200c-3p | DIXDC1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.516; TCGA BRCA -0.323; TCGA CESC -0.354; TCGA COAD -0.377; TCGA ESCA -0.37; TCGA HNSC -0.263; TCGA KIRP -0.117; TCGA LUAD -0.124; TCGA LUSC -0.514; TCGA OV -0.101; TCGA PAAD -0.146; TCGA PRAD -0.423; TCGA SARC -0.118; TCGA STAD -0.557; TCGA UCEC -0.36 |
hsa-miR-200c-3p | RBM20 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.268; TCGA BRCA -0.206; TCGA CESC -0.239; TCGA COAD -0.555; TCGA HNSC -0.206; TCGA KIRC -0.127; TCGA KIRP -0.172; TCGA OV -0.212; TCGA PRAD -0.404; TCGA STAD -0.59; TCGA UCEC -0.304 |
hsa-miR-200c-3p | NOG | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.376; TCGA BRCA -0.347; TCGA ESCA -0.526; TCGA HNSC -0.705; TCGA KIRC -0.203; TCGA LGG -0.732; TCGA LUAD -0.24; TCGA LUSC -0.667; TCGA OV -0.191; TCGA PRAD -0.65; TCGA STAD -0.484 |
hsa-miR-200c-3p | GJC1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.312; TCGA BRCA -0.178; TCGA CESC -0.175; TCGA COAD -0.521; TCGA ESCA -0.289; TCGA HNSC -0.178; TCGA KIRC -0.357; TCGA LUAD -0.232; TCGA OV -0.222; TCGA PAAD -0.269; TCGA PRAD -0.6; TCGA SARC -0.135; TCGA STAD -0.514; TCGA UCEC -0.434 |
hsa-miR-200c-3p | FOXF1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.333; TCGA BRCA -0.151; TCGA CESC -0.214; TCGA COAD -0.406; TCGA ESCA -0.383; TCGA HNSC -0.122; TCGA KIRC -0.203; TCGA LUSC -0.674; TCGA OV -0.146; TCGA PAAD -0.197; TCGA PRAD -0.655; TCGA STAD -0.545; TCGA UCEC -0.173 |
hsa-miR-200c-3p | FRMD4A | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; THCA; STAD | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.178; TCGA COAD -0.232; TCGA ESCA -0.179; TCGA HNSC -0.081; TCGA LGG -0.122; TCGA LUAD -0.184; TCGA LUSC -0.349; TCGA OV -0.11; TCGA PAAD -0.259; TCGA THCA -0.155; TCGA STAD -0.241 |
hsa-miR-200c-3p | PCDH10 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.526; TCGA BRCA -0.288; TCGA CESC -0.411; TCGA ESCA -0.571; TCGA HNSC -0.404; TCGA KIRP -0.143; TCGA LUAD -0.362; TCGA LUSC -0.506; TCGA OV -0.272; TCGA PRAD -0.819; TCGA THCA -0.385; TCGA STAD -1.22; TCGA UCEC -0.365 |
hsa-miR-200c-3p | SIRPA | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.382; TCGA BRCA -0.27; TCGA CESC -0.227; TCGA COAD -0.53; TCGA ESCA -0.193; TCGA HNSC -0.274; TCGA KIRC -0.237; TCGA KIRP -0.166; TCGA LUAD -0.354; TCGA LUSC -0.564; TCGA PAAD -0.293; TCGA PRAD -0.335; TCGA THCA -0.467; TCGA UCEC -0.147 |
hsa-miR-200c-3p | ZNF532 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.181; TCGA BRCA -0.124; TCGA CESC -0.152; TCGA COAD -0.471; TCGA ESCA -0.18; TCGA HNSC -0.071; TCGA KIRC -0.124; TCGA LUAD -0.114; TCGA OV -0.112; TCGA PAAD -0.242; TCGA PRAD -0.187; TCGA STAD -0.252; TCGA UCEC -0.136 |
hsa-miR-200c-3p | MPRIP | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.081; TCGA BRCA -0.187; TCGA CESC -0.106; TCGA COAD -0.156; TCGA ESCA -0.091; TCGA HNSC -0.133; TCGA LUAD -0.087; TCGA LUSC -0.253; TCGA OV -0.134; TCGA PAAD -0.106; TCGA PRAD -0.19; TCGA THCA -0.05; TCGA STAD -0.11; TCGA UCEC -0.185 |
hsa-miR-200c-3p | ARHGAP28 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.204; TCGA BRCA -0.434; TCGA CESC -0.357; TCGA COAD -0.298; TCGA ESCA -0.201; TCGA HNSC -0.335; TCGA LGG -0.273; TCGA LUAD -0.305; TCGA OV -0.264; TCGA PAAD -0.444; TCGA SARC -0.151; TCGA STAD -0.22; TCGA UCEC -0.224 |
hsa-miR-200c-3p | ST3GAL2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.23; TCGA BRCA -0.206; TCGA CESC -0.217; TCGA COAD -0.112; TCGA ESCA -0.168; TCGA HNSC -0.28; TCGA KIRC -0.084; TCGA LIHC -0.066; TCGA LUAD -0.248; TCGA LUSC -0.384; TCGA OV -0.131; TCGA PAAD -0.174; TCGA PRAD -0.262; TCGA THCA -0.158; TCGA STAD -0.138; TCGA UCEC -0.179 |
hsa-miR-200c-3p | DTNA | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.647; TCGA BRCA -0.139; TCGA CESC -0.38; TCGA COAD -0.961; TCGA ESCA -0.523; TCGA HNSC -0.502; TCGA KIRP -0.305; TCGA LUAD -0.311; TCGA LUSC -0.321; TCGA PRAD -0.62; TCGA SARC -0.156; TCGA STAD -0.72; TCGA UCEC -0.39 |
hsa-miR-200c-3p | PSIP1 | 9 cancers: BLCA; ESCA; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.171; TCGA ESCA -0.114; TCGA LGG -0.132; TCGA LUAD -0.137; TCGA OV -0.103; TCGA PAAD -0.154; TCGA PRAD -0.242; TCGA STAD -0.175; TCGA UCEC -0.127 |
hsa-miR-200c-3p | ARHGEF3 | 10 cancers: BLCA; CESC; COAD; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.084; TCGA CESC -0.091; TCGA COAD -0.101; TCGA LUAD -0.121; TCGA LUSC -0.371; TCGA PRAD -0.146; TCGA SARC -0.074; TCGA THCA -0.124; TCGA STAD -0.051; TCGA UCEC -0.061 |
hsa-miR-200c-3p | ETV5 | 9 cancers: BLCA; BRCA; CESC; KIRC; LGG; LUAD; OV; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.204; TCGA BRCA -0.134; TCGA CESC -0.154; TCGA KIRC -0.069; TCGA LGG -0.147; TCGA LUAD -0.1; TCGA OV -0.137; TCGA PRAD -0.503; TCGA UCEC -0.115 |
hsa-miR-200c-3p | JAZF1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.417; TCGA BRCA -0.275; TCGA CESC -0.288; TCGA COAD -0.496; TCGA ESCA -0.306; TCGA HNSC -0.237; TCGA KIRC -0.128; TCGA KIRP -0.118; TCGA LIHC -0.071; TCGA LUAD -0.167; TCGA LUSC -0.403; TCGA PAAD -0.129; TCGA PRAD -0.637; TCGA STAD -0.319; TCGA UCEC -0.222 |
hsa-miR-200c-3p | ASAP1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.164; TCGA BRCA -0.116; TCGA CESC -0.106; TCGA COAD -0.163; TCGA ESCA -0.15; TCGA KIRC -0.158; TCGA LUAD -0.202; TCGA OV -0.103; TCGA PAAD -0.158; TCGA PRAD -0.322; TCGA SARC -0.071; TCGA THCA -0.15; TCGA STAD -0.088; TCGA UCEC -0.119 |
hsa-miR-200c-3p | PARD3B | 9 cancers: BLCA; BRCA; COAD; LGG; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.267; TCGA BRCA -0.352; TCGA COAD -0.175; TCGA LGG -0.259; TCGA LUSC -0.684; TCGA PRAD -0.218; TCGA SARC -0.16; TCGA STAD -0.186; TCGA UCEC -0.164 |
hsa-miR-200c-3p | MPDZ | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.205; TCGA BRCA -0.254; TCGA CESC -0.233; TCGA COAD -0.837; TCGA ESCA -0.439; TCGA HNSC -0.271; TCGA LGG -0.082; TCGA LIHC -0.226; TCGA LUAD -0.14; TCGA LUSC -0.325; TCGA OV -0.18; TCGA PAAD -0.281; TCGA PRAD -0.234; TCGA SARC -0.119; TCGA STAD -0.58; TCGA UCEC -0.221 |
hsa-miR-200c-3p | RND3 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.166; TCGA BRCA -0.267; TCGA ESCA -0.109; TCGA HNSC -0.168; TCGA KIRP -0.05; TCGA LUAD -0.245; TCGA PAAD -0.191; TCGA PRAD -0.667; TCGA THCA -0.557; TCGA UCEC -0.09 |
hsa-miR-200c-3p | WWC3 | 10 cancers: BLCA; COAD; ESCA; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.152; TCGA COAD -0.148; TCGA ESCA -0.245; TCGA KIRC -0.122; TCGA LUSC -0.277; TCGA OV -0.16; TCGA PAAD -0.154; TCGA PRAD -0.248; TCGA STAD -0.306; TCGA UCEC -0.16 |
hsa-miR-200c-3p | NAP1L5 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.177; TCGA CESC -0.14; TCGA COAD -0.24; TCGA ESCA -0.262; TCGA HNSC -0.089; TCGA LGG -0.178; TCGA LIHC -0.129; TCGA LUAD -0.14; TCGA LUSC -0.277; TCGA PRAD -0.218; TCGA STAD -0.425; TCGA UCEC -0.194 |
hsa-miR-200c-3p | CHRDL1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.987; TCGA BRCA -0.919; TCGA CESC -0.925; TCGA COAD -1.854; TCGA ESCA -1.082; TCGA HNSC -0.729; TCGA LGG -0.29; TCGA LUSC -1.277; TCGA PAAD -0.897; TCGA PRAD -1.024; TCGA SARC -0.258; TCGA THCA -1.544; TCGA STAD -1.092; TCGA UCEC -0.797 |
hsa-miR-200c-3p | GLRX | 11 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.167; TCGA BRCA -0.083; TCGA HNSC -0.258; TCGA KIRC -0.057; TCGA LIHC -0.158; TCGA LUAD -0.182; TCGA LUSC -0.591; TCGA PAAD -0.158; TCGA PRAD -0.232; TCGA SARC -0.121; TCGA THCA -0.387 |
hsa-miR-200c-3p | CFL2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.478; TCGA BRCA -0.381; TCGA CESC -0.215; TCGA COAD -0.585; TCGA ESCA -0.397; TCGA HNSC -0.463; TCGA LIHC -0.171; TCGA LUAD -0.262; TCGA LUSC -0.468; TCGA OV -0.138; TCGA PAAD -0.206; TCGA PRAD -0.546; TCGA SARC -0.175; TCGA STAD -0.65; TCGA UCEC -0.336 |
hsa-miR-200c-3p | TRIL | 12 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.297; TCGA CESC -0.416; TCGA COAD -0.355; TCGA HNSC -0.288; TCGA LUAD -0.305; TCGA LUSC -0.348; TCGA OV -0.193; TCGA PAAD -0.265; TCGA PRAD -0.285; TCGA SARC -0.177; TCGA STAD -0.162; TCGA UCEC -0.143 |
hsa-miR-200c-3p | ATP11C | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.051; TCGA BRCA -0.146; TCGA CESC -0.107; TCGA COAD -0.108; TCGA ESCA -0.1; TCGA LIHC -0.156; TCGA LUAD -0.228; TCGA OV -0.098; TCGA PAAD -0.239; TCGA PRAD -0.142; TCGA THCA -0.213; TCGA STAD -0.075; TCGA UCEC -0.136 |
hsa-miR-200c-3p | FLI1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.315; TCGA BRCA -0.344; TCGA CESC -0.295; TCGA COAD -0.482; TCGA ESCA -0.318; TCGA HNSC -0.328; TCGA KIRC -0.192; TCGA LUAD -0.266; TCGA LUSC -0.864; TCGA OV -0.135; TCGA PAAD -0.461; TCGA PRAD -0.315; TCGA THCA -0.234; TCGA STAD -0.198; TCGA UCEC -0.287 |
hsa-miR-200c-3p | POLK | 9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.075; TCGA BRCA -0.12; TCGA ESCA -0.079; TCGA HNSC -0.083; TCGA LUAD -0.07; TCGA LUSC -0.176; TCGA PRAD -0.116; TCGA STAD -0.144; TCGA UCEC -0.096 |
hsa-miR-200c-3p | CNTN1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.74; TCGA BRCA -0.487; TCGA CESC -0.316; TCGA COAD -1.496; TCGA ESCA -0.557; TCGA LGG -0.259; TCGA PRAD -0.965; TCGA THCA -1.16; TCGA STAD -1.033; TCGA UCEC -0.321 |
hsa-miR-200c-3p | DOCK4 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.216; TCGA BRCA -0.238; TCGA CESC -0.332; TCGA COAD -0.256; TCGA ESCA -0.17; TCGA HNSC -0.227; TCGA KIRC -0.145; TCGA LUAD -0.232; TCGA LUSC -0.58; TCGA OV -0.115; TCGA PAAD -0.132; TCGA THCA -0.149; TCGA STAD -0.143; TCGA UCEC -0.265 |
hsa-miR-200c-3p | GREM1 | 11 cancers: BLCA; CESC; COAD; ESCA; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.651; TCGA CESC -0.406; TCGA COAD -1.251; TCGA ESCA -0.692; TCGA LUAD -0.534; TCGA OV -0.282; TCGA PAAD -0.51; TCGA PRAD -0.511; TCGA THCA -1.51; TCGA STAD -0.546; TCGA UCEC -0.34 |
hsa-miR-200c-3p | MARCH8 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.123; TCGA BRCA -0.155; TCGA CESC -0.159; TCGA COAD -0.105; TCGA ESCA -0.106; TCGA LGG -0.265; TCGA LIHC -0.079; TCGA LUSC -0.267; TCGA PRAD -0.198; TCGA SARC -0.095; TCGA STAD -0.167; TCGA UCEC -0.197 |
hsa-miR-200c-3p | BCAP29 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.065; TCGA BRCA -0.101; TCGA CESC -0.07; TCGA ESCA -0.062; TCGA HNSC -0.12; TCGA KIRC -0.071; TCGA LUAD -0.095; TCGA LUSC -0.108; TCGA SARC -0.054; TCGA STAD -0.103; TCGA UCEC -0.134 |
hsa-miR-200c-3p | TFEC | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA | MirTarget | TCGA BLCA -0.382; TCGA CESC -0.245; TCGA COAD -0.434; TCGA ESCA -0.334; TCGA HNSC -0.343; TCGA KIRC -0.268; TCGA KIRP -0.294; TCGA LUAD -0.38; TCGA LUSC -0.888; TCGA PAAD -0.557; TCGA PRAD -0.199; TCGA THCA -0.761 |
hsa-miR-200c-3p | LRRC8A | 9 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUAD; OV; PRAD; UCEC | MirTarget | TCGA BLCA -0.077; TCGA BRCA -0.071; TCGA COAD -0.105; TCGA KIRC -0.099; TCGA LGG -0.297; TCGA LUAD -0.128; TCGA OV -0.148; TCGA PRAD -0.063; TCGA UCEC -0.095 |
hsa-miR-200c-3p | HIPK3 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.181; TCGA BRCA -0.251; TCGA COAD -0.157; TCGA ESCA -0.109; TCGA HNSC -0.169; TCGA LUSC -0.193; TCGA PRAD -0.452; TCGA SARC -0.139; TCGA STAD -0.23; TCGA UCEC -0.206 |
hsa-miR-200c-3p | NEK9 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.102; TCGA BRCA -0.132; TCGA CESC -0.105; TCGA ESCA -0.119; TCGA HNSC -0.075; TCGA OV -0.101; TCGA PRAD -0.08; TCGA STAD -0.186; TCGA UCEC -0.181 |
hsa-miR-200c-3p | TCP11L1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.241; TCGA BRCA -0.086; TCGA CESC -0.108; TCGA COAD -0.154; TCGA ESCA -0.164; TCGA HNSC -0.092; TCGA KIRC -0.111; TCGA LGG -0.114; TCGA LUAD -0.189; TCGA OV -0.117; TCGA PAAD -0.106; TCGA PRAD -0.14; TCGA THCA -0.281; TCGA STAD -0.205; TCGA UCEC -0.149 |
hsa-miR-200c-3p | CELF2 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.508; TCGA BRCA -0.45; TCGA CESC -0.27; TCGA ESCA -0.523; TCGA HNSC -0.323; TCGA KIRC -0.089; TCGA KIRP -0.089; TCGA LGG -0.064; TCGA LUSC -0.847; TCGA OV -0.104; TCGA PAAD -0.543; TCGA PRAD -0.575; TCGA THCA -0.451; TCGA STAD -0.494; TCGA UCEC -0.326 |
hsa-miR-200c-3p | DRP2 | 10 cancers: BLCA; CESC; ESCA; HNSC; LGG; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.312; TCGA CESC -0.261; TCGA ESCA -0.283; TCGA HNSC -0.362; TCGA LGG -0.342; TCGA OV -0.246; TCGA PAAD -0.228; TCGA PRAD -0.555; TCGA STAD -0.498; TCGA UCEC -0.334 |
hsa-miR-200c-3p | SLC30A4 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.373; TCGA BRCA -0.213; TCGA CESC -0.127; TCGA COAD -0.146; TCGA ESCA -0.093; TCGA HNSC -0.168; TCGA LGG -0.15; TCGA LUAD -0.179; TCGA LUSC -0.18; TCGA STAD -0.146; TCGA UCEC -0.196 |
hsa-miR-200c-3p | FKBP14 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.117; TCGA BRCA -0.171; TCGA CESC -0.155; TCGA COAD -0.154; TCGA ESCA -0.106; TCGA HNSC -0.129; TCGA LUAD -0.182; TCGA OV -0.157; TCGA PAAD -0.177; TCGA PRAD -0.213; TCGA THCA -0.117; TCGA STAD -0.109; TCGA UCEC -0.073 |
hsa-miR-200c-3p | PPARGC1A | 10 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; PRAD; UCEC | mirMAP | TCGA BLCA -0.483; TCGA BRCA -0.427; TCGA HNSC -0.453; TCGA KIRP -0.213; TCGA LGG -0.173; TCGA LIHC -0.202; TCGA LUSC -0.568; TCGA OV -0.444; TCGA PRAD -0.831; TCGA UCEC -0.315 |
hsa-miR-200c-3p | BACH2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.543; TCGA BRCA -0.344; TCGA CESC -0.284; TCGA COAD -0.81; TCGA ESCA -0.344; TCGA HNSC -0.215; TCGA LGG -0.132; TCGA LUAD -0.191; TCGA OV -0.249; TCGA PAAD -0.456; TCGA PRAD -0.299; TCGA THCA -0.438; TCGA STAD -0.329; TCGA UCEC -0.391 |
hsa-miR-200c-3p | PDE4D | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUSC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.185; TCGA BRCA -0.178; TCGA COAD -0.147; TCGA ESCA -0.195; TCGA HNSC -0.195; TCGA KIRP -0.093; TCGA LGG -0.147; TCGA LUSC -0.335; TCGA OV -0.178; TCGA PRAD -0.317; TCGA SARC -0.134; TCGA STAD -0.301; TCGA UCEC -0.306 |
hsa-miR-200c-3p | FOXP1 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; OV; STAD; UCEC | mirMAP | TCGA BLCA -0.054; TCGA BRCA -0.092; TCGA CESC -0.113; TCGA ESCA -0.163; TCGA HNSC -0.184; TCGA LUSC -0.448; TCGA OV -0.076; TCGA STAD -0.135; TCGA UCEC -0.178 |
hsa-miR-200c-3p | MEF2D | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.142; TCGA CESC -0.118; TCGA COAD -0.145; TCGA ESCA -0.124; TCGA HNSC -0.174; TCGA KIRC -0.066; TCGA LUSC -0.191; TCGA OV -0.064; TCGA PRAD -0.107; TCGA STAD -0.179; TCGA UCEC -0.161 |
hsa-miR-200c-3p | THRA | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.222; TCGA BRCA -0.165; TCGA CESC -0.169; TCGA HNSC -0.065; TCGA LGG -0.219; TCGA LUSC -0.17; TCGA PRAD -0.187; TCGA STAD -0.104; TCGA UCEC -0.203 |
hsa-miR-200c-3p | STARD8 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.379; TCGA BRCA -0.34; TCGA CESC -0.405; TCGA COAD -0.511; TCGA ESCA -0.29; TCGA HNSC -0.424; TCGA LUAD -0.258; TCGA LUSC -0.929; TCGA OV -0.205; TCGA PAAD -0.353; TCGA PRAD -0.595; TCGA STAD -0.213; TCGA UCEC -0.351 |
hsa-miR-200c-3p | SYT11 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.47; TCGA BRCA -0.244; TCGA CESC -0.346; TCGA COAD -0.649; TCGA ESCA -0.389; TCGA HNSC -0.3; TCGA LGG -0.112; TCGA LUAD -0.263; TCGA LUSC -0.524; TCGA OV -0.099; TCGA PAAD -0.233; TCGA PRAD -0.582; TCGA SARC -0.097; TCGA THCA -0.513; TCGA STAD -0.439; TCGA UCEC -0.224 |
hsa-miR-200c-3p | IL6ST | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.352; TCGA BRCA -0.318; TCGA CESC -0.215; TCGA COAD -0.286; TCGA ESCA -0.224; TCGA HNSC -0.278; TCGA LGG -0.134; TCGA LUSC -0.656; TCGA PRAD -0.624; TCGA SARC -0.204; TCGA STAD -0.258; TCGA UCEC -0.276 |
hsa-miR-200c-3p | ZFP37 | 11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.13; TCGA BRCA -0.157; TCGA CESC -0.194; TCGA ESCA -0.156; TCGA LGG -0.215; TCGA LUAD -0.292; TCGA OV -0.153; TCGA PAAD -0.149; TCGA PRAD -0.11; TCGA STAD -0.171; TCGA UCEC -0.166 |
hsa-miR-200c-3p | FGF2 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.582; TCGA BRCA -0.615; TCGA CESC -0.509; TCGA COAD -0.707; TCGA ESCA -0.459; TCGA HNSC -0.14; TCGA KIRP -0.104; TCGA LIHC -0.156; TCGA LUAD -0.304; TCGA LUSC -0.412; TCGA OV -0.4; TCGA PAAD -0.315; TCGA PRAD -0.673; TCGA SARC -0.167; TCGA THCA -0.316; TCGA STAD -0.558; TCGA UCEC -0.579 |
hsa-miR-200c-3p | ST8SIA2 | 10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.213; TCGA BRCA -0.281; TCGA ESCA -0.411; TCGA HNSC -0.382; TCGA LGG -0.639; TCGA LUAD -0.446; TCGA PAAD -0.339; TCGA PRAD -0.32; TCGA THCA -0.657; TCGA STAD -0.45 |
hsa-miR-200c-3p | ST6GAL2 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.262; TCGA CESC -0.421; TCGA COAD -0.793; TCGA ESCA -0.443; TCGA HNSC -0.324; TCGA LGG -0.574; TCGA LUAD -0.255; TCGA OV -0.216; TCGA PAAD -0.48; TCGA PRAD -0.414; TCGA SARC -0.201; TCGA STAD -0.699; TCGA UCEC -0.238 |
hsa-miR-200c-3p | PIK3R1 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.055; TCGA BRCA -0.257; TCGA CESC -0.21; TCGA ESCA -0.143; TCGA HNSC -0.166; TCGA LGG -0.313; TCGA LIHC -0.105; TCGA LUAD -0.175; TCGA LUSC -0.165; TCGA PAAD -0.155; TCGA PRAD -0.357; TCGA SARC -0.131; TCGA STAD -0.219 |
hsa-miR-200c-3p | GFRA1 | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.326; TCGA CESC -0.918; TCGA COAD -0.989; TCGA ESCA -0.531; TCGA HNSC -0.382; TCGA LGG -0.678; TCGA LIHC -0.317; TCGA LUSC -0.89; TCGA OV -0.599; TCGA PAAD -0.31; TCGA PRAD -0.671; TCGA THCA -1.04; TCGA STAD -0.797; TCGA UCEC -0.471 |
hsa-miR-200c-3p | DST | 12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.105; TCGA BRCA -0.368; TCGA COAD -0.192; TCGA HNSC -0.101; TCGA LGG -0.137; TCGA LUAD -0.304; TCGA OV -0.188; TCGA PRAD -0.464; TCGA SARC -0.202; TCGA THCA -0.476; TCGA STAD -0.326; TCGA UCEC -0.236 |
hsa-miR-200c-3p | SCN3A | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.315; TCGA BRCA -0.677; TCGA CESC -0.415; TCGA COAD -0.362; TCGA ESCA -0.348; TCGA HNSC -0.343; TCGA LGG -0.518; TCGA LUAD -0.27; TCGA LUSC -0.429; TCGA OV -0.368; TCGA PAAD -0.258; TCGA PRAD -0.418; TCGA SARC -0.409; TCGA THCA -0.372; TCGA STAD -0.277; TCGA UCEC -0.333 |
hsa-miR-200c-3p | RAB8B | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.059; TCGA BRCA -0.198; TCGA CESC -0.159; TCGA COAD -0.188; TCGA ESCA -0.208; TCGA HNSC -0.165; TCGA KIRC -0.052; TCGA LUAD -0.199; TCGA LUSC -0.466; TCGA OV -0.098; TCGA PAAD -0.208; TCGA PRAD -0.081; TCGA STAD -0.099; TCGA UCEC -0.275 |
hsa-miR-200c-3p | SLFN5 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.064; TCGA BRCA -0.288; TCGA COAD -0.278; TCGA HNSC -0.094; TCGA KIRC -0.077; TCGA LUAD -0.169; TCGA LUSC -0.198; TCGA PRAD -0.362; TCGA THCA -0.156; TCGA STAD -0.095 |
hsa-miR-200c-3p | SHE | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.346; TCGA BRCA -0.498; TCGA CESC -0.44; TCGA COAD -0.618; TCGA ESCA -0.309; TCGA HNSC -0.33; TCGA LUSC -0.991; TCGA OV -0.247; TCGA PAAD -0.365; TCGA PRAD -0.378; TCGA SARC -0.142; TCGA STAD -0.331; TCGA UCEC -0.441 |
hsa-miR-200c-3p | SGCD | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.675; TCGA BRCA -0.429; TCGA CESC -0.459; TCGA COAD -0.927; TCGA ESCA -0.463; TCGA HNSC -0.802; TCGA LGG -0.13; TCGA LUAD -0.377; TCGA LUSC -0.798; TCGA OV -0.267; TCGA PAAD -0.377; TCGA PRAD -0.282; TCGA SARC -0.122; TCGA THCA -0.376; TCGA STAD -0.587; TCGA UCEC -0.149 |
hsa-miR-200c-3p | PYGO1 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.411; TCGA BRCA -0.378; TCGA CESC -0.328; TCGA ESCA -0.276; TCGA HNSC -0.237; TCGA LGG -0.234; TCGA LUAD -0.141; TCGA OV -0.245; TCGA PAAD -0.358; TCGA PRAD -0.314; TCGA STAD -0.548; TCGA UCEC -0.35 |
hsa-miR-200c-3p | CHST11 | 15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.403; TCGA CESC -0.202; TCGA COAD -0.501; TCGA ESCA -0.138; TCGA HNSC -0.156; TCGA KIRC -0.266; TCGA KIRP -0.078; TCGA LGG -0.114; TCGA LUAD -0.214; TCGA LUSC -0.494; TCGA PAAD -0.272; TCGA PRAD -0.479; TCGA THCA -0.229; TCGA STAD -0.149; TCGA UCEC -0.138 |
hsa-miR-200c-3p | PTEN | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.057; TCGA BRCA -0.143; TCGA CESC -0.087; TCGA ESCA -0.064; TCGA HNSC -0.112; TCGA LGG -0.07; TCGA LUAD -0.067; TCGA LUSC -0.283; TCGA PAAD -0.108; TCGA PRAD -0.176; TCGA STAD -0.095; TCGA UCEC -0.102 |
hsa-miR-200c-3p | THEMIS | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.306; TCGA BRCA -0.107; TCGA COAD -0.252; TCGA HNSC -0.221; TCGA KIRC -0.379; TCGA LUAD -0.256; TCGA LUSC -0.479; TCGA PAAD -0.604; TCGA PRAD -0.437; TCGA THCA -0.758 |
hsa-miR-200c-3p | MSRB3 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.636; TCGA BRCA -0.515; TCGA CESC -0.514; TCGA COAD -0.98; TCGA ESCA -0.593; TCGA HNSC -0.462; TCGA LUAD -0.413; TCGA LUSC -0.808; TCGA OV -0.331; TCGA PAAD -0.375; TCGA PRAD -0.791; TCGA THCA -0.283; TCGA STAD -0.709; TCGA UCEC -0.629 |
hsa-miR-200c-3p | FZD4 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.112; TCGA BRCA -0.539; TCGA CESC -0.233; TCGA COAD -0.389; TCGA ESCA -0.217; TCGA HNSC -0.392; TCGA KIRC -0.1; TCGA KIRP -0.062; TCGA LIHC -0.098; TCGA LUAD -0.125; TCGA LUSC -0.633; TCGA PAAD -0.286; TCGA STAD -0.242; TCGA UCEC -0.257 |
hsa-miR-200c-3p | ARL10 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.288; TCGA BRCA -0.263; TCGA CESC -0.23; TCGA COAD -0.572; TCGA ESCA -0.255; TCGA KIRC -0.116; TCGA LGG -0.225; TCGA LUAD -0.296; TCGA OV -0.118; TCGA PAAD -0.185; TCGA PRAD -0.541; TCGA SARC -0.095; TCGA THCA -0.309; TCGA STAD -0.344; TCGA UCEC -0.265 |
hsa-miR-200c-3p | CIITA | 9 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.202; TCGA COAD -0.382; TCGA HNSC -0.212; TCGA KIRC -0.14; TCGA LUAD -0.25; TCGA LUSC -0.827; TCGA PAAD -0.506; TCGA PRAD -0.3; TCGA THCA -0.809 |
hsa-miR-200c-3p | SV2B | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.601; TCGA BRCA -0.488; TCGA CESC -0.304; TCGA COAD -1.102; TCGA ESCA -0.517; TCGA HNSC -0.224; TCGA LUAD -0.29; TCGA OV -0.29; TCGA PRAD -0.583; TCGA THCA -0.912; TCGA STAD -0.465; TCGA UCEC -0.363 |
hsa-miR-200c-3p | BEND4 | 10 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.318; TCGA COAD -0.496; TCGA ESCA -0.308; TCGA LGG -0.594; TCGA LUAD -0.377; TCGA LUSC -0.506; TCGA PAAD -0.522; TCGA THCA -0.791; TCGA STAD -0.223; TCGA UCEC -0.309 |
hsa-miR-200c-3p | TCF4 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.316; TCGA BRCA -0.373; TCGA CESC -0.251; TCGA COAD -0.552; TCGA ESCA -0.207; TCGA HNSC -0.148; TCGA KIRC -0.156; TCGA LGG -0.206; TCGA LUAD -0.252; TCGA LUSC -0.23; TCGA OV -0.178; TCGA PAAD -0.352; TCGA PRAD -0.354; TCGA THCA -0.123; TCGA STAD -0.262; TCGA UCEC -0.233 |
hsa-miR-200c-3p | SLC6A17 | 10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; OV; SARC; STAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.339; TCGA COAD -0.821; TCGA ESCA -0.245; TCGA HNSC -0.546; TCGA LGG -0.294; TCGA LUAD -0.494; TCGA OV -0.255; TCGA SARC -0.222; TCGA STAD -0.382; TCGA UCEC -0.107 |
hsa-miR-200c-3p | MYO5A | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.235; TCGA BRCA -0.118; TCGA CESC -0.213; TCGA COAD -0.537; TCGA ESCA -0.234; TCGA LGG -0.209; TCGA LUAD -0.295; TCGA LUSC -0.106; TCGA PAAD -0.274; TCGA THCA -0.127; TCGA STAD -0.241; TCGA UCEC -0.178 |
hsa-miR-200c-3p | SFMBT2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.349; TCGA BRCA -0.116; TCGA CESC -0.375; TCGA COAD -0.606; TCGA ESCA -0.362; TCGA HNSC -0.151; TCGA KIRC -0.051; TCGA LUAD -0.151; TCGA LUSC -0.566; TCGA OV -0.141; TCGA PAAD -0.34; TCGA PRAD -0.343; TCGA STAD -0.198; TCGA UCEC -0.385 |
hsa-miR-200c-3p | C17orf51 | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.276; TCGA BRCA -0.364; TCGA CESC -0.247; TCGA COAD -0.224; TCGA HNSC -0.105; TCGA KIRP -0.065; TCGA LGG -0.123; TCGA LUAD -0.15; TCGA OV -0.116; TCGA PAAD -0.167; TCGA PRAD -0.246; TCGA SARC -0.077; TCGA STAD -0.241; TCGA UCEC -0.253 |
hsa-miR-200c-3p | TMEM110 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.067; TCGA BRCA -0.05; TCGA COAD -0.107; TCGA ESCA -0.057; TCGA HNSC -0.082; TCGA LIHC -0.092; TCGA LUAD -0.064; TCGA LUSC -0.231; TCGA PAAD -0.09; TCGA PRAD -0.061; TCGA SARC -0.055; TCGA THCA -0.128 |
hsa-miR-200c-3p | NR5A2 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; OV; PRAD; UCEC | miRNATAP | TCGA BLCA -0.12; TCGA BRCA -0.419; TCGA CESC -0.293; TCGA HNSC -0.257; TCGA KIRC -0.207; TCGA LUAD -0.127; TCGA LUSC -0.667; TCGA OV -0.13; TCGA PRAD -0.195; TCGA UCEC -0.11 |
hsa-miR-200c-3p | RASSF8 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.315; TCGA BRCA -0.189; TCGA CESC -0.146; TCGA COAD -0.64; TCGA ESCA -0.325; TCGA HNSC -0.281; TCGA LUAD -0.406; TCGA LUSC -0.278; TCGA OV -0.256; TCGA PAAD -0.222; TCGA PRAD -0.147; TCGA SARC -0.1; TCGA STAD -0.52; TCGA UCEC -0.443 |
hsa-miR-200c-3p | GPM6A | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.612; TCGA BRCA -0.518; TCGA CESC -0.675; TCGA COAD -1.912; TCGA ESCA -1.067; TCGA HNSC -0.482; TCGA LGG -0.306; TCGA LUAD -0.257; TCGA LUSC -1.569; TCGA PAAD -0.457; TCGA PRAD -0.845; TCGA SARC -0.189; TCGA STAD -1.06; TCGA UCEC -0.847 |
hsa-miR-200c-3p | TLN1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.285; TCGA BRCA -0.211; TCGA CESC -0.184; TCGA COAD -0.264; TCGA ESCA -0.271; TCGA HNSC -0.219; TCGA LUAD -0.153; TCGA LUSC -0.407; TCGA OV -0.124; TCGA PAAD -0.211; TCGA PRAD -0.369; TCGA SARC -0.073; TCGA STAD -0.371; TCGA UCEC -0.196 |
hsa-miR-200c-3p | RUSC2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.333; TCGA BRCA -0.173; TCGA CESC -0.173; TCGA COAD -0.342; TCGA ESCA -0.215; TCGA HNSC -0.341; TCGA LGG -0.123; TCGA LUAD -0.17; TCGA LUSC -0.351; TCGA OV -0.171; TCGA PAAD -0.104; TCGA PRAD -0.389; TCGA SARC -0.105; TCGA STAD -0.295; TCGA UCEC -0.262 |
hsa-miR-200c-3p | DLC1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.196; TCGA BRCA -0.448; TCGA CESC -0.387; TCGA COAD -0.427; TCGA ESCA -0.349; TCGA HNSC -0.349; TCGA LIHC -0.07; TCGA LUSC -1.071; TCGA OV -0.21; TCGA PAAD -0.3; TCGA PRAD -0.354; TCGA THCA -0.193; TCGA STAD -0.37; TCGA UCEC -0.258 |
hsa-miR-200c-3p | NFIB | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; STAD | miRNATAP | TCGA BLCA -0.213; TCGA BRCA -0.24; TCGA HNSC -0.092; TCGA KIRC -0.09; TCGA KIRP -0.087; TCGA LGG -0.202; TCGA LIHC -0.056; TCGA LUSC -0.178; TCGA PAAD -0.172; TCGA STAD -0.181 |
hsa-miR-200c-3p | HDAC4 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.26; TCGA BRCA -0.172; TCGA CESC -0.088; TCGA COAD -0.126; TCGA HNSC -0.063; TCGA LGG -0.356; TCGA OV -0.107; TCGA PAAD -0.093; TCGA PRAD -0.105; TCGA STAD -0.286; TCGA UCEC -0.175 |
hsa-miR-200c-3p | FRMD6 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.099; TCGA BRCA -0.208; TCGA CESC -0.318; TCGA COAD -0.722; TCGA ESCA -0.288; TCGA LUAD -0.398; TCGA OV -0.197; TCGA PAAD -0.271; TCGA PRAD -0.673; TCGA SARC -0.12; TCGA THCA -0.295; TCGA STAD -0.426; TCGA UCEC -0.431 |
hsa-miR-200c-3p | FAM8A1 | 11 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.057; TCGA BRCA -0.059; TCGA ESCA -0.074; TCGA HNSC -0.065; TCGA LIHC -0.097; TCGA LUSC -0.152; TCGA OV -0.09; TCGA PRAD -0.077; TCGA SARC -0.078; TCGA STAD -0.125; TCGA UCEC -0.164 |
hsa-miR-200c-3p | PALM2-AKAP2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.423; TCGA BRCA -0.447; TCGA CESC -0.306; TCGA COAD -0.436; TCGA ESCA -0.318; TCGA HNSC -0.379; TCGA LUAD -0.318; TCGA LUSC -0.849; TCGA OV -0.123; TCGA PAAD -0.316; TCGA PRAD -0.301; TCGA SARC -0.059; TCGA THCA -0.169; TCGA STAD -0.305; TCGA UCEC -0.338 |
hsa-miR-200c-3p | TMEM170B | 11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.128; TCGA BRCA -0.291; TCGA COAD -0.187; TCGA HNSC -0.238; TCGA LGG -0.215; TCGA LIHC -0.094; TCGA LUSC -0.303; TCGA OV -0.14; TCGA PAAD -0.134; TCGA STAD -0.307; TCGA UCEC -0.176 |
hsa-miR-200c-3p | CREB5 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.47; TCGA BRCA -0.482; TCGA CESC -0.231; TCGA COAD -0.238; TCGA HNSC -0.257; TCGA KIRC -0.24; TCGA KIRP -0.382; TCGA LUAD -0.391; TCGA LUSC -0.246; TCGA PAAD -0.228; TCGA PRAD -0.262; TCGA THCA -0.669; TCGA STAD -0.3 |
hsa-miR-200c-3p | DPY19L1 | 9 cancers: BLCA; BRCA; KIRC; LIHC; LUAD; OV; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.056; TCGA BRCA -0.152; TCGA KIRC -0.087; TCGA LIHC -0.062; TCGA LUAD -0.237; TCGA OV -0.139; TCGA PRAD -0.317; TCGA THCA -0.295; TCGA UCEC -0.107 |
hsa-miR-200c-3p | RECK | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.45; TCGA BRCA -0.483; TCGA CESC -0.537; TCGA COAD -0.542; TCGA ESCA -0.467; TCGA HNSC -0.453; TCGA LUAD -0.369; TCGA LUSC -0.742; TCGA OV -0.262; TCGA PAAD -0.338; TCGA PRAD -0.227; TCGA THCA -0.185; TCGA STAD -0.462; TCGA UCEC -0.444 |
hsa-miR-200c-3p | WASF3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.125; TCGA BRCA -0.459; TCGA CESC -0.42; TCGA COAD -0.823; TCGA ESCA -0.223; TCGA HNSC -0.152; TCGA LGG -0.32; TCGA LUSC -0.442; TCGA OV -0.186; TCGA PAAD -0.151; TCGA STAD -0.387; TCGA UCEC -0.271 |
hsa-miR-200c-3p | KDR | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRNATAP | TCGA BLCA -0.101; TCGA BRCA -0.289; TCGA CESC -0.382; TCGA COAD -0.237; TCGA HNSC -0.264; TCGA KIRC -0.194; TCGA LGG -0.097; TCGA LIHC -0.117; TCGA LUAD -0.266; TCGA LUSC -0.728; TCGA OV -0.208; TCGA PAAD -0.185; TCGA PRAD -0.434; TCGA UCEC -0.323 |
hsa-miR-200c-3p | NFASC | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.305; TCGA BRCA -0.096; TCGA CESC -0.465; TCGA COAD -0.543; TCGA ESCA -0.568; TCGA HNSC -0.176; TCGA LUSC -0.506; TCGA OV -0.363; TCGA PRAD -0.538; TCGA SARC -0.197; TCGA THCA -0.21; TCGA STAD -0.738; TCGA UCEC -0.364 |
hsa-miR-200c-3p | NEGR1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.681; TCGA BRCA -0.493; TCGA CESC -0.515; TCGA COAD -0.786; TCGA ESCA -0.529; TCGA HNSC -0.488; TCGA LGG -0.24; TCGA LUAD -0.288; TCGA LUSC -0.984; TCGA OV -0.454; TCGA PAAD -0.147; TCGA PRAD -0.661; TCGA STAD -0.722; TCGA UCEC -0.545 |
hsa-miR-200c-3p | SRF | 11 cancers: BLCA; BRCA; CESC; COAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.164; TCGA BRCA -0.056; TCGA CESC -0.086; TCGA COAD -0.108; TCGA OV -0.073; TCGA PAAD -0.099; TCGA PRAD -0.209; TCGA SARC -0.079; TCGA THCA -0.123; TCGA STAD -0.25; TCGA UCEC -0.162 |
hsa-miR-200c-3p | SH3PXD2A | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.103; TCGA BRCA -0.127; TCGA CESC -0.092; TCGA COAD -0.163; TCGA HNSC -0.076; TCGA KIRC -0.139; TCGA LUAD -0.09; TCGA OV -0.152; TCGA PAAD -0.16; TCGA PRAD -0.451; TCGA THCA -0.201; TCGA STAD -0.166; TCGA UCEC -0.225 |
hsa-miR-200c-3p | PTPN21 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.119; TCGA BRCA -0.365; TCGA CESC -0.118; TCGA COAD -0.133; TCGA ESCA -0.102; TCGA HNSC -0.241; TCGA LUAD -0.159; TCGA LUSC -0.63; TCGA PRAD -0.217; TCGA STAD -0.191; TCGA UCEC -0.243 |
hsa-miR-200c-3p | NR3C1 | 14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.314; TCGA BRCA -0.372; TCGA COAD -0.538; TCGA ESCA -0.212; TCGA HNSC -0.093; TCGA KIRC -0.124; TCGA LGG -0.126; TCGA LIHC -0.091; TCGA LUSC -0.257; TCGA PAAD -0.163; TCGA PRAD -0.41; TCGA SARC -0.053; TCGA STAD -0.31; TCGA UCEC -0.354 |
hsa-miR-200c-3p | PLXNC1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.428; TCGA BRCA -0.195; TCGA CESC -0.41; TCGA COAD -0.633; TCGA ESCA -0.312; TCGA HNSC -0.411; TCGA KIRC -0.216; TCGA KIRP -0.089; TCGA LUAD -0.372; TCGA LUSC -0.98; TCGA PAAD -0.3; TCGA PRAD -0.622; TCGA SARC -0.142; TCGA THCA -0.399; TCGA STAD -0.099; TCGA UCEC -0.326 |
hsa-miR-200c-3p | MAF | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.357; TCGA BRCA -0.319; TCGA CESC -0.279; TCGA COAD -0.486; TCGA ESCA -0.234; TCGA HNSC -0.182; TCGA KIRC -0.239; TCGA KIRP -0.103; TCGA LUAD -0.276; TCGA LUSC -0.191; TCGA OV -0.187; TCGA PAAD -0.226; TCGA PRAD -0.242; TCGA THCA -0.067; TCGA STAD -0.239; TCGA UCEC -0.423 |
hsa-miR-200c-3p | CRYBG3 | 9 cancers: BLCA; BRCA; COAD; ESCA; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.063; TCGA BRCA -0.49; TCGA COAD -0.201; TCGA ESCA -0.076; TCGA PAAD -0.122; TCGA PRAD -0.267; TCGA SARC -0.175; TCGA STAD -0.174; TCGA UCEC -0.301 |
hsa-miR-200c-3p | GLI3 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.216; TCGA BRCA -0.092; TCGA CESC -0.439; TCGA COAD -1.073; TCGA ESCA -0.361; TCGA HNSC -0.204; TCGA KIRC -0.052; TCGA LUAD -0.323; TCGA OV -0.311; TCGA PAAD -0.433; TCGA PRAD -0.525; TCGA STAD -0.527; TCGA UCEC -0.472 |
hsa-miR-200c-3p | MMD | 10 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.308; TCGA BRCA -0.503; TCGA ESCA -0.175; TCGA LUAD -0.338; TCGA LUSC -0.173; TCGA OV -0.164; TCGA PAAD -0.231; TCGA PRAD -0.199; TCGA STAD -0.19; TCGA UCEC -0.089 |
hsa-miR-200c-3p | GPR146 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.181; TCGA BRCA -0.489; TCGA CESC -0.106; TCGA COAD -0.429; TCGA ESCA -0.175; TCGA HNSC -0.102; TCGA KIRC -0.107; TCGA LIHC -0.157; TCGA LUSC -0.537; TCGA PAAD -0.161; TCGA PRAD -0.101; TCGA SARC -0.1; TCGA STAD -0.256; TCGA UCEC -0.13 |
hsa-miR-200c-3p | BICD2 | 9 cancers: BLCA; BRCA; COAD; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.071; TCGA BRCA -0.094; TCGA COAD -0.131; TCGA LUAD -0.115; TCGA OV -0.134; TCGA PAAD -0.181; TCGA PRAD -0.208; TCGA STAD -0.175; TCGA UCEC -0.11 |
hsa-miR-200c-3p | PRKCA | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.159; TCGA BRCA -0.385; TCGA CESC -0.228; TCGA ESCA -0.158; TCGA HNSC -0.258; TCGA LGG -0.178; TCGA LIHC -0.058; TCGA LUAD -0.263; TCGA LUSC -0.384; TCGA OV -0.15; TCGA PRAD -0.463; TCGA THCA -0.224; TCGA STAD -0.143; TCGA UCEC -0.325 |
hsa-miR-200c-3p | COL4A3 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.321; TCGA BRCA -0.115; TCGA COAD -0.558; TCGA ESCA -0.485; TCGA HNSC -0.416; TCGA LUSC -1.119; TCGA PAAD -0.496; TCGA PRAD -0.341; TCGA STAD -0.429; TCGA UCEC -0.316 |
hsa-miR-200c-3p | KIF13A | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.123; TCGA BRCA -0.162; TCGA CESC -0.104; TCGA HNSC -0.096; TCGA LGG -0.246; TCGA PRAD -0.151; TCGA SARC -0.103; TCGA STAD -0.117; TCGA UCEC -0.149 |
hsa-miR-200c-3p | PLXNA4 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.68; TCGA BRCA -0.695; TCGA CESC -0.414; TCGA COAD -1.065; TCGA ESCA -0.482; TCGA HNSC -0.387; TCGA LGG -0.125; TCGA LUAD -0.378; TCGA LUSC -0.827; TCGA OV -0.271; TCGA PAAD -0.52; TCGA PRAD -0.417; TCGA STAD -0.542 |
hsa-miR-200c-3p | LATS2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.256; TCGA BRCA -0.294; TCGA CESC -0.142; TCGA COAD -0.365; TCGA ESCA -0.189; TCGA HNSC -0.24; TCGA LUAD -0.117; TCGA LUSC -0.48; TCGA OV -0.159; TCGA PAAD -0.186; TCGA PRAD -0.141; TCGA STAD -0.205; TCGA UCEC -0.26 |
hsa-miR-200c-3p | SCHIP1 | 14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.248; TCGA BRCA -0.196; TCGA COAD -0.591; TCGA ESCA -0.225; TCGA HNSC -0.111; TCGA KIRP -0.231; TCGA LGG -0.122; TCGA LUAD -0.134; TCGA OV -0.162; TCGA PAAD -0.237; TCGA PRAD -0.635; TCGA SARC -0.094; TCGA THCA -0.217; TCGA UCEC -0.228 |
hsa-miR-200c-3p | CYP1B1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.551; TCGA BRCA -0.131; TCGA CESC -0.497; TCGA COAD -1.102; TCGA ESCA -0.716; TCGA HNSC -0.403; TCGA LUAD -0.208; TCGA LUSC -0.681; TCGA OV -0.271; TCGA PAAD -0.595; TCGA PRAD -0.161; TCGA SARC -0.234; TCGA THCA -0.849; TCGA STAD -0.703; TCGA UCEC -0.493 |
hsa-miR-200c-3p | PCSK2 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.388; TCGA BRCA -0.389; TCGA CESC -0.373; TCGA COAD -1.18; TCGA ESCA -0.576; TCGA LGG -0.679; TCGA LUSC -0.615; TCGA PRAD -0.917; TCGA STAD -0.937; TCGA UCEC -0.434 |
hsa-miR-200c-3p | PRKAR2B | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.267; TCGA BRCA -0.293; TCGA CESC -0.232; TCGA COAD -0.458; TCGA ESCA -0.465; TCGA HNSC -0.17; TCGA LGG -0.133; TCGA LUSC -0.244; TCGA OV -0.138; TCGA PAAD -0.16; TCGA PRAD -0.192; TCGA THCA -0.424; TCGA STAD -0.547; TCGA UCEC -0.358 |
hsa-miR-200c-3p | SDC2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.331; TCGA BRCA -0.286; TCGA CESC -0.35; TCGA COAD -0.53; TCGA ESCA -0.329; TCGA HNSC -0.385; TCGA LIHC -0.109; TCGA LUAD -0.208; TCGA LUSC -0.462; TCGA OV -0.237; TCGA PAAD -0.17; TCGA PRAD -0.332; TCGA SARC -0.073; TCGA STAD -0.304; TCGA UCEC -0.216 |
hsa-miR-200c-3p | FGD1 | 9 cancers: BLCA; COAD; ESCA; LGG; LUAD; OV; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.177; TCGA COAD -0.338; TCGA ESCA -0.167; TCGA LGG -0.149; TCGA LUAD -0.132; TCGA OV -0.232; TCGA PAAD -0.187; TCGA PRAD -0.058; TCGA STAD -0.258 |
hsa-miR-200c-3p | ITPR1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.311; TCGA BRCA -0.183; TCGA CESC -0.365; TCGA COAD -0.542; TCGA ESCA -0.414; TCGA HNSC -0.169; TCGA LUSC -0.556; TCGA OV -0.143; TCGA PAAD -0.267; TCGA PRAD -0.626; TCGA SARC -0.211; TCGA STAD -0.392; TCGA UCEC -0.417 |
hsa-miR-200c-3p | PLK2 | 10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUSC; OV; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.154; TCGA CESC -0.181; TCGA HNSC -0.337; TCGA KIRC -0.325; TCGA KIRP -0.062; TCGA LUSC -0.214; TCGA OV -0.189; TCGA PRAD -0.224; TCGA THCA -0.104; TCGA UCEC -0.166 |
hsa-miR-200c-3p | FYN | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.351; TCGA BRCA -0.315; TCGA CESC -0.264; TCGA COAD -0.284; TCGA ESCA -0.213; TCGA HNSC -0.27; TCGA KIRC -0.174; TCGA LGG -0.118; TCGA LIHC -0.065; TCGA LUAD -0.283; TCGA LUSC -0.429; TCGA OV -0.159; TCGA PAAD -0.294; TCGA PRAD -0.293; TCGA STAD -0.196; TCGA UCEC -0.229 |
hsa-miR-200c-3p | BASP1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.189; TCGA CESC -0.291; TCGA COAD -0.634; TCGA ESCA -0.289; TCGA HNSC -0.292; TCGA LGG -0.208; TCGA PAAD -0.504; TCGA THCA -0.325; TCGA STAD -0.086 |
hsa-miR-200c-3p | CNTFR | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.437; TCGA BRCA -0.651; TCGA CESC -0.616; TCGA COAD -0.923; TCGA ESCA -0.332; TCGA HNSC -0.599; TCGA LGG -0.429; TCGA LUAD -0.275; TCGA LUSC -0.511; TCGA OV -0.335; TCGA PAAD -0.647; TCGA PRAD -0.718; TCGA STAD -0.443; TCGA UCEC -0.417 |
hsa-miR-200c-3p | SPRED1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; OV; PRAD; UCEC | miRNATAP | TCGA BLCA -0.18; TCGA BRCA -0.192; TCGA CESC -0.152; TCGA HNSC -0.11; TCGA KIRC -0.094; TCGA LUAD -0.233; TCGA LUSC -0.289; TCGA OV -0.085; TCGA PRAD -0.335; TCGA UCEC -0.157 |
hsa-miR-200c-3p | DNAJB5 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.523; TCGA BRCA -0.224; TCGA CESC -0.262; TCGA COAD -0.807; TCGA ESCA -0.424; TCGA HNSC -0.363; TCGA KIRC -0.06; TCGA KIRP -0.095; TCGA LGG -0.142; TCGA LUAD -0.222; TCGA LUSC -0.232; TCGA OV -0.166; TCGA PAAD -0.334; TCGA PRAD -0.654; TCGA STAD -0.742; TCGA UCEC -0.228 |
hsa-miR-200c-3p | PDE5A | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.301; TCGA BRCA -0.272; TCGA CESC -0.127; TCGA COAD -0.419; TCGA ESCA -0.387; TCGA LUAD -0.184; TCGA LUSC -0.56; TCGA OV -0.193; TCGA PRAD -0.775; TCGA SARC -0.196; TCGA THCA -0.316; TCGA STAD -0.388; TCGA UCEC -0.312 |
hsa-miR-200c-3p | BBX | 9 cancers: BLCA; BRCA; COAD; ESCA; LGG; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.055; TCGA BRCA -0.053; TCGA COAD -0.067; TCGA ESCA -0.071; TCGA LGG -0.056; TCGA PRAD -0.251; TCGA SARC -0.055; TCGA STAD -0.147; TCGA UCEC -0.072 |
hsa-miR-200c-3p | MEX3B | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.212; TCGA BRCA -0.066; TCGA CESC -0.23; TCGA COAD -0.386; TCGA ESCA -0.217; TCGA KIRC -0.142; TCGA KIRP -0.061; TCGA LGG -0.361; TCGA LUAD -0.097; TCGA OV -0.318; TCGA PAAD -0.246; TCGA PRAD -0.085; TCGA THCA -0.225; TCGA STAD -0.167; TCGA UCEC -0.219 |
hsa-miR-200c-3p | WASF1 | 11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; OV; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.089; TCGA BRCA -0.128; TCGA COAD -0.296; TCGA KIRC -0.117; TCGA KIRP -0.062; TCGA LGG -0.297; TCGA LUAD -0.275; TCGA OV -0.171; TCGA PAAD -0.189; TCGA THCA -0.111; TCGA STAD -0.436 |
hsa-miR-200c-3p | ADAMTS3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.413; TCGA BRCA -0.379; TCGA CESC -0.378; TCGA COAD -0.584; TCGA ESCA -0.252; TCGA HNSC -0.27; TCGA KIRP -0.173; TCGA LUAD -0.234; TCGA LUSC -0.435; TCGA PAAD -0.548; TCGA STAD -0.223; TCGA UCEC -0.254 |
hsa-miR-200c-3p | PRDM1 | 11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.102; TCGA BRCA -0.082; TCGA CESC -0.112; TCGA COAD -0.158; TCGA KIRC -0.349; TCGA LUAD -0.207; TCGA LUSC -0.315; TCGA PAAD -0.314; TCGA PRAD -0.303; TCGA THCA -0.209; TCGA UCEC -0.194 |
hsa-miR-200c-3p | ARHGEF17 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.236; TCGA BRCA -0.078; TCGA CESC -0.178; TCGA COAD -0.551; TCGA ESCA -0.292; TCGA HNSC -0.173; TCGA KIRC -0.075; TCGA LGG -0.116; TCGA LUSC -0.441; TCGA PAAD -0.184; TCGA PRAD -0.417; TCGA STAD -0.364; TCGA UCEC -0.135 |
hsa-miR-200c-3p | FGF18 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.257; TCGA BRCA -0.298; TCGA CESC -0.26; TCGA ESCA -0.2; TCGA HNSC -0.491; TCGA LUSC -0.955; TCGA PAAD -0.315; TCGA PRAD -0.388; TCGA THCA -0.697; TCGA STAD -0.154 |
hsa-miR-200c-3p | ZFHX4 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.601; TCGA BRCA -0.513; TCGA CESC -0.488; TCGA COAD -1.27; TCGA ESCA -0.439; TCGA HNSC -0.36; TCGA LGG -0.109; TCGA LIHC -0.102; TCGA LUAD -0.357; TCGA OV -0.375; TCGA PAAD -0.442; TCGA PRAD -0.22; TCGA THCA -0.423; TCGA STAD -0.559; TCGA UCEC -0.42 |
hsa-miR-200c-3p | ARL2BP | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.1; TCGA CESC -0.124; TCGA COAD -0.066; TCGA ESCA -0.087; TCGA KIRC -0.084; TCGA KIRP -0.076; TCGA LUAD -0.066; TCGA LUSC -0.107; TCGA OV -0.067; TCGA PAAD -0.104; TCGA PRAD -0.148; TCGA STAD -0.113; TCGA UCEC -0.112 |
hsa-miR-200c-3p | HCFC2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.125; TCGA BRCA -0.164; TCGA CESC -0.121; TCGA COAD -0.191; TCGA ESCA -0.125; TCGA HNSC -0.172; TCGA LGG -0.147; TCGA LUAD -0.084; TCGA LUSC -0.233; TCGA PAAD -0.09; TCGA PRAD -0.192; TCGA SARC -0.056; TCGA STAD -0.252; TCGA UCEC -0.192 |
hsa-miR-200c-3p | GLIS2 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.315; TCGA BRCA -0.085; TCGA CESC -0.16; TCGA COAD -0.625; TCGA ESCA -0.251; TCGA HNSC -0.137; TCGA KIRP -0.125; TCGA LGG -0.214; TCGA LUAD -0.126; TCGA LUSC -0.407; TCGA OV -0.166; TCGA PAAD -0.178; TCGA PRAD -0.48; TCGA THCA -0.09; TCGA STAD -0.26; TCGA UCEC -0.211 |
hsa-miR-200c-3p | SLC16A2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.395; TCGA BRCA -0.228; TCGA CESC -0.476; TCGA COAD -0.549; TCGA ESCA -0.247; TCGA HNSC -0.381; TCGA LGG -0.07; TCGA LIHC -0.282; TCGA LUAD -0.321; TCGA LUSC -0.446; TCGA OV -0.207; TCGA PAAD -0.236; TCGA PRAD -0.477; TCGA STAD -0.289; TCGA UCEC -0.325 |
hsa-miR-200c-3p | PRKG1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.563; TCGA BRCA -0.393; TCGA CESC -0.601; TCGA COAD -0.536; TCGA ESCA -0.319; TCGA HNSC -0.436; TCGA LUAD -0.38; TCGA LUSC -0.818; TCGA OV -0.301; TCGA PAAD -0.205; TCGA PRAD -1.05; TCGA SARC -0.319; TCGA STAD -0.456; TCGA UCEC -0.579 |
hsa-miR-200c-3p | MITF | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.371; TCGA BRCA -0.382; TCGA CESC -0.299; TCGA COAD -0.785; TCGA ESCA -0.383; TCGA HNSC -0.402; TCGA KIRP -0.131; TCGA LUAD -0.243; TCGA LUSC -0.724; TCGA OV -0.127; TCGA PAAD -0.239; TCGA PRAD -0.469; TCGA SARC -0.278; TCGA STAD -0.36; TCGA UCEC -0.359 |
hsa-miR-200c-3p | SETD7 | 12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUSC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.161; TCGA BRCA -0.226; TCGA CESC -0.081; TCGA HNSC -0.136; TCGA KIRC -0.089; TCGA LGG -0.072; TCGA LIHC -0.098; TCGA LUSC -0.182; TCGA SARC -0.108; TCGA THCA -0.088; TCGA STAD -0.265; TCGA UCEC -0.29 |
hsa-miR-200c-3p | KLF10 | 11 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.184; TCGA BRCA -0.231; TCGA ESCA -0.139; TCGA HNSC -0.239; TCGA LUAD -0.143; TCGA LUSC -0.301; TCGA OV -0.123; TCGA PRAD -0.368; TCGA THCA -0.091; TCGA STAD -0.275; TCGA UCEC -0.124 |
hsa-miR-200c-3p | IFIT5 | 10 cancers: BLCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.13; TCGA HNSC -0.159; TCGA LGG -0.096; TCGA LUAD -0.132; TCGA LUSC -0.307; TCGA PAAD -0.088; TCGA PRAD -0.268; TCGA THCA -0.25; TCGA STAD -0.065; TCGA UCEC -0.065 |
hsa-miR-200c-3p | DACT1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.469; TCGA BRCA -0.215; TCGA CESC -0.474; TCGA COAD -0.48; TCGA ESCA -0.328; TCGA HNSC -0.534; TCGA LUAD -0.347; TCGA LUSC -0.624; TCGA OV -0.344; TCGA PAAD -0.211; TCGA PRAD -0.512; TCGA STAD -0.235; TCGA UCEC -0.318 |
hsa-miR-200c-3p | DMD | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.53; TCGA BRCA -0.594; TCGA CESC -0.282; TCGA COAD -0.538; TCGA ESCA -0.374; TCGA HNSC -0.292; TCGA LIHC -0.13; TCGA LUSC -0.345; TCGA PRAD -0.714; TCGA SARC -0.263; TCGA THCA -0.263; TCGA STAD -0.651; TCGA UCEC -0.385 |
hsa-miR-200c-3p | DNAJB9 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; UCEC | miRNATAP | TCGA BLCA -0.091; TCGA CESC -0.078; TCGA ESCA -0.067; TCGA HNSC -0.067; TCGA KIRC -0.104; TCGA KIRP -0.092; TCGA LIHC -0.121; TCGA LUSC -0.236; TCGA SARC -0.051; TCGA UCEC -0.061 |
hsa-miR-200c-3p | MBNL1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.147; TCGA BRCA -0.205; TCGA CESC -0.083; TCGA COAD -0.063; TCGA ESCA -0.11; TCGA HNSC -0.057; TCGA KIRC -0.086; TCGA LUAD -0.068; TCGA LUSC -0.112; TCGA PAAD -0.177; TCGA PRAD -0.251; TCGA SARC -0.13; TCGA THCA -0.159; TCGA STAD -0.225; TCGA UCEC -0.157 |
hsa-miR-200c-3p | HIVEP3 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.205; TCGA CESC -0.243; TCGA COAD -0.224; TCGA ESCA -0.163; TCGA HNSC -0.201; TCGA KIRC -0.065; TCGA LUAD -0.281; TCGA LUSC -0.441; TCGA OV -0.128; TCGA PAAD -0.078; TCGA PRAD -0.06; TCGA STAD -0.098; TCGA UCEC -0.098 |
hsa-miR-200c-3p | RPS6KA2 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.129; TCGA BRCA -0.281; TCGA CESC -0.185; TCGA COAD -0.283; TCGA ESCA -0.15; TCGA HNSC -0.247; TCGA LGG -0.073; TCGA LUSC -0.666; TCGA STAD -0.189; TCGA UCEC -0.131 |
hsa-miR-200c-3p | TEAD1 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.193; TCGA BRCA -0.302; TCGA COAD -0.128; TCGA ESCA -0.108; TCGA HNSC -0.169; TCGA LGG -0.179; TCGA LUAD -0.19; TCGA LUSC -0.105; TCGA PRAD -0.434; TCGA SARC -0.067; TCGA STAD -0.339; TCGA UCEC -0.168 |
hsa-miR-200c-3p | SNAI2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.183; TCGA BRCA -0.287; TCGA CESC -0.366; TCGA COAD -0.418; TCGA ESCA -0.203; TCGA HNSC -0.134; TCGA LIHC -0.133; TCGA LUAD -0.454; TCGA OV -0.38; TCGA PAAD -0.295; TCGA PRAD -0.697; TCGA THCA -0.485; TCGA STAD -0.159; TCGA UCEC -0.42 |
hsa-miR-200c-3p | KCNK2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.502; TCGA BRCA -0.204; TCGA COAD -1.279; TCGA ESCA -0.353; TCGA HNSC -0.418; TCGA LGG -0.136; TCGA LUAD -0.522; TCGA PAAD -0.36; TCGA PRAD -0.713; TCGA STAD -0.716; TCGA UCEC -0.214 |
hsa-miR-200c-3p | NDST1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.122; TCGA BRCA -0.108; TCGA CESC -0.132; TCGA COAD -0.166; TCGA ESCA -0.087; TCGA HNSC -0.183; TCGA LIHC -0.05; TCGA LUAD -0.075; TCGA LUSC -0.322; TCGA OV -0.088; TCGA PAAD -0.105; TCGA STAD -0.125; TCGA UCEC -0.081 |
hsa-miR-200c-3p | PDE7B | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.079; TCGA BRCA -0.435; TCGA CESC -0.4; TCGA COAD -0.565; TCGA ESCA -0.383; TCGA HNSC -0.393; TCGA LIHC -0.073; TCGA LUSC -0.468; TCGA OV -0.339; TCGA PAAD -0.337; TCGA PRAD -0.513; TCGA SARC -0.158; TCGA STAD -0.624; TCGA UCEC -0.43 |
hsa-miR-200c-3p | CNTN4 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.19; TCGA BRCA -0.354; TCGA CESC -0.472; TCGA COAD -0.699; TCGA ESCA -0.384; TCGA HNSC -0.443; TCGA KIRP -0.181; TCGA LGG -0.395; TCGA LUSC -0.842; TCGA OV -0.362; TCGA PAAD -0.194; TCGA PRAD -0.303; TCGA SARC -0.264; TCGA STAD -0.317; TCGA UCEC -0.41 |
hsa-miR-200c-3p | MFAP5 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.904; TCGA BRCA -0.505; TCGA CESC -0.544; TCGA COAD -1.36; TCGA ESCA -0.819; TCGA HNSC -0.541; TCGA LUAD -0.73; TCGA LUSC -0.601; TCGA PAAD -0.488; TCGA PRAD -0.721; TCGA SARC -0.466; TCGA THCA -1.49; TCGA STAD -0.612; TCGA UCEC -0.49 |
hsa-miR-200c-3p | PAM | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD | miRNATAP | TCGA BLCA -0.267; TCGA BRCA -0.255; TCGA CESC -0.144; TCGA COAD -0.214; TCGA ESCA -0.223; TCGA HNSC -0.206; TCGA KIRC -0.078; TCGA LUAD -0.11; TCGA LUSC -0.291; TCGA PRAD -0.321; TCGA STAD -0.246 |
hsa-miR-200c-3p | NCS1 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.305; TCGA CESC -0.249; TCGA COAD -0.445; TCGA ESCA -0.371; TCGA HNSC -0.075; TCGA LUAD -0.345; TCGA PAAD -0.196; TCGA PRAD -0.508; TCGA SARC -0.106; TCGA STAD -0.597; TCGA UCEC -0.217 |
hsa-miR-200c-3p | ERRFI1 | 10 cancers: BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BRCA -0.138; TCGA ESCA -0.177; TCGA HNSC -0.139; TCGA KIRC -0.167; TCGA LUAD -0.229; TCGA LUSC -0.308; TCGA OV -0.204; TCGA PRAD -0.158; TCGA STAD -0.257; TCGA UCEC -0.09 |
hsa-miR-200c-3p | FLT1 | 12 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BRCA -0.256; TCGA CESC -0.22; TCGA COAD -0.228; TCGA HNSC -0.155; TCGA KIRC -0.304; TCGA LGG -0.107; TCGA LUAD -0.101; TCGA LUSC -0.369; TCGA OV -0.153; TCGA PRAD -0.204; TCGA SARC -0.102; TCGA UCEC -0.15 |
hsa-miR-200c-3p | NTF3 | 9 cancers: BRCA; CESC; COAD; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRNATAP | TCGA BRCA -0.406; TCGA CESC -0.267; TCGA COAD -0.225; TCGA LUAD -0.208; TCGA PAAD -0.272; TCGA PRAD -0.521; TCGA THCA -0.417; TCGA STAD -0.156; TCGA UCEC -0.178 |
hsa-miR-200c-3p | LCA5 | 9 cancers: BRCA; CESC; COAD; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.236; TCGA CESC -0.124; TCGA COAD -0.409; TCGA LUAD -0.107; TCGA LUSC -0.145; TCGA PRAD -0.374; TCGA SARC -0.142; TCGA STAD -0.175; TCGA UCEC -0.213 |
hsa-miR-200c-3p | KLHL29 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.489; TCGA ESCA -0.177; TCGA KIRC -0.062; TCGA KIRP -0.087; TCGA LUAD -0.24; TCGA LUSC -0.163; TCGA PRAD -0.325; TCGA THCA -0.232; TCGA STAD -0.306; TCGA UCEC -0.207 |
hsa-miR-200c-3p | SYNJ1 | 11 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.082; TCGA CESC -0.08; TCGA ESCA -0.064; TCGA HNSC -0.094; TCGA LGG -0.113; TCGA LUAD -0.126; TCGA LUSC -0.247; TCGA PRAD -0.119; TCGA SARC -0.068; TCGA STAD -0.062; TCGA UCEC -0.14 |
hsa-miR-200c-3p | TMEM43 | 16 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.155; TCGA CESC -0.153; TCGA COAD -0.108; TCGA ESCA -0.109; TCGA HNSC -0.059; TCGA KIRC -0.061; TCGA KIRP -0.112; TCGA LUAD -0.148; TCGA LUSC -0.099; TCGA OV -0.074; TCGA PAAD -0.089; TCGA PRAD -0.209; TCGA SARC -0.099; TCGA THCA -0.097; TCGA STAD -0.204; TCGA UCEC -0.194 |
hsa-miR-200c-3p | EXOG | 10 cancers: BRCA; ESCA; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; STAD | MirTarget | TCGA BRCA -0.079; TCGA ESCA -0.087; TCGA KIRP -0.075; TCGA LGG -0.072; TCGA LUAD -0.083; TCGA LUSC -0.07; TCGA OV -0.074; TCGA PAAD -0.102; TCGA SARC -0.052; TCGA STAD -0.123 |
hsa-miR-200c-3p | FIGN | 11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; STAD | MirTarget | TCGA BRCA -0.366; TCGA COAD -0.849; TCGA ESCA -0.337; TCGA HNSC -0.425; TCGA KIRC -0.079; TCGA KIRP -0.124; TCGA LGG -0.1; TCGA LUSC -0.407; TCGA PRAD -0.234; TCGA THCA -0.255; TCGA STAD -0.458 |
hsa-miR-200c-3p | KANK1 | 10 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.286; TCGA CESC -0.211; TCGA HNSC -0.16; TCGA LGG -0.209; TCGA LIHC -0.064; TCGA LUSC -0.127; TCGA PRAD -0.406; TCGA SARC -0.24; TCGA STAD -0.152; TCGA UCEC -0.155 |
hsa-miR-200c-3p | RAPGEF2 | 10 cancers: BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUSC; OV; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.203; TCGA CESC -0.091; TCGA HNSC -0.176; TCGA KIRC -0.053; TCGA LGG -0.119; TCGA LIHC -0.084; TCGA LUSC -0.424; TCGA OV -0.071; TCGA STAD -0.087; TCGA UCEC -0.074 |
hsa-miR-200c-3p | SESN1 | 9 cancers: BRCA; CESC; HNSC; LGG; LUSC; PAAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.201; TCGA CESC -0.112; TCGA HNSC -0.103; TCGA LGG -0.125; TCGA LUSC -0.266; TCGA PAAD -0.247; TCGA SARC -0.121; TCGA STAD -0.079; TCGA UCEC -0.136 |
hsa-miR-200c-3p | KIAA0355 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.182; TCGA CESC -0.08; TCGA COAD -0.077; TCGA ESCA -0.123; TCGA HNSC -0.096; TCGA LUAD -0.056; TCGA LUSC -0.212; TCGA PAAD -0.091; TCGA STAD -0.115; TCGA UCEC -0.129 |
hsa-miR-200c-3p | PHACTR2 | 10 cancers: BRCA; CESC; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.25; TCGA CESC -0.118; TCGA HNSC -0.156; TCGA LUAD -0.083; TCGA LUSC -0.492; TCGA OV -0.103; TCGA PAAD -0.179; TCGA PRAD -0.264; TCGA STAD -0.069; TCGA UCEC -0.137 |
hsa-miR-200c-3p | TRHDE | 9 cancers: BRCA; CESC; HNSC; LGG; LUAD; LUSC; OV; PRAD; UCEC | MirTarget | TCGA BRCA -0.97; TCGA CESC -0.65; TCGA HNSC -0.821; TCGA LGG -0.521; TCGA LUAD -0.379; TCGA LUSC -1.292; TCGA OV -0.325; TCGA PRAD -0.853; TCGA UCEC -0.579 |
hsa-miR-200c-3p | MARCKS | 11 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; THCA; UCEC | MirTarget | TCGA BRCA -0.059; TCGA COAD -0.118; TCGA HNSC -0.117; TCGA KIRC -0.162; TCGA KIRP -0.092; TCGA LGG -0.278; TCGA LUAD -0.167; TCGA OV -0.126; TCGA PAAD -0.111; TCGA THCA -0.278; TCGA UCEC -0.093 |
hsa-miR-200c-3p | SLC6A1 | 12 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.108; TCGA CESC -0.44; TCGA COAD -0.37; TCGA HNSC -0.357; TCGA KIRC -0.306; TCGA LGG -0.424; TCGA LIHC -0.208; TCGA LUSC -0.599; TCGA OV -0.284; TCGA PRAD -0.271; TCGA STAD -0.144; TCGA UCEC -0.322 |
hsa-miR-200c-3p | PKIA | 10 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.362; TCGA COAD -0.693; TCGA ESCA -0.255; TCGA HNSC -0.493; TCGA LGG -0.276; TCGA LUAD -0.231; TCGA OV -0.373; TCGA PAAD -0.19; TCGA STAD -0.487; TCGA UCEC -0.342 |
hsa-miR-200c-3p | SASH1 | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.288; TCGA CESC -0.104; TCGA COAD -0.175; TCGA ESCA -0.106; TCGA HNSC -0.187; TCGA LGG -0.165; TCGA LUSC -0.37; TCGA PAAD -0.207; TCGA SARC -0.12; TCGA STAD -0.199; TCGA UCEC -0.119 |
hsa-miR-200c-3p | KCND2 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.285; TCGA CESC -0.374; TCGA COAD -1.028; TCGA ESCA -0.359; TCGA HNSC -0.373; TCGA LGG -0.269; TCGA PAAD -0.267; TCGA PRAD -0.259; TCGA SARC -0.355; TCGA THCA -0.845; TCGA STAD -0.326; TCGA UCEC -0.282 |
hsa-miR-200c-3p | ARL15 | 11 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; UCEC | MirTarget | TCGA BRCA -0.219; TCGA CESC -0.15; TCGA ESCA -0.1; TCGA HNSC -0.126; TCGA LUAD -0.1; TCGA LUSC -0.167; TCGA OV -0.084; TCGA PAAD -0.095; TCGA PRAD -0.072; TCGA SARC -0.097; TCGA UCEC -0.167 |
hsa-miR-200c-3p | BHLHE41 | 11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BRCA -0.219; TCGA COAD -0.431; TCGA ESCA -0.185; TCGA HNSC -0.21; TCGA KIRC -0.431; TCGA KIRP -0.17; TCGA LUAD -0.407; TCGA LUSC -0.506; TCGA PRAD -0.167; TCGA SARC -0.122; TCGA STAD -0.192 |
hsa-miR-200c-3p | PAG1 | 10 cancers: BRCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; THCA; UCEC | MirTarget | TCGA BRCA -0.082; TCGA HNSC -0.223; TCGA KIRC -0.237; TCGA LGG -0.126; TCGA LUAD -0.234; TCGA LUSC -0.703; TCGA OV -0.115; TCGA PAAD -0.176; TCGA THCA -0.378; TCGA UCEC -0.087 |
hsa-miR-200c-3p | ZC3H12B | 9 cancers: BRCA; CESC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.262; TCGA CESC -0.258; TCGA LGG -0.291; TCGA LUAD -0.118; TCGA LUSC -0.402; TCGA PRAD -0.377; TCGA SARC -0.111; TCGA STAD -0.16; TCGA UCEC -0.362 |
hsa-miR-200c-3p | ZFAND5 | 9 cancers: BRCA; ESCA; HNSC; LGG; LIHC; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.152; TCGA ESCA -0.09; TCGA HNSC -0.061; TCGA LGG -0.101; TCGA LIHC -0.133; TCGA LUSC -0.112; TCGA PRAD -0.204; TCGA STAD -0.151; TCGA UCEC -0.069 |
hsa-miR-200c-3p | PDE10A | 9 cancers: BRCA; CESC; COAD; HNSC; LGG; LUSC; OV; STAD; UCEC | mirMAP | TCGA BRCA -0.261; TCGA CESC -0.304; TCGA COAD -0.475; TCGA HNSC -0.122; TCGA LGG -0.112; TCGA LUSC -0.219; TCGA OV -0.364; TCGA STAD -0.242; TCGA UCEC -0.389 |
hsa-miR-200c-3p | SHROOM4 | 12 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.346; TCGA CESC -0.308; TCGA ESCA -0.135; TCGA HNSC -0.299; TCGA LUAD -0.157; TCGA LUSC -0.785; TCGA OV -0.198; TCGA PAAD -0.269; TCGA PRAD -0.471; TCGA THCA -0.222; TCGA STAD -0.136; TCGA UCEC -0.17 |
hsa-miR-200c-3p | CHD9 | 10 cancers: BRCA; CESC; ESCA; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC | mirMAP; miRNATAP | TCGA BRCA -0.189; TCGA CESC -0.107; TCGA ESCA -0.064; TCGA LGG -0.199; TCGA LIHC -0.056; TCGA LUSC -0.126; TCGA OV -0.058; TCGA PRAD -0.214; TCGA STAD -0.117; TCGA UCEC -0.171 |
hsa-miR-200c-3p | CAMK1D | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; STAD | mirMAP | TCGA BRCA -0.104; TCGA ESCA -0.3; TCGA KIRC -0.132; TCGA LGG -0.07; TCGA LIHC -0.111; TCGA LUAD -0.211; TCGA PAAD -0.227; TCGA PRAD -0.572; TCGA STAD -0.348 |
hsa-miR-200c-3p | BMPR2 | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.137; TCGA CESC -0.079; TCGA COAD -0.144; TCGA ESCA -0.087; TCGA HNSC -0.109; TCGA LGG -0.122; TCGA LUAD -0.095; TCGA LUSC -0.279; TCGA PRAD -0.133; TCGA STAD -0.123; TCGA UCEC -0.138 |
hsa-miR-200c-3p | VGLL3 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.489; TCGA CESC -0.346; TCGA COAD -0.897; TCGA ESCA -0.468; TCGA HNSC -0.468; TCGA LUAD -0.345; TCGA LUSC -0.914; TCGA OV -0.269; TCGA PAAD -0.369; TCGA PRAD -0.41; TCGA SARC -0.365; TCGA THCA -0.715; TCGA STAD -0.451; TCGA UCEC -0.598 |
hsa-miR-200c-3p | PRTG | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.293; TCGA CESC -0.493; TCGA COAD -0.718; TCGA ESCA -0.204; TCGA HNSC -0.333; TCGA LGG -0.25; TCGA LUSC -0.818; TCGA OV -0.412; TCGA PAAD -0.334; TCGA STAD -0.46; TCGA UCEC -0.406 |
hsa-miR-200c-3p | YPEL2 | 9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.148; TCGA ESCA -0.112; TCGA HNSC -0.112; TCGA KIRC -0.084; TCGA KIRP -0.084; TCGA LUSC -0.299; TCGA SARC -0.084; TCGA STAD -0.095; TCGA UCEC -0.136 |
hsa-miR-200c-3p | SCN5A | 9 cancers: BRCA; CESC; COAD; HNSC; LUAD; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.405; TCGA CESC -0.261; TCGA COAD -0.488; TCGA HNSC -0.476; TCGA LUAD -0.286; TCGA OV -0.221; TCGA PRAD -0.758; TCGA STAD -0.287; TCGA UCEC -0.162 |
hsa-miR-200c-3p | NLGN4X | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.429; TCGA CESC -0.479; TCGA COAD -0.741; TCGA ESCA -0.347; TCGA HNSC -0.394; TCGA LGG -0.127; TCGA LUAD -0.258; TCGA LUSC -0.25; TCGA OV -0.248; TCGA PAAD -0.522; TCGA PRAD -0.37; TCGA THCA -0.433; TCGA STAD -0.496; TCGA UCEC -0.156 |
hsa-miR-200c-3p | IRS1 | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; OV; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.177; TCGA CESC -0.328; TCGA COAD -0.341; TCGA ESCA -0.135; TCGA HNSC -0.219; TCGA LGG -0.095; TCGA LIHC -0.186; TCGA LUAD -0.279; TCGA OV -0.208; TCGA PRAD -0.233; TCGA SARC -0.146; TCGA STAD -0.188; TCGA UCEC -0.306 |
hsa-miR-200c-3p | SLC38A2 | 10 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BRCA -0.091; TCGA CESC -0.085; TCGA HNSC -0.091; TCGA LGG -0.086; TCGA LIHC -0.118; TCGA LUAD -0.085; TCGA PRAD -0.05; TCGA SARC -0.057; TCGA THCA -0.148; TCGA UCEC -0.088 |
hsa-miR-200c-3p | SLC23A2 | 9 cancers: BRCA; CESC; COAD; ESCA; LGG; LIHC; OV; STAD; UCEC | miRNATAP | TCGA BRCA -0.138; TCGA CESC -0.123; TCGA COAD -0.156; TCGA ESCA -0.089; TCGA LGG -0.163; TCGA LIHC -0.178; TCGA OV -0.081; TCGA STAD -0.15; TCGA UCEC -0.252 |
hsa-miR-200c-3p | SLC14A1 | 9 cancers: BRCA; CESC; ESCA; HNSC; LUSC; OV; PRAD; SARC; STAD | miRNATAP | TCGA BRCA -0.347; TCGA CESC -0.235; TCGA ESCA -0.367; TCGA HNSC -0.376; TCGA LUSC -0.857; TCGA OV -0.248; TCGA PRAD -0.767; TCGA SARC -0.233; TCGA STAD -0.231 |
hsa-miR-200c-3p | GATA2 | 10 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.162; TCGA COAD -0.369; TCGA ESCA -0.258; TCGA HNSC -0.177; TCGA LGG -0.114; TCGA LUSC -0.527; TCGA OV -0.217; TCGA PAAD -0.225; TCGA STAD -0.198; TCGA UCEC -0.126 |
hsa-miR-200c-3p | CITED2 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.131; TCGA CESC -0.147; TCGA COAD -0.182; TCGA ESCA -0.208; TCGA HNSC -0.142; TCGA LUSC -0.514; TCGA SARC -0.12; TCGA STAD -0.288; TCGA UCEC -0.295 |
hsa-miR-200c-3p | OSR1 | 13 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.443; TCGA CESC -0.224; TCGA COAD -0.921; TCGA ESCA -0.365; TCGA KIRC -0.129; TCGA KIRP -0.196; TCGA LUSC -0.351; TCGA OV -0.299; TCGA PAAD -0.499; TCGA PRAD -0.489; TCGA THCA -0.876; TCGA STAD -0.443; TCGA UCEC -0.448 |
hsa-miR-200c-3p | NR2F2 | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.06; TCGA CESC -0.183; TCGA COAD -0.171; TCGA ESCA -0.148; TCGA HNSC -0.08; TCGA LUSC -0.17; TCGA OV -0.079; TCGA PAAD -0.16; TCGA PRAD -0.135; TCGA STAD -0.214; TCGA UCEC -0.276 |
hsa-miR-200c-3p | MBNL2 | 10 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.222; TCGA CESC -0.119; TCGA ESCA -0.165; TCGA HNSC -0.186; TCGA LIHC -0.059; TCGA LUSC -0.396; TCGA OV -0.071; TCGA PRAD -0.493; TCGA STAD -0.154; TCGA UCEC -0.216 |
hsa-miR-200c-3p | SLC38A4 | 9 cancers: BRCA; CESC; HNSC; LIHC; OV; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BRCA -0.439; TCGA CESC -0.541; TCGA HNSC -0.366; TCGA LIHC -0.157; TCGA OV -0.168; TCGA PRAD -0.527; TCGA SARC -0.347; TCGA THCA -0.632; TCGA UCEC -0.293 |
hsa-miR-200c-3p | FOXF2 | 11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; THCA; STAD | miRNATAP | TCGA BRCA -0.161; TCGA COAD -0.475; TCGA ESCA -0.325; TCGA HNSC -0.112; TCGA KIRC -0.266; TCGA LGG -0.18; TCGA LUAD -0.269; TCGA LUSC -0.19; TCGA PRAD -0.517; TCGA THCA -0.225; TCGA STAD -0.513 |
hsa-miR-200c-3p | PPP1R9B | 11 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; UCEC | MirTarget | TCGA CESC -0.059; TCGA COAD -0.073; TCGA HNSC -0.101; TCGA KIRC -0.137; TCGA KIRP -0.09; TCGA LGG -0.092; TCGA LUAD -0.095; TCGA LUSC -0.132; TCGA OV -0.128; TCGA PAAD -0.101; TCGA UCEC -0.069 |
hsa-miR-200c-3p | MTSS1L | 10 cancers: CESC; COAD; ESCA; LGG; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA CESC -0.101; TCGA COAD -0.168; TCGA ESCA -0.157; TCGA LGG -0.256; TCGA OV -0.144; TCGA PRAD -0.263; TCGA SARC -0.116; TCGA THCA -0.072; TCGA STAD -0.308; TCGA UCEC -0.105 |
hsa-miR-200c-3p | PHTF2 | 11 cancers: COAD; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.091; TCGA ESCA -0.125; TCGA HNSC -0.12; TCGA KIRC -0.051; TCGA LGG -0.057; TCGA LUAD -0.12; TCGA PAAD -0.144; TCGA PRAD -0.131; TCGA THCA -0.17; TCGA STAD -0.06; TCGA UCEC -0.073 |
hsa-miR-200c-3p | MAPK7 | 10 cancers: ESCA; HNSC; KIRC; KIRP; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA ESCA -0.062; TCGA HNSC -0.053; TCGA KIRC -0.089; TCGA KIRP -0.063; TCGA OV -0.105; TCGA PAAD -0.107; TCGA PRAD -0.145; TCGA SARC -0.058; TCGA STAD -0.11; TCGA UCEC -0.097 |
Enriched cancer pathways of putative targets