microRNA information: hsa-miR-200c-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-200c-5p | miRbase |
| Accession: | MIMAT0004657 | miRbase |
| Precursor name: | hsa-mir-200c | miRbase |
| Precursor accession: | MI0000650 | miRbase |
| Symbol: | MIR200C | HGNC |
| RefSeq ID: | NR_029779 | GenBank |
| Sequence: | CGUCUUACCCAGCAGUGUUUGG |
Reported expression in cancers: hsa-miR-200c-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-200c-5p | bladder cancer | upregulation | "MicroRNA expression signatures of bladder cancer r ......" | 21464941 | RNA-Seq |
| hsa-miR-200c-5p | bladder cancer | deregulation | "In other recruited 17 patients with BUC who were d ......" | 22886973 | Reverse transcription PCR; Microarray |
| hsa-miR-200c-5p | bladder cancer | downregulation | "MicroRNA-200c miR-200c is one of the short noncodi ......" | 25367080 | Reverse transcription PCR; qPCR |
| hsa-miR-200c-5p | bladder cancer | downregulation | "Moreover miR-155 was downregulated whereas miR-200 ......" | 26927195 | |
| hsa-miR-200c-5p | bladder cancer | upregulation | "MiR-200c exhibits a disordered expression in many ......" | 27574450 | Reverse transcription PCR |
| hsa-miR-200c-5p | breast cancer | downregulation | "Down regulation of microRNA 200c is associated wit ......" | 22101791 | qPCR |
| hsa-miR-200c-5p | breast cancer | downregulation | "The expression profiles of miR-9 miR-21 miR-30a mi ......" | 25013435 | Reverse transcription PCR |
| hsa-miR-200c-5p | breast cancer | downregulation | "Circulating miR 200c and miR 141 and outcomes in p ......" | 25885099 | Reverse transcription PCR |
| hsa-miR-200c-5p | breast cancer | downregulation | "Expression levels of miR-200a miR-200b miR-200c mi ......" | 26201425 | qPCR |
| hsa-miR-200c-5p | breast cancer | downregulation | "The microRNA miR-200c is involved in the tumorigen ......" | 26392416 | qPCR; Microarray; in situ hybridization |
| hsa-miR-200c-5p | colorectal cancer | upregulation | "The increased expression of miR-200c miR-221 and m ......" | 21873159 | |
| hsa-miR-200c-5p | colorectal cancer | upregulation | "Furthermore PZH treatment upregulated the expressi ......" | 25422078 | |
| hsa-miR-200c-5p | endometrial cancer | upregulation | "We evaluated the differential expressions of miRNA ......" | 21035172 | Microarray |
| hsa-miR-200c-5p | endometrial cancer | upregulation | "Increased expression of miR-200c was recently repo ......" | 22015043 | qPCR |
| hsa-miR-200c-5p | esophageal cancer | upregulation | "Circulating miR 200c levels significantly predict ......" | 23838916 | qPCR |
| hsa-miR-200c-5p | gastric cancer | downregulation | "miR 200b and miR 200c as prognostic factors and me ......" | 23995857 | qPCR; Microarray |
| hsa-miR-200c-5p | gastric cancer | downregulation | "Here we report that the miR-200 family members miR ......" | 25502084 | |
| hsa-miR-200c-5p | gastric cancer | downregulation | "Serum miR 200c expression level as a prognostic bi ......" | 26662382 | qPCR |
| hsa-miR-200c-5p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-200c-5p | kidney renal cell cancer | downregulation | "Genome wide microRNA expression profiling in renal ......" | 18925646 | Microarray; qPCR |
| hsa-miR-200c-5p | kidney renal cell cancer | downregulation | "We analyzed 70 matched pairs of clear cell renal c ......" | 21784468 | qPCR; Microarray |
| hsa-miR-200c-5p | kidney renal cell cancer | downregulation | "microRNA 200c modulates the epithelial to mesenchy ......" | 23754305 | Microarray |
| hsa-miR-200c-5p | kidney renal cell cancer | downregulation | "In this study miRNA expression profiles were deter ......" | 26248649 | Microarray |
| hsa-miR-200c-5p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
| hsa-miR-200c-5p | liver cancer | downregulation | "The expressions of miR-200c and miR-141 were downr ......" | 24135722 | |
| hsa-miR-200c-5p | lung cancer | upregulation | "High expression of serum miR 21 and tumor miR 200c ......" | 21516486 | Microarray; Reverse transcription PCR; qPCR |
| hsa-miR-200c-5p | lung squamous cell cancer | downregulation | "Loss of miR 200c expression induces an aggressive ......" | 20696752 | |
| hsa-miR-200c-5p | lung squamous cell cancer | downregulation | "The ectopic miR-200c increased the radiosensitivit ......" | 24205206 | |
| hsa-miR-200c-5p | melanoma | downregulation | "Differential expression of microRNAs during melano ......" | 22223089 | Microarray |
| hsa-miR-200c-5p | melanoma | downregulation | "miR 200c inhibits melanoma progression and drug re ......" | 22982443 | |
| hsa-miR-200c-5p | ovarian cancer | downregulation | "Association between miR 200c and the survival of p ......" | 21345725 | Reverse transcription PCR; qPCR; Microarray |
| hsa-miR-200c-5p | ovarian cancer | downregulation | "Restoration of miR 200c to ovarian cancer reduces ......" | 23074172 | |
| hsa-miR-200c-5p | pancreatic cancer | upregulation | "MicroRNA hsa miR 200c is an independent prognostic ......" | 20579395 | |
| hsa-miR-200c-5p | pancreatic cancer | upregulation | "miR 139 and miR 200c regulate pancreatic cancer en ......" | 25955258 | Microarray; qPCR |
| hsa-miR-200c-5p | pancreatic cancer | upregulation | "MicroRNA 200c as a Prognostic Biomarker for Pancre ......" | 26493507 | |
| hsa-miR-200c-5p | prostate cancer | downregulation | "Consequently miR-200c was downregulated in ERG-pos ......" | 24186205 | |
| hsa-miR-200c-5p | prostate cancer | downregulation | "Among them 10 paired HGPIN and PCa were prepared t ......" | 27017949 | qPCR; Microarray |
Reported cancer pathway affected by hsa-miR-200c-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-200c-5p | breast cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "miR 200c at the nexus of epithelial mesenchymal tr ......" | 21682933 | |
| hsa-miR-200c-5p | breast cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c represses migration and invasion of ......" | 22144583 | |
| hsa-miR-200c-5p | breast cancer | Epithelial mesenchymal transition pathway; Apoptosis pathway | "miR 200c enhances radiosensitivity of human breast ......" | 22991189 | |
| hsa-miR-200c-5p | breast cancer | Apoptosis pathway | "In addition our analysis showed inverse expression ......" | 24039897 | Luciferase |
| hsa-miR-200c-5p | breast cancer | Epithelial mesenchymal transition pathway | "miR 200c inhibits metastasis of breast cancer cell ......" | 24710933 | Luciferase; Western blot; Transwell assay; Wound Healing Assay |
| hsa-miR-200c-5p | breast cancer | Apoptosis pathway | "microRNA 200c downregulates XIAP expression to sup ......" | 24821285 | Luciferase; Western blot |
| hsa-miR-200c-5p | breast cancer | Epithelial mesenchymal transition pathway | "Overexpression of microRNA 200c predicts poor outc ......" | 25329395 | |
| hsa-miR-200c-5p | colon cancer | Apoptosis pathway | "The roles of miR 200c in colon cancer and associat ......" | 24682933 | Western blot |
| hsa-miR-200c-5p | colon cancer | Apoptosis pathway | "By performing MTT wound-healing and Transwell migr ......" | 27460529 | Flow cytometry; Cell migration assay |
| hsa-miR-200c-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "Induction of epithelial mesenchymal transition and ......" | 25757925 | |
| hsa-miR-200c-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "The analysis of microRNAs miR 200C and miR 145 exp ......" | 26335822 | |
| hsa-miR-200c-5p | esophageal cancer | PI3K/Akt signaling pathway | "Overexpression of miR 200c induces chemoresistance ......" | 21248297 | Western blot |
| hsa-miR-200c-5p | gastric cancer | Apoptosis pathway | "Enhancement of radiotherapy efficacy by miR 200c l ......" | 24872697 | |
| hsa-miR-200c-5p | gastric cancer | Epithelial mesenchymal transition pathway | "Ubiquitin ligase Cbl b represses IGF I induced epi ......" | 24885194 | |
| hsa-miR-200c-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c attenuates tumour growth and metasta ......" | 21294122 | Luciferase |
| hsa-miR-200c-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "Among several miRNAs in which the expression was a ......" | 21899661 | |
| hsa-miR-200c-5p | head and neck cancer | Epithelial mesenchymal transition pathway | "In addition miR-21 let-7 miR-107 miR-138 and miR-2 ......" | 23340306 | |
| hsa-miR-200c-5p | kidney renal cell cancer | Apoptosis pathway | "MiR 200c sensitizes clear cell renal cell carcinom ......" | 25150313 | |
| hsa-miR-200c-5p | kidney renal cell cancer | cell cycle pathway | "miR 200c Targets CDK2 and Suppresses Tumorigenesis ......" | 26248649 | Luciferase |
| hsa-miR-200c-5p | lung cancer | cell cycle pathway; Apoptosis pathway | "Over expression of miR 200c suppresses invasion an ......" | 27432063 | Western blot |
| hsa-miR-200c-5p | lung cancer | Apoptosis pathway | "Electroneutral composite polymersomes self assembl ......" | 27541441 | |
| hsa-miR-200c-5p | lung cancer | Epithelial mesenchymal transition pathway | "miR 200c regulates crizotinib resistant ALK positi ......" | 27666124 | Luciferase |
| hsa-miR-200c-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 | Luciferase; Western blot; Cell migration assay |
| hsa-miR-200c-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Growing evidence indicates that miR-200c is involv ......" | 24997798 | Luciferase; Western blot |
| hsa-miR-200c-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c inhibits the metastasis of non small ......" | 26935975 | Luciferase; Western blot |
| hsa-miR-200c-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c overexpression inhibits tumorigenici ......" | 23842108 | |
| hsa-miR-200c-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "Both resistant variants display a strong epithelia ......" | 26025631 | |
| hsa-miR-200c-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Cell cycle distribution and apoptosis were examine ......" | 19112422 | Flow cytometry |
| hsa-miR-200c-5p | pancreatic cancer | Epithelial mesenchymal transition pathway | "MicroRNA 200c overexpression plays an inhibitory r ......" | 26081037 | Colony formation |
| hsa-miR-200c-5p | prostate cancer | cell cycle pathway | "Furthermore miR-200c served as an important mediat ......" | 25017995 | Western blot; Luciferase |
| hsa-miR-200c-5p | prostate cancer | Epithelial mesenchymal transition pathway | "Effects of miR 200c on the migration and invasion ......" | 25363395 | Cell migration assay; Western blot |
| hsa-miR-200c-5p | prostate cancer | Apoptosis pathway | "Regulation of miR 200c and miR 141 by Methylation ......" | 27198154 | |
| hsa-miR-200c-5p | sarcoma | cell cycle pathway | "The regulatory function of miR 200c on inflammator ......" | 25305131 | Western blot |
Reported cancer prognosis affected by hsa-miR-200c-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-200c-5p | B cell lymphoma | poor survival | "High expression of microRNA 200c predicts poor cli ......" | 23232598 | |
| hsa-miR-200c-5p | bladder cancer | staging; progression | "Moreover we report that miR-200c expression is sig ......" | 20473948 | |
| hsa-miR-200c-5p | bladder cancer | progression; tumorigenesis | "miR 200c inhibits invasion migration and prolifera ......" | 25367080 | Western blot; Luciferase |
| hsa-miR-200c-5p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-200c-5p | bladder cancer | cell migration | "MiR 200c promotes bladder cancer cell migration an ......" | 27574450 | Transwell assay; Luciferase; Western blot |
| hsa-miR-200c-5p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
| hsa-miR-200c-5p | breast cancer | progression | "Recent evidence demonstrates that up-regulation of ......" | 19839049 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "miR 200c at the nexus of epithelial mesenchymal tr ......" | 21682933 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "Down regulation of microRNA 200c is associated wit ......" | 22101791 | Flow cytometry |
| hsa-miR-200c-5p | breast cancer | cell migration; drug resistance; metastasis | "MicroRNA 200c represses migration and invasion of ......" | 22144583 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "miR 200c targets a NF κB up regulated TrkB/NTF3 a ......" | 23185507 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "miR 200c sensitizes breast cancer cells to doxorub ......" | 23209748 | |
| hsa-miR-200c-5p | breast cancer | cell migration | "Analysis of the miRNA expression identified 11 miR ......" | 23497265 | |
| hsa-miR-200c-5p | breast cancer | metastasis | "It has been reported that microRNA-200c miRNA-200c ......" | 23546450 | |
| hsa-miR-200c-5p | breast cancer | metastasis | "Overexpressions of microRNA 9 and microRNA 200c in ......" | 23617747 | |
| hsa-miR-200c-5p | breast cancer | cell migration; drug resistance | "Previously we reported that the expression of miR- ......" | 23626803 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "In addition our analysis showed inverse expression ......" | 24039897 | Luciferase |
| hsa-miR-200c-5p | breast cancer | metastasis; drug resistance | "MiR 200c suppresses TGF β signaling and counterac ......" | 24615544 | |
| hsa-miR-200c-5p | breast cancer | metastasis; progression | "miR 200c inhibits metastasis of breast cancer cell ......" | 24710933 | Luciferase; Western blot; Transwell assay; Wound Healing Assay |
| hsa-miR-200c-5p | breast cancer | metastasis | "Induction of the mesenchymal to epithelial transit ......" | 24729530 | |
| hsa-miR-200c-5p | breast cancer | metastasis | "The expression profiles of miR-9 miR-21 miR-30a mi ......" | 25013435 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "MiR 200c inhibits autophagy and enhances radiosens ......" | 25044403 | |
| hsa-miR-200c-5p | breast cancer | cell migration; poor survival; metastasis; recurrence; staging | "Overexpression of microRNA 200c predicts poor outc ......" | 25329395 | |
| hsa-miR-200c-5p | breast cancer | metastasis | "BRCA mutations cause reduction in miR 200c express ......" | 25445393 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-200c-5p | breast cancer | motility | "Expression of miR 200c in claudin low breast cance ......" | 25746005 | |
| hsa-miR-200c-5p | breast cancer | staging; progression; poor survival | "Circulating miR 200c and miR 141 and outcomes in p ......" | 25885099 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
| hsa-miR-200c-5p | breast cancer | drug resistance | "Furthermore several studies have documented that s ......" | 26310899 | |
| hsa-miR-200c-5p | breast cancer | progression; tumorigenesis; poor survival | "miR 200c inhibits breast cancer proliferation by t ......" | 26392416 | Luciferase |
| hsa-miR-200c-5p | breast cancer | tumorigenesis | "Essential role of miR 200c in regulating self rene ......" | 26400441 | Western blot; Luciferase |
| hsa-miR-200c-5p | breast cancer | metastasis | "These included miR-141 miR-144 miR-193b miR-200a m ......" | 26785733 | |
| hsa-miR-200c-5p | breast cancer | metastasis | "We evaluated the expression levels of miR-21 miR-1 ......" | 27197674 | |
| hsa-miR-200c-5p | breast cancer | cell migration | "Another study suggested that ERM expression was re ......" | 27276064 | Transwell assay; Wound Healing Assay |
| hsa-miR-200c-5p | breast cancer | poor survival | "In this multicenter study a 10-miRNA classifier in ......" | 27566954 | |
| hsa-miR-200c-5p | breast cancer | metastasis | "Epigenetic Silencing of miR 200c in Breast Cancer ......" | 27717206 | |
| hsa-miR-200c-5p | colon cancer | tumorigenesis | "To further investigate the in vivo biological sign ......" | 18172508 | |
| hsa-miR-200c-5p | colon cancer | metastasis | "miR 200c inhibits invasion and migration in human ......" | 22407310 | |
| hsa-miR-200c-5p | colon cancer | worse prognosis; metastasis; poor survival; staging | "The roles of miR 200c in colon cancer and associat ......" | 24682933 | Western blot |
| hsa-miR-200c-5p | colorectal cancer | poor survival | "Ten miRNAs hsa-let-7b hsa-let-7g hsa-miR-15b hsa-m ......" | 18079988 | |
| hsa-miR-200c-5p | colorectal cancer | metastasis | "Applying real-time PCR we detected the expression ......" | 21827717 | |
| hsa-miR-200c-5p | colorectal cancer | progression | "The quantitative analysis by stem loop real time P ......" | 22562822 | |
| hsa-miR-200c-5p | colorectal cancer | metastasis | "MicroRNA 200c modulates epithelial to mesenchymal ......" | 22735571 | |
| hsa-miR-200c-5p | colorectal cancer | metastasis; staging; worse prognosis; recurrence | "Serum miR 200c is a novel prognostic and metastasi ......" | 23982750 | |
| hsa-miR-200c-5p | colorectal cancer | staging; poor survival | "Tumor tissue samples were obtained from 127 surgic ......" | 24510588 | |
| hsa-miR-200c-5p | colorectal cancer | metastasis | "Regulation of colorectal carcinoma stemness growth ......" | 24658157 | Luciferase |
| hsa-miR-200c-5p | colorectal cancer | drug resistance | "Induction of epithelial mesenchymal transition and ......" | 25757925 | |
| hsa-miR-200c-5p | colorectal cancer | metastasis | "Investigating intra tumor heterogeneity and expres ......" | 27565378 | |
| hsa-miR-200c-5p | esophageal cancer | drug resistance; poor survival | "Overexpression of miR 200c induces chemoresistance ......" | 21248297 | Western blot |
| hsa-miR-200c-5p | esophageal cancer | worse prognosis; drug resistance; progression; poor survival | "Circulating miR 200c levels significantly predict ......" | 23838916 | |
| hsa-miR-200c-5p | gastric cancer | staging; progression; poor survival; metastasis | "Circulating miR 200c as a diagnostic and prognosti ......" | 22954417 | |
| hsa-miR-200c-5p | gastric cancer | drug resistance | "MicroRNA 200c regulates the sensitivity of chemoth ......" | 23821457 | Luciferase; Western blot |
| hsa-miR-200c-5p | gastric cancer | progression; worse prognosis; staging; metastasis; poor survival | "miR 200b and miR 200c as prognostic factors and me ......" | 23995857 | Luciferase; Cell proliferation assay; Cell migration assay; Cell Proliferation Assay |
| hsa-miR-200c-5p | gastric cancer | poor survival | "RNA and protein expression were analyzed by RT-PCR ......" | 24352645 | |
| hsa-miR-200c-5p | gastric cancer | drug resistance | "Enhancement of radiotherapy efficacy by miR 200c l ......" | 24872697 | |
| hsa-miR-200c-5p | gastric cancer | staging; poor survival | "Here we report that the miR-200 family members miR ......" | 25502084 | Wound Healing Assay |
| hsa-miR-200c-5p | gastric cancer | staging; metastasis | "In the first step of this study preliminary experi ......" | 26233325 | |
| hsa-miR-200c-5p | gastric cancer | poor survival; staging; worse prognosis | "Serum miR 200c expression level as a prognostic bi ......" | 26662382 | |
| hsa-miR-200c-5p | gastric cancer | progression; tumorigenesis | "Epigenetically deregulated miR 200c is involved in ......" | 27498672 | Luciferase |
| hsa-miR-200c-5p | head and neck cancer | metastasis; malignant trasformation; poor survival | "MicroRNA 200c attenuates tumour growth and metasta ......" | 21294122 | Luciferase |
| hsa-miR-200c-5p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-200c-5p | kidney papillary renal cell cancer | staging; poor survival; progression | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-200c-5p | kidney renal cell cancer | metastasis; malignant trasformation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
| hsa-miR-200c-5p | kidney renal cell cancer | metastasis | "microRNA 200c modulates the epithelial to mesenchy ......" | 23754305 | |
| hsa-miR-200c-5p | kidney renal cell cancer | drug resistance | "MiR 200c sensitizes clear cell renal cell carcinom ......" | 25150313 | |
| hsa-miR-200c-5p | kidney renal cell cancer | drug resistance | "Loss of miR 200c up regulates CYP1B1 and confers d ......" | 25860934 | |
| hsa-miR-200c-5p | kidney renal cell cancer | poor survival | "Using vote-counting strategy and robust rank aggre ......" | 25974855 | |
| hsa-miR-200c-5p | kidney renal cell cancer | tumorigenesis; progression | "miR 200c Targets CDK2 and Suppresses Tumorigenesis ......" | 26248649 | Luciferase |
| hsa-miR-200c-5p | kidney renal cell cancer | metastasis | "In addition miR-200c can partly reverse the MALAT1 ......" | 26461224 | |
| hsa-miR-200c-5p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
| hsa-miR-200c-5p | liver cancer | poor survival | "The expressions of miR-200c and miR-141 were downr ......" | 24135722 | |
| hsa-miR-200c-5p | lung cancer | worse prognosis; poor survival | "High expression of serum miR 21 and tumor miR 200c ......" | 21516486 | |
| hsa-miR-200c-5p | lung cancer | drug resistance | "Therapeutic delivery of miR 200c enhances radiosen ......" | 24791940 | |
| hsa-miR-200c-5p | lung cancer | drug resistance; cell migration | "Over expression of miR 200c suppresses invasion an ......" | 27432063 | Western blot |
| hsa-miR-200c-5p | lung cancer | drug resistance | "Electroneutral composite polymersomes self assembl ......" | 27541441 | |
| hsa-miR-200c-5p | lung squamous cell cancer | metastasis; differentiation | "Loss of miR 200c expression induces an aggressive ......" | 20696752 | |
| hsa-miR-200c-5p | lung squamous cell cancer | poor survival | "Using a linear combination of the miR CT values wi ......" | 24007627 | |
| hsa-miR-200c-5p | lung squamous cell cancer | poor survival | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 | Luciferase; Western blot; Cell migration assay |
| hsa-miR-200c-5p | lung squamous cell cancer | progression; tumorigenesis; metastasis; staging | "Growing evidence indicates that miR-200c is involv ......" | 24997798 | Luciferase; Western blot |
| hsa-miR-200c-5p | lung squamous cell cancer | staging; poor survival; cell migration | "miR 141 and miR 200c as markers of overall surviva ......" | 25003366 | |
| hsa-miR-200c-5p | lung squamous cell cancer | worse prognosis; poor survival; tumor size | "Expression of microRNA miR 126 and miR 200c is ass ......" | 25124149 | |
| hsa-miR-200c-5p | lung squamous cell cancer | progression; poor survival; staging | "miR 200c overexpression is associated with better ......" | 25277203 | |
| hsa-miR-200c-5p | lung squamous cell cancer | metastasis; malignant trasformation; progression | "MicroRNA 200c inhibits the metastasis of non small ......" | 26935975 | Luciferase; Western blot |
| hsa-miR-200c-5p | lung squamous cell cancer | poor survival | "The 3-miRNA panel expression miR-192 miR-200c and ......" | 27153322 | |
| hsa-miR-200c-5p | melanoma | progression; staging | "Differential expression of microRNAs during melano ......" | 22223089 | Colony formation |
| hsa-miR-200c-5p | melanoma | metastasis | "Here we demonstrate a significant correlation betw ......" | 22956368 | |
| hsa-miR-200c-5p | melanoma | progression; drug resistance; metastasis | "miR 200c inhibits melanoma progression and drug re ......" | 22982443 | |
| hsa-miR-200c-5p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
| hsa-miR-200c-5p | ovarian cancer | drug resistance | "In a well-characterized series of 72 ovarian carci ......" | 21051560 | |
| hsa-miR-200c-5p | ovarian cancer | staging; poor survival | "Association between miR 200c and the survival of p ......" | 21345725 | |
| hsa-miR-200c-5p | ovarian cancer | staging; worse prognosis; drug resistance; progression | "Restoration of miR 200c to ovarian cancer reduces ......" | 23074172 | |
| hsa-miR-200c-5p | ovarian cancer | worse prognosis; drug resistance | "MiR 200c and HuR in ovarian cancer; This study ass ......" | 23394580 | |
| hsa-miR-200c-5p | ovarian cancer | metastasis | "MicroRNA 200c overexpression inhibits tumorigenici ......" | 23842108 | |
| hsa-miR-200c-5p | ovarian cancer | progression | "The aberrant expression of the miR-200 family miR- ......" | 24952258 | |
| hsa-miR-200c-5p | ovarian cancer | poor survival; progression | "Expression levels of members in the miR-200 family ......" | 24966949 | |
| hsa-miR-200c-5p | ovarian cancer | metastasis; staging; cell migration | "miR 200c modulates ovarian cancer cell metastasis ......" | 25052237 | Luciferase; Western blot |
| hsa-miR-200c-5p | ovarian cancer | staging; poor survival; worse prognosis | "MicroRNA 200c and microRNA 141 as potential diagno ......" | 25636451 | |
| hsa-miR-200c-5p | ovarian cancer | drug resistance | "Both resistant variants display a strong epithelia ......" | 26025631 | |
| hsa-miR-200c-5p | ovarian cancer | progression; metastasis; worse prognosis; poor survival | "Expression of serum miR 200a miR 200b and miR 200c ......" | 26063644 | |
| hsa-miR-200c-5p | ovarian cancer | poor survival; metastasis | "MicroRNA 200c and microRNA 31 regulate proliferati ......" | 26260454 | Colony formation |
| hsa-miR-200c-5p | ovarian cancer | progression; poor survival | "Subgroup analysis revealed that there was a signif ......" | 26910180 | |
| hsa-miR-200c-5p | ovarian cancer | malignant trasformation; staging; metastasis; poor survival; progression | "Diagnostic and prognostic relevance of circulating ......" | 26943577 | |
| hsa-miR-200c-5p | ovarian cancer | metastasis | "miR 200c Regulation of Metastases in Ovarian Cance ......" | 27601996 | |
| hsa-miR-200c-5p | ovarian cancer | malignant trasformation | "Circulating Cell Free miR 373 miR 200a miR 200b an ......" | 27753009 | |
| hsa-miR-200c-5p | pancreatic cancer | poor survival; worse prognosis | "MicroRNA hsa miR 200c is an independent prognostic ......" | 20579395 | |
| hsa-miR-200c-5p | pancreatic cancer | cell migration | "miR 139 and miR 200c regulate pancreatic cancer en ......" | 25955258 | |
| hsa-miR-200c-5p | pancreatic cancer | tumorigenesis; drug resistance | "MicroRNA 200c overexpression plays an inhibitory r ......" | 26081037 | Colony formation |
| hsa-miR-200c-5p | pancreatic cancer | drug resistance; poor survival | "MicroRNA 200c overexpression inhibits chemoresista ......" | 26261532 | Colony formation |
| hsa-miR-200c-5p | pancreatic cancer | poor survival; worse prognosis | "MicroRNA 200c as a Prognostic Biomarker for Pancre ......" | 26493507 | |
| hsa-miR-200c-5p | prostate cancer | drug resistance | "To distinguish the presence of cancer stem cell li ......" | 22768203 | Flow cytometry |
| hsa-miR-200c-5p | prostate cancer | drug resistance | "Epithelial to mesenchymal transition leads to doce ......" | 23041061 | |
| hsa-miR-200c-5p | prostate cancer | tumorigenesis; cell migration; motility | "TMPRSS2 ERG gene fusions induce prostate tumorigen ......" | 24186205 | |
| hsa-miR-200c-5p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-200c-5p | prostate cancer | progression | "Furthermore miR-200c served as an important mediat ......" | 25017995 | Western blot; Luciferase |
| hsa-miR-200c-5p | sarcoma | progression | "The regulatory function of miR 200c on inflammator ......" | 25305131 | Western blot |
| hsa-miR-200c-5p | sarcoma | metastasis; progression | "miR 200c and phospho AKT as prognostic factors and ......" | 27155790 |
Reported gene related to hsa-miR-200c-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-200c-5p | bladder cancer | CDH1 | "miR-200c over-expression resulted in conspicuous d ......" | 25367080 |
| hsa-miR-200c-5p | breast cancer | CDH1 | "Overexpression of miR-200c enhanced the expression ......" | 24754877 |
| hsa-miR-200c-5p | breast cancer | CDH1 | "This chromatin modifications were paralleled by an ......" | 27717206 |
| hsa-miR-200c-5p | breast cancer | CDH1 | "MicroRNA-200c miR-200c has been shown to suppress ......" | 22144583 |
| hsa-miR-200c-5p | breast cancer | CDH1 | "We investigated the expressions of miR-9 and miR-2 ......" | 23617747 |
| hsa-miR-200c-5p | colorectal cancer | CDH1 | "Overexpression of miR-200c in CRC cell lines cause ......" | 22735571 |
| hsa-miR-200c-5p | gastric cancer | CDH1 | "We also found that miR-200c and miR-141 directly t ......" | 25502084 |
| hsa-miR-200c-5p | head and neck cancer | CDH1 | "Accordingly the enforced expression of miR-200c an ......" | 24424572 |
| hsa-miR-200c-5p | kidney renal cell cancer | CDH1 | "Overexpression of miR-200c in SN12-PM6 and 786-0 c ......" | 23754305 |
| hsa-miR-200c-5p | lung squamous cell cancer | CDH1 | "Reintroduction of miR-200c into highly invasive/ag ......" | 20696752 |
| hsa-miR-200c-5p | melanoma | CDH1 | "In addition miR-200c overexpression significantly ......" | 22982443 |
| hsa-miR-200c-5p | ovarian cancer | CDH1 | "However the stable overexpression of the miR-200c ......" | 23842108 |
| hsa-miR-200c-5p | ovarian cancer | CDH1 | "Overexpression of miR-200c regulated E-cadherin an ......" | 25052237 |
| hsa-miR-200c-5p | pancreatic cancer | CDH1 | "Especially the expression of miR-200c has been sho ......" | 20579395 |
| hsa-miR-200c-5p | sarcoma | CDH1 | "Transient transfection of RMS cells with a miR-200 ......" | 23000453 |
| hsa-miR-200c-5p | breast cancer | ZEB1 | "miR-200c has been shown to regulate the epithelial ......" | 24710933 |
| hsa-miR-200c-5p | breast cancer | ZEB1 | "MiR 200c suppresses TGF β signaling and counterac ......" | 24615544 |
| hsa-miR-200c-5p | breast cancer | ZEB1 | "Of this family miR-200c has garnered particular at ......" | 21682933 |
| hsa-miR-200c-5p | breast cancer | ZEB1 | "Epigenetic Silencing of miR 200c in Breast Cancer ......" | 27717206 |
| hsa-miR-200c-5p | breast cancer | ZEB1 | "Concomitant with the increase in miR-200b and miR- ......" | 23626803 |
| hsa-miR-200c-5p | colon cancer | ZEB1 | "miR 200c inhibits invasion and migration in human ......" | 22407310 |
| hsa-miR-200c-5p | head and neck cancer | ZEB1 | "Accordingly the enforced expression of miR-200c an ......" | 24424572 |
| hsa-miR-200c-5p | kidney renal cell cancer | ZEB1 | "Overexpression of miR-200c in SN12-PM6 and 786-0 c ......" | 23754305 |
| hsa-miR-200c-5p | lung cancer | ZEB1 | "miR 200c regulates crizotinib resistant ALK positi ......" | 27666124 |
| hsa-miR-200c-5p | prostate cancer | ZEB1 | "Furthermore miR-200c was found to be important in ......" | 24186205 |
| hsa-miR-200c-5p | breast cancer | ZEB2 | "miR-200c has been shown to regulate the epithelial ......" | 24710933 |
| hsa-miR-200c-5p | breast cancer | ZEB2 | "Of this family miR-200c has garnered particular at ......" | 21682933 |
| hsa-miR-200c-5p | gastric cancer | ZEB2 | "Two gastric cancer cell lines were treated with IG ......" | 24885194 |
| hsa-miR-200c-5p | kidney renal cell cancer | ZEB2 | "We established by quantitative RT-PCR that in CCCs ......" | 18925646 |
| hsa-miR-200c-5p | lung squamous cell cancer | ZEB2 | "MicroRNA 200c inhibits the metastasis of non small ......" | 26935975 |
| hsa-miR-200c-5p | ovarian cancer | ZEB2 | "miR 200c modulates ovarian cancer cell metastasis ......" | 25052237 |
| hsa-miR-200c-5p | breast cancer | BMI1 | "miR 200c sensitizes breast cancer cells to doxorub ......" | 23209748 |
| hsa-miR-200c-5p | breast cancer | BMI1 | "Expression of BMI1 a known regulator of stem cell ......" | 19665978 |
| hsa-miR-200c-5p | breast cancer | BMI1 | "MiR-200c and miR-203 overexpression in breast canc ......" | 24039897 |
| hsa-miR-200c-5p | head and neck cancer | BMI1 | "In this study the expression of miR200c in the reg ......" | 21294122 |
| hsa-miR-200c-5p | breast cancer | VIM | "Overexpression of miR-200c enhanced the expression ......" | 24754877 |
| hsa-miR-200c-5p | colorectal cancer | VIM | "Overexpression of miR-200c in CRC cell lines cause ......" | 22735571 |
| hsa-miR-200c-5p | ovarian cancer | VIM | "However the stable overexpression of the miR-200c ......" | 23842108 |
| hsa-miR-200c-5p | ovarian cancer | VIM | "Overexpression of miR-200c regulated E-cadherin an ......" | 25052237 |
| hsa-miR-200c-5p | breast cancer | KRAS | "miR 200c inhibits breast cancer proliferation by t ......" | 26392416 |
| hsa-miR-200c-5p | colorectal cancer | KRAS | "Oncogenic KRAS regulates miR 200c and miR 221/222 ......" | 21873159 |
| hsa-miR-200c-5p | colorectal cancer | KRAS | "We previously found that oncogenic KRAS induces in ......" | 22641662 |
| hsa-miR-200c-5p | colon cancer | TP53 | "In conclusion miR-200c functions as an oncogene in ......" | 24682933 |
| hsa-miR-200c-5p | colorectal cancer | TP53 | "Sequencing analysis revealed that hsa-miR-181b p = ......" | 18079988 |
| hsa-miR-200c-5p | lung cancer | TP53 | "RT-PCR and Western blot assays showed that the exp ......" | 27432063 |
| hsa-miR-200c-5p | gastric cancer | DNMT3A | "Epigenetically deregulated miR 200c is involved in ......" | 27498672 |
| hsa-miR-200c-5p | prostate cancer | DNMT3A | "The biological significance of miR-200c and miR-14 ......" | 27198154 |
| hsa-miR-200c-5p | bladder cancer | E2F3 | "miR 200c inhibits invasion migration and prolifera ......" | 25367080 |
| hsa-miR-200c-5p | prostate cancer | E2F3 | "Furthermore miR-200c served as an important mediat ......" | 25017995 |
| hsa-miR-200c-5p | glioblastoma | EGFR | "Correlation between EGFR amplification and the exp ......" | 25058589 |
| hsa-miR-200c-5p | lung squamous cell cancer | EGFR | "miR 200c overexpression is associated with better ......" | 25277203 |
| hsa-miR-200c-5p | lung cancer | EZH2 | "Furthermore miR-200c overexpression significantly ......" | 27432063 |
| hsa-miR-200c-5p | prostate cancer | EZH2 | "Furthermore miR-200c served as an important mediat ......" | 25017995 |
| hsa-miR-200c-5p | ovarian cancer | MUC16 | "The increased levels of miR-200b and miR-200c were ......" | 26943577 |
| hsa-miR-200c-5p | pancreatic cancer | MUC16 | "MicroRNA 200c modulates the expression of MUC4 and ......" | 24204560 |
| hsa-miR-200c-5p | breast cancer | NTRK2 | "miR 200c sensitizes breast cancer cells to doxorub ......" | 23209748 |
| hsa-miR-200c-5p | ovarian cancer | NTRK2 | "miR-200c also targets TrkB a mediator of resistanc ......" | 23074172 |
| hsa-miR-200c-5p | breast cancer | PDCD10 | "Furthermore miR-200c negatively regulated programm ......" | 26400441 |
| hsa-miR-200c-5p | breast cancer | PDCD10 | "Through dual-luciferase method it was verified tha ......" | 25566594 |
| hsa-miR-200c-5p | breast cancer | PRDX2 | "Demethylating agent 5-aza-2'-deoxycytidine 5-aza-d ......" | 23626803 |
| hsa-miR-200c-5p | lung cancer | PRDX2 | "We found that miR-200c overexpression increased ce ......" | 24791940 |
| hsa-miR-200c-5p | colon cancer | PTEN | "In conclusion miR-200c functions as an oncogene in ......" | 24682933 |
| hsa-miR-200c-5p | pancreatic cancer | PTEN | "Forced over-expression or silencing of miR-200c fo ......" | 22637745 |
| hsa-miR-200c-5p | bladder cancer | RECK | "MiR 200c promotes bladder cancer cell migration an ......" | 27574450 |
| hsa-miR-200c-5p | lung cancer | RECK | "Finally we demonstrated that expression of miR-200 ......" | 24647918 |
| hsa-miR-200c-5p | ovarian cancer | TUBB3 | "miR-200c increases sensitivity to taxanes in vitro ......" | 23074172 |
| hsa-miR-200c-5p | ovarian cancer | TUBB3 | "This study assessed the role of miR-200c as regula ......" | 23394580 |
| hsa-miR-200c-5p | breast cancer | VEGFA | "Analysis revealed a negative correlation between m ......" | 25445393 |
| hsa-miR-200c-5p | lung squamous cell cancer | VEGFA | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 |
| hsa-miR-200c-5p | lung cancer | ALK | "miR 200c regulates crizotinib resistant ALK positi ......" | 27666124 |
| hsa-miR-200c-5p | endometrial cancer | BRD7 | "The interactions between MicroRNA 200c and BRD7 in ......" | 22015043 |
| hsa-miR-200c-5p | colon cancer | CCL16 | "Loss of exosomal transferred miR-200c in resistant ......" | 25832648 |
| hsa-miR-200c-5p | gastric cancer | CD44 | "In addition to radioenhancement miR-200c nanoparti ......" | 24872697 |
| hsa-miR-200c-5p | lung squamous cell cancer | CDH2 | "Reintroduction of miR-200c into highly invasive/ag ......" | 20696752 |
| hsa-miR-200c-5p | kidney renal cell cancer | CDK2 | "miR 200c Targets CDK2 and Suppresses Tumorigenesis ......" | 26248649 |
| hsa-miR-200c-5p | breast cancer | CFL2 | "We characterized one of the target genes of miR-20 ......" | 23497265 |
| hsa-miR-200c-5p | kidney renal cell cancer | CYP1B1 | "Loss of miR 200c up regulates CYP1B1 and confers d ......" | 25860934 |
| hsa-miR-200c-5p | lung squamous cell cancer | DCR | "In 66 NSCLC patients with wild-type EGFR high leve ......" | 25277203 |
| hsa-miR-200c-5p | B cell lymphoma | DDIT3 | "This study presents microRNA-200c expression data ......" | 23232598 |
| hsa-miR-200c-5p | breast cancer | DICER1 | "In contrast miR-200c which promotes an epithelial ......" | 21761362 |
| hsa-miR-200c-5p | prostate cancer | DNMT1 | "In PC3 cells miR-200c and miR-141 expression is su ......" | 27198154 |
| hsa-miR-200c-5p | prostate cancer | DUSP3 | "All patients with VHR PCa in the study had elevate ......" | 27601638 |
| hsa-miR-200c-5p | gastric cancer | EFNA1 | "G A variant in miR 200c binding site of EFNA1 alte ......" | 23065816 |
| hsa-miR-200c-5p | ovarian cancer | ELAVL1 | "MiR 200c and HuR in ovarian cancer; Crosslinking-c ......" | 23394580 |
| hsa-miR-200c-5p | prostate cancer | EPCAM | "Oppositely re-induction of the epithelial phenotyp ......" | 24992580 |
| hsa-miR-200c-5p | prostate cancer | ERG | "TMPRSS2 ERG gene fusions induce prostate tumorigen ......" | 24186205 |
| hsa-miR-200c-5p | breast cancer | ESR1 | "Further miR-200b and miR-200c overexpression sensi ......" | 23626803 |
| hsa-miR-200c-5p | breast cancer | ETV5 | "Another study suggested that ERM expression was re ......" | 27276064 |
| hsa-miR-200c-5p | breast cancer | FHOD1 | "MicroRNA 200c represses migration and invasion of ......" | 22144583 |
| hsa-miR-200c-5p | gastric cancer | GDF15 | "Circulating levels of GDF15 MMP7 and miR 200c as a ......" | 24947260 |
| hsa-miR-200c-5p | breast cancer | GLA | "Here we found that GLA attenuated the migratory an ......" | 24754877 |
| hsa-miR-200c-5p | ovarian cancer | HEY | "Stable overexpression of miR-200c was obtained in ......" | 23394580 |
| hsa-miR-200c-5p | head and neck cancer | HGF | "Among several miRNAs in which the expression was a ......" | 21899661 |
| hsa-miR-200c-5p | breast cancer | HMGB1 | "miR 200c inhibits metastasis of breast cancer cell ......" | 24710933 |
| hsa-miR-200c-5p | kidney renal cell cancer | HMOX1 | "MiR 200c sensitizes clear cell renal cell carcinom ......" | 25150313 |
| hsa-miR-200c-5p | gastric cancer | IGF1 | "Two gastric cancer cell lines were treated with IG ......" | 24885194 |
| hsa-miR-200c-5p | sarcoma | IKBKB | "Additionally gain-of-function of miR-200c through ......" | 25305131 |
| hsa-miR-200c-5p | sarcoma | IL8 | "Additionally gain-of-function of miR-200c through ......" | 25305131 |
| hsa-miR-200c-5p | lung squamous cell cancer | KDR | "MiR 200c increases the radiosensitivity of non sma ......" | 24205206 |
| hsa-miR-200c-5p | endometrial cancer | MALAT1 | "In the present study we first showed that miR-200c ......" | 27693631 |
| hsa-miR-200c-5p | breast cancer | MAP1LC3A | "In 35 human breast cancer tissue samples we detect ......" | 25044403 |
| hsa-miR-200c-5p | lung cancer | MAPK8 | "Finally we demonstrated that expression of miR-200 ......" | 24647918 |
| hsa-miR-200c-5p | melanoma | MARCKS | "Functional target identification studies suggest t ......" | 20957176 |
| hsa-miR-200c-5p | breast cancer | MKI67 | "The miR-200c levels were numerically higher in sta ......" | 25885099 |
| hsa-miR-200c-5p | pancreatic cancer | MMP14 | "Forced over-expression or silencing of miR-200c fo ......" | 22637745 |
| hsa-miR-200c-5p | gastric cancer | MMP7 | "Circulating levels of GDF15 MMP7 and miR 200c as a ......" | 24947260 |
| hsa-miR-200c-5p | pancreatic cancer | MUC4 | "MicroRNA 200c modulates the expression of MUC4 and ......" | 24204560 |
| hsa-miR-200c-5p | endometrial cancer | MYC | "MiR-200c regulated the translocation of β-catenin ......" | 22015043 |
| hsa-miR-200c-5p | breast cancer | NFASC | "miR 200c targets a NF κB up regulated TrkB/NTF3 a ......" | 23185507 |
| hsa-miR-200c-5p | lung squamous cell cancer | NOL3 | "The downstream regulating mechanism of miR-200c wa ......" | 24205206 |
| hsa-miR-200c-5p | gastric cancer | OS9 | "There was a correlation p = 0.016 with the num ......" | 22954417 |
| hsa-miR-200c-5p | gastric cancer | PAEP | "Enhancement of radiotherapy efficacy by miR 200c l ......" | 24872697 |
| hsa-miR-200c-5p | breast cancer | PDCD4 | "Through dual-luciferase method it was verified tha ......" | 25566594 |
| hsa-miR-200c-5p | breast cancer | PPM1F | "MicroRNA 200c represses migration and invasion of ......" | 22144583 |
| hsa-miR-200c-5p | esophageal cancer | PPP2R1B | "Western blotting showed that knockdown of miR-200c ......" | 21248297 |
| hsa-miR-200c-5p | gastric cancer | RND3 | "MicroRNA 200c regulates the sensitivity of chemoth ......" | 23821457 |
| hsa-miR-200c-5p | prostate cancer | SEC23A | "A computational analysis predicted the 3'-UTR of t ......" | 21593139 |
| hsa-miR-200c-5p | lung cancer | SESN1 | "We found that miR-200c overexpression increased ce ......" | 24791940 |
| hsa-miR-200c-5p | colorectal cancer | SOX2 | "Regulation of colorectal carcinoma stemness growth ......" | 24658157 |
| hsa-miR-200c-5p | breast cancer | TAM | "Further miR-200b and miR-200c overexpression sensi ......" | 23626803 |
| hsa-miR-200c-5p | breast cancer | TBK1 | "Additionally we found that miR-200c directly targe ......" | 22991189 |
| hsa-miR-200c-5p | prostate cancer | TMPRSS2 | "TMPRSS2 ERG gene fusions induce prostate tumorigen ......" | 24186205 |
| hsa-miR-200c-5p | sarcoma | TP63 | "The regulatory function of miR 200c on inflammator ......" | 25305131 |
| hsa-miR-200c-5p | breast cancer | UBQLN1 | "MiR 200c inhibits autophagy and enhances radiosens ......" | 25044403 |
| hsa-miR-200c-5p | lung squamous cell cancer | USP25 | "The functions of miR-200c and USP25 in migration/i ......" | 24997798 |
| hsa-miR-200c-5p | breast cancer | XIAP | "microRNA 200c downregulates XIAP expression to sup ......" | 24821285 |
| hsa-miR-200c-5p | breast cancer | ZNF217 | "MiR 200c suppresses TGF β signaling and counterac ......" | 24615544 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-200c-5p | PARM1 | 9 cancers: BLCA; BRCA; CESC; HNSC; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.215; TCGA BRCA -0.261; TCGA CESC -0.284; TCGA HNSC -0.245; TCGA LUSC -0.339; TCGA OV -0.144; TCGA PRAD -0.242; TCGA STAD -0.197; TCGA UCEC -0.362 |
hsa-miR-200c-5p | DTNA | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.663; TCGA CESC -0.345; TCGA COAD -0.787; TCGA ESCA -0.522; TCGA HNSC -0.584; TCGA LUAD -0.158; TCGA PRAD -0.434; TCGA STAD -0.748; TCGA UCEC -0.336 |
hsa-miR-200c-5p | RUNDC3B | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.173; TCGA BRCA -0.284; TCGA CESC -0.297; TCGA ESCA -0.193; TCGA HNSC -0.178; TCGA LUAD -0.219; TCGA LUSC -0.422; TCGA OV -0.145; TCGA PRAD -0.191; TCGA STAD -0.312; TCGA UCEC -0.329 |
hsa-miR-200c-5p | MEF2C | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.399; TCGA BRCA -0.26; TCGA CESC -0.425; TCGA COAD -0.304; TCGA ESCA -0.29; TCGA HNSC -0.527; TCGA LUAD -0.324; TCGA LUSC -0.557; TCGA OV -0.11; TCGA PAAD -0.304; TCGA PRAD -0.308; TCGA STAD -0.393; TCGA UCEC -0.377 |
hsa-miR-200c-5p | VASN | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD | MirTarget | TCGA BLCA -0.328; TCGA BRCA -0.132; TCGA CESC -0.202; TCGA COAD -0.326; TCGA ESCA -0.172; TCGA HNSC -0.108; TCGA LUAD -0.174; TCGA LUSC -0.429; TCGA PAAD -0.287; TCGA THCA -0.466; TCGA STAD -0.199 |
hsa-miR-200c-5p | MSRB3 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.702; TCGA BRCA -0.435; TCGA CESC -0.421; TCGA COAD -0.71; TCGA ESCA -0.556; TCGA HNSC -0.485; TCGA LUAD -0.44; TCGA LUSC -0.563; TCGA OV -0.331; TCGA PAAD -0.48; TCGA PRAD -0.509; TCGA THCA -0.15; TCGA STAD -0.753; TCGA UCEC -0.593 |
hsa-miR-200c-5p | CASQ2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -1.106; TCGA BRCA -0.576; TCGA CESC -0.404; TCGA COAD -1.486; TCGA ESCA -0.946; TCGA HNSC -0.865; TCGA LUAD -0.384; TCGA LUSC -0.718; TCGA PAAD -0.513; TCGA PRAD -0.682; TCGA STAD -1.249; TCGA UCEC -0.472 |
hsa-miR-200c-5p | COL11A1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; THCA | MirTarget; miRNATAP | TCGA BLCA -0.573; TCGA CESC -0.457; TCGA COAD -0.775; TCGA ESCA -0.542; TCGA HNSC -0.457; TCGA LUAD -0.41; TCGA OV -0.35; TCGA PAAD -1.193; TCGA THCA -2.009 |
hsa-miR-200c-5p | SEPT7 | 12 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.068; TCGA CESC -0.064; TCGA COAD -0.099; TCGA ESCA -0.068; TCGA LUAD -0.08; TCGA LUSC -0.061; TCGA OV -0.077; TCGA PAAD -0.061; TCGA PRAD -0.078; TCGA THCA -0.067; TCGA STAD -0.154; TCGA UCEC -0.13 |
hsa-miR-200c-5p | GNAO1 | 10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.621; TCGA CESC -0.25; TCGA COAD -0.707; TCGA ESCA -0.579; TCGA LUAD -0.192; TCGA LUSC -0.209; TCGA OV -0.244; TCGA PRAD -0.496; TCGA STAD -0.891; TCGA UCEC -0.439 |
hsa-miR-200c-5p | CACNB2 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.348; TCGA BRCA -0.125; TCGA CESC -0.306; TCGA ESCA -0.24; TCGA HNSC -0.251; TCGA LUSC -0.346; TCGA PRAD -0.196; TCGA STAD -0.648; TCGA UCEC -0.46 |
hsa-miR-200c-5p | ESAM | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | MirTarget | TCGA BLCA -0.155; TCGA BRCA -0.303; TCGA CESC -0.209; TCGA COAD -0.211; TCGA HNSC -0.245; TCGA LUAD -0.269; TCGA LUSC -0.526; TCGA OV -0.18; TCGA PAAD -0.253; TCGA PRAD -0.283; TCGA UCEC -0.255 |
hsa-miR-200c-5p | ATP1A2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.88; TCGA BRCA -0.824; TCGA CESC -0.652; TCGA COAD -1.287; TCGA ESCA -0.897; TCGA HNSC -0.952; TCGA LUAD -0.297; TCGA LUSC -0.822; TCGA PAAD -0.434; TCGA PRAD -0.59; TCGA THCA -0.224; TCGA STAD -1.249; TCGA UCEC -0.507 |
hsa-miR-200c-5p | ZNF365 | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.131; TCGA COAD -0.692; TCGA ESCA -0.502; TCGA LUAD -0.359; TCGA LUSC -0.282; TCGA PAAD -0.241; TCGA PRAD -0.275; TCGA THCA -0.472; TCGA STAD -0.538 |
hsa-miR-200c-5p | EML1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.327; TCGA BRCA -0.168; TCGA CESC -0.166; TCGA COAD -0.413; TCGA ESCA -0.336; TCGA HNSC -0.202; TCGA LUAD -0.204; TCGA LUSC -0.264; TCGA STAD -0.567; TCGA UCEC -0.182 |
hsa-miR-200c-5p | FAM110B | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.52; TCGA CESC -0.502; TCGA COAD -0.555; TCGA ESCA -0.267; TCGA HNSC -0.489; TCGA LUAD -0.18; TCGA LUSC -0.208; TCGA PAAD -0.119; TCGA THCA -0.16; TCGA STAD -0.363; TCGA UCEC -0.245 |
hsa-miR-200c-5p | SAMD4A | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.371; TCGA BRCA -0.333; TCGA CESC -0.237; TCGA COAD -0.232; TCGA ESCA -0.229; TCGA HNSC -0.241; TCGA LUAD -0.364; TCGA LUSC -0.465; TCGA PAAD -0.259; TCGA PRAD -0.262; TCGA THCA -0.381; TCGA STAD -0.433; TCGA UCEC -0.316 |
hsa-miR-200c-5p | PHLDB2 | 9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.233; TCGA BRCA -0.369; TCGA COAD -0.467; TCGA ESCA -0.434; TCGA LUAD -0.302; TCGA PRAD -0.085; TCGA THCA -0.478; TCGA STAD -0.53; TCGA UCEC -0.436 |
hsa-miR-200c-5p | POU6F1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.295; TCGA BRCA -0.241; TCGA CESC -0.181; TCGA COAD -0.228; TCGA ESCA -0.297; TCGA HNSC -0.354; TCGA LUAD -0.157; TCGA LUSC -0.333; TCGA OV -0.079; TCGA PAAD -0.191; TCGA STAD -0.493; TCGA UCEC -0.219 |
hsa-miR-200c-5p | SLIT3 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.363; TCGA BRCA -0.481; TCGA CESC -0.566; TCGA COAD -0.663; TCGA ESCA -0.34; TCGA HNSC -0.401; TCGA LUAD -0.45; TCGA LUSC -0.774; TCGA OV -0.175; TCGA PAAD -0.456; TCGA PRAD -0.421; TCGA STAD -0.482; TCGA UCEC -0.243 |
hsa-miR-200c-5p | PTPRT | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; THCA; STAD | mirMAP | TCGA BLCA -0.205; TCGA BRCA -0.311; TCGA CESC -0.362; TCGA COAD -0.505; TCGA ESCA -0.35; TCGA HNSC -0.253; TCGA LUAD -0.299; TCGA THCA -0.425; TCGA STAD -0.293 |
hsa-miR-200c-5p | CELF2 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.533; TCGA BRCA -0.288; TCGA CESC -0.307; TCGA ESCA -0.465; TCGA HNSC -0.294; TCGA LUAD -0.177; TCGA LUSC -0.567; TCGA OV -0.13; TCGA PAAD -0.316; TCGA PRAD -0.333; TCGA THCA -0.46; TCGA STAD -0.442; TCGA UCEC -0.305 |
hsa-miR-200c-5p | RUNX1T1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.651; TCGA BRCA -0.474; TCGA CESC -0.586; TCGA COAD -0.605; TCGA ESCA -0.514; TCGA HNSC -0.439; TCGA LUAD -0.281; TCGA LUSC -0.726; TCGA OV -0.374; TCGA PAAD -0.209; TCGA PRAD -0.19; TCGA STAD -0.617; TCGA UCEC -0.573 |
hsa-miR-200c-5p | MYH10 | 11 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.151; TCGA BRCA -0.137; TCGA COAD -0.415; TCGA ESCA -0.341; TCGA LUAD -0.206; TCGA LUSC -0.348; TCGA OV -0.154; TCGA PAAD -0.135; TCGA THCA -0.343; TCGA STAD -0.361; TCGA UCEC -0.133 |
hsa-miR-200c-5p | MAP1B | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.559; TCGA BRCA -0.272; TCGA CESC -0.313; TCGA COAD -0.493; TCGA ESCA -0.413; TCGA HNSC -0.273; TCGA LUAD -0.179; TCGA OV -0.156; TCGA PAAD -0.173; TCGA PRAD -0.367; TCGA THCA -0.139; TCGA STAD -0.64; TCGA UCEC -0.274 |
hsa-miR-200c-5p | TSHZ2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.217; TCGA BRCA -0.418; TCGA CESC -0.17; TCGA COAD -0.531; TCGA ESCA -0.244; TCGA LUAD -0.14; TCGA OV -0.123; TCGA PAAD -0.303; TCGA THCA -0.386; TCGA STAD -0.394; TCGA UCEC -0.14 |
hsa-miR-200c-5p | NRK | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.37; TCGA BRCA -0.293; TCGA CESC -0.53; TCGA COAD -1.033; TCGA ESCA -0.776; TCGA HNSC -0.586; TCGA LUAD -0.256; TCGA OV -0.315; TCGA PAAD -0.563; TCGA PRAD -0.526; TCGA THCA -1.094; TCGA STAD -0.902; TCGA UCEC -0.597 |
hsa-miR-200c-5p | RHOBTB1 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.112; TCGA BRCA -0.053; TCGA CESC -0.176; TCGA COAD -0.144; TCGA HNSC -0.345; TCGA LUSC -0.254; TCGA OV -0.11; TCGA PAAD -0.123; TCGA PRAD -0.177; TCGA STAD -0.101; TCGA UCEC -0.127 |
hsa-miR-200c-5p | CRTAC1 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.446; TCGA CESC -0.406; TCGA COAD -1.063; TCGA ESCA -0.557; TCGA HNSC -0.657; TCGA LUSC -0.474; TCGA PRAD -0.647; TCGA STAD -0.771; TCGA UCEC -0.255 |
Enriched cancer pathways of putative targets