microRNA information: hsa-miR-202-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-202-3p | miRbase |
Accession: | MIMAT0002811 | miRbase |
Precursor name: | hsa-mir-202 | miRbase |
Precursor accession: | MI0003130 | miRbase |
Symbol: | MIR202 | HGNC |
RefSeq ID: | NR_030170 | GenBank |
Sequence: | AGAGGUAUAGGGCAUGGGAA |
Reported expression in cancers: hsa-miR-202-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-202-3p | colorectal cancer | downregulation | "Here we focused on the function and molecular mech ......" | 24327274 | qPCR; Microarray |
hsa-miR-202-3p | gastric cancer | downregulation | "Decrease of miR 202 3p expression a novel tumor su ......" | 23936094 | |
hsa-miR-202-3p | liver cancer | downregulation | "In the current study we observed that microRNA-202 ......" | 24704686 | |
hsa-miR-202-3p | lung cancer | upregulation | "MiR-202 was significantly reduced in lung cancer t ......" | 27338052 | |
hsa-miR-202-3p | sarcoma | downregulation | "miR-202 has been confirmed to be downregulated in ......" | 25156120 |
Reported cancer pathway affected by hsa-miR-202-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-202-3p | gastric cancer | Apoptosis pathway | "Decrease of miR 202 3p expression a novel tumor su ......" | 23936094 | |
hsa-miR-202-3p | lung cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 202 induces cell cycle arrest and apoptos ......" | 27338052 | Western blot; Flow cytometry; Luciferase |
hsa-miR-202-3p | pancreatic cancer | Apoptosis pathway | "Down regulation of miR 202 modulates Mxd1 and Sin3 ......" | 25611699 | |
hsa-miR-202-3p | sarcoma | Apoptosis pathway | "miR 202 suppresses proliferation and induces apopt ......" | 25156120 | |
hsa-miR-202-3p | sarcoma | Apoptosis pathway | "TGF β1 induced miR 202 mediates drug resistance b ......" | 26276504 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-202-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-202-3p | breast cancer | poor survival; worse prognosis | "Circulating cell free cancer testis MAGE A RNA BOR ......" | 24983365 | |
hsa-miR-202-3p | cervical and endocervical cancer | progression | "miR 202 inhibits the progression of human cervical ......" | 27732565 | |
hsa-miR-202-3p | colorectal cancer | tumorigenesis | "microRNA 202 3p inhibits cell proliferation by tar ......" | 24327274 | Colony formation; Western blot; Luciferase |
hsa-miR-202-3p | liver cancer | progression; tumorigenesis | "miR 202 suppresses cell proliferation in human hep ......" | 24704686 | |
hsa-miR-202-3p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
hsa-miR-202-3p | sarcoma | progression; tumorigenesis | "miR 202 suppresses proliferation and induces apopt ......" | 25156120 | |
hsa-miR-202-3p | sarcoma | drug resistance | "TGF β1 induced miR 202 mediates drug resistance b ......" | 26276504 | Western blot; Luciferase |
Reported gene related to hsa-miR-202-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-202-3p | cervical and endocervical cancer | CCND1 | "miR 202 inhibits the progression of human cervical ......" | 27732565 |
hsa-miR-202-3p | lung cancer | CCND1 | "MicroRNA 202 induces cell cycle arrest and apoptos ......" | 27338052 |
hsa-miR-202-3p | cervical and endocervical cancer | PCNA | "miR 202 inhibits the progression of human cervical ......" | 27732565 |
hsa-miR-202-3p | lung cancer | PCNA | "MicroRNA 202 induces cell cycle arrest and apoptos ......" | 27338052 |
hsa-miR-202-3p | colorectal cancer | ARL5A | "miR-202-3p might function as a tumor suppressor in ......" | 24327274 |
hsa-miR-202-3p | gastric cancer | BCL2 | "MiR-202-3p also inhibited the expression of γ-cat ......" | 23936094 |
hsa-miR-202-3p | breast cancer | CTCFL | "Circulating cell free cancer testis MAGE A RNA BOR ......" | 24983365 |
hsa-miR-202-3p | esophageal cancer | CYLD | "Differentially expressed miRNA analysis selected f ......" | 25098614 |
hsa-miR-202-3p | gastric cancer | GLI1 | "We demonstrate that the transcriptional factor Gli ......" | 23936094 |
hsa-miR-202-3p | sarcoma | GLI2 | "miR 202 suppresses proliferation and induces apopt ......" | 25156120 |
hsa-miR-202-3p | liver cancer | LRP6 | "miR 202 suppresses cell proliferation in human hep ......" | 24704686 |
hsa-miR-202-3p | pancreatic cancer | MXD1 | "Down regulation of miR 202 modulates Mxd1 and Sin3 ......" | 25611699 |
hsa-miR-202-3p | sarcoma | PDCD4 | "Moreover relationships of miR-202 level with PDCD4 ......" | 26276504 |
hsa-miR-202-3p | pancreatic cancer | SIN3A | "Down regulation of miR 202 modulates Mxd1 and Sin3 ......" | 25611699 |
hsa-miR-202-3p | colorectal cancer | WDTC1 | "microRNA 202 3p inhibits cell proliferation by tar ......" | 24327274 |