microRNA information: hsa-miR-204-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-204-5p | miRbase |
Accession: | MIMAT0000265 | miRbase |
Precursor name: | hsa-mir-204 | miRbase |
Precursor accession: | MI0000284 | miRbase |
Symbol: | MIR204 | HGNC |
RefSeq ID: | NR_029621 | GenBank |
Sequence: | UUCCCUUUGUCAUCCUAUGCCU |
Reported expression in cancers: hsa-miR-204-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-204-5p | acute myeloid leukemia | downregulation | "Many of the down-regulated miRNAs including miR-20 ......" | 18308931 | |
hsa-miR-204-5p | acute myeloid leukemia | downregulation | "Low expression of microRNA 204 miR 204 is associat ......" | 26126974 | |
hsa-miR-204-5p | bladder cancer | downregulation | "We investigated the miRNA expression signature of ......" | 21304530 | |
hsa-miR-204-5p | bladder cancer | downregulation | "In the first - discovery - phase microarray cards ......" | 27468885 | Microarray; qPCR |
hsa-miR-204-5p | breast cancer | downregulation | "Studying the miRNome of locally advanced breast tu ......" | 27703260 | |
hsa-miR-204-5p | colorectal cancer | downregulation | "miR-204-5p was found to be downregulated in colore ......" | 25294901 | Microarray |
hsa-miR-204-5p | colorectal cancer | downregulation | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | RNA-Seq |
hsa-miR-204-5p | gastric cancer | downregulation | "Our results suggest that down-regulation of miR-20 ......" | 23768087 | |
hsa-miR-204-5p | gastric cancer | downregulation | "Our and others' data revealed that miR-204-5p was ......" | 25429829 | |
hsa-miR-204-5p | gastric cancer | downregulation | "miR-204 was found to be downregulated in gastric c ......" | 26729198 | qPCR |
hsa-miR-204-5p | glioblastoma | downregulation | "Till now little has been known about the role of m ......" | 27588402 | |
hsa-miR-204-5p | kidney renal cell cancer | downregulation | "MicroRNA-204 miR-204 has been reported to be frequ ......" | 26323722 | |
hsa-miR-204-5p | lung squamous cell cancer | downregulation | "Decreased expression of miR 204 in plasma is assoc ......" | 26497897 | qPCR |
hsa-miR-204-5p | lung squamous cell cancer | upregulation | "Deregulated expression of miR-204 has been reporte ......" | 26935060 | qPCR |
hsa-miR-204-5p | ovarian cancer | downregulation | "In this study we aimed to find out the influence o ......" | 25962115 | |
hsa-miR-204-5p | retinoblastoma | downregulation | "Aberrant expression of miR-204 had been frequently ......" | 25647033 | |
hsa-miR-204-5p | thyroid cancer | downregulation | "It was recently shown that miR-204-5p is downregul ......" | 25603050 |
Reported cancer pathway affected by hsa-miR-204-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-204-5p | breast cancer | Apoptosis pathway | "MicroRNA 204 targets JAK2 in breast cancer and ind ......" | 26191195 | |
hsa-miR-204-5p | breast cancer | Epithelial mesenchymal transition pathway | "MiR 204 5p/Six1 feedback loop promotes epithelial ......" | 26408179 | |
hsa-miR-204-5p | colorectal cancer | Apoptosis pathway | "miR 204 5p expression in colorectal cancer: an aut ......" | 25209181 | |
hsa-miR-204-5p | esophageal cancer | Epithelial mesenchymal transition pathway | "miR 204 inhibits invasion and epithelial mesenchym ......" | 26722467 | |
hsa-miR-204-5p | gastric cancer | Epithelial mesenchymal transition pathway | "MiR 204 down regulates SIRT1 and reverts SIRT1 ind ......" | 23768087 | Luciferase; Western blot |
hsa-miR-204-5p | gastric cancer | Epithelial mesenchymal transition pathway | "Decreased miR 204 in H pylori associated gastric c ......" | 24984017 | Luciferase |
hsa-miR-204-5p | gastric cancer | Epithelial mesenchymal transition pathway | "miR 204 regulates the EMT by targeting snai1 to su ......" | 26729198 | Luciferase; Transwell assay |
hsa-miR-204-5p | liver cancer | Apoptosis pathway | "To investigate the level of microRNA-204 miR-204 i ......" | 25652855 | Flow cytometry; MTT assay; Western blot |
hsa-miR-204-5p | liver cancer | Apoptosis pathway | "miR 204 5p targeting SIRT1 regulates hepatocellula ......" | 27748572 | Western blot; Cell proliferation assay; Colony formation; Cell Proliferation Assay |
hsa-miR-204-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "Deregulated expression of miR-204 has been reporte ......" | 26935060 | Western blot; Colony formation; Cell migration assay |
hsa-miR-204-5p | ovarian cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "Up Regulation of miR 204 Enhances Anoikis Sensitiv ......" | 25962115 | Wound Healing Assay; Western blot |
hsa-miR-204-5p | prostate cancer | Apoptosis pathway | "Human miR-204-5p potentially targeting BCL2 has be ......" | 27519795 | Luciferase; Western blot |
hsa-miR-204-5p | prostate cancer | Apoptosis pathway | "In this study we firstly investigated the regulati ......" | 27686228 | Western blot |
hsa-miR-204-5p | sarcoma | Epithelial mesenchymal transition pathway | "MicroRNA 204 inhibits proliferation migration inva ......" | 25998694 | Luciferase |
hsa-miR-204-5p | thyroid cancer | cell cycle pathway; Apoptosis pathway | "MiR 204 5p suppresses cell proliferation by inhibi ......" | 25603050 | Luciferase |
Reported cancer prognosis affected by hsa-miR-204-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-204-5p | acute myeloid leukemia | poor survival | "Low expression of microRNA 204 miR 204 is associat ......" | 26126974 | |
hsa-miR-204-5p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
hsa-miR-204-5p | breast cancer | worse prognosis; staging; metastasis; poor survival; drug resistance | "Decreased expression of miR 204 is associated with ......" | 25031750 | |
hsa-miR-204-5p | breast cancer | progression | "CONSORT: Sam68 Is Directly Regulated by MiR 204 an ......" | 26656364 | Flow cytometry; Western blot; Luciferase |
hsa-miR-204-5p | breast cancer | staging | "Dual targeting of ANGPT1 and TGFBR2 genes by miR 2 ......" | 27703260 | Luciferase |
hsa-miR-204-5p | colorectal cancer | poor survival | "miR 204 5p expression in colorectal cancer: an aut ......" | 25209181 | |
hsa-miR-204-5p | colorectal cancer | progression; metastasis; poor survival | "miR 204 5p inhibits proliferation and invasion and ......" | 25294901 | Western blot; Luciferase |
hsa-miR-204-5p | colorectal cancer | worse prognosis | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | |
hsa-miR-204-5p | colorectal cancer | drug resistance | "LncRNA UCA1 enhances cell proliferation and 5 fluo ......" | 27046651 | |
hsa-miR-204-5p | colorectal cancer | drug resistance | "MicroRNA 204 modulates colorectal cancer cell sens ......" | 27095441 | |
hsa-miR-204-5p | endometrial cancer | staging; metastasis; poor survival; tumorigenesis | "A TrkB STAT3 miR 204 5p regulatory circuitry contr ......" | 24321270 | Luciferase; MTT assay; Transwell assay |
hsa-miR-204-5p | gastric cancer | cell migration; tumorigenesis | "MiR-204 which was predicted to target ezrin was do ......" | 21416062 | Luciferase |
hsa-miR-204-5p | gastric cancer | drug resistance | "miR 204 targets Bcl 2 expression and enhances resp ......" | 23152059 | |
hsa-miR-204-5p | gastric cancer | drug resistance; metastasis | "MiR 204 down regulates SIRT1 and reverts SIRT1 ind ......" | 23768087 | Luciferase; Western blot |
hsa-miR-204-5p | gastric cancer | staging | "In the second stage differentially expressed miRNA ......" | 26172537 | |
hsa-miR-204-5p | gastric cancer | progression; metastasis | "miR 204 regulates the EMT by targeting snai1 to su ......" | 26729198 | Luciferase; Transwell assay |
hsa-miR-204-5p | gastric cancer | worse prognosis; staging; metastasis; differentiation; poor survival; malignant trasformation; drug resistance | "Reduced expression of serum miR 204 predicts poor ......" | 27173244 | |
hsa-miR-204-5p | glioblastoma | progression | "miR 204 suppresses the development and progression ......" | 27588402 | |
hsa-miR-204-5p | head and neck cancer | metastasis; progression | "Network modeling identifies molecular functions ta ......" | 20369013 | |
hsa-miR-204-5p | kidney renal cell cancer | cell migration; metastasis | "Upregulation of microRNA 204 inhibits cell prolife ......" | 26323722 | Western blot; Luciferase; Cell migration assay; MTT assay |
hsa-miR-204-5p | liver cancer | staging; tumor size | "To investigate the level of microRNA-204 miR-204 i ......" | 25652855 | Flow cytometry; MTT assay; Western blot |
hsa-miR-204-5p | liver cancer | progression; poor survival | "miR 204 5p targeting SIRT1 regulates hepatocellula ......" | 27748572 | Western blot; Cell proliferation assay; Colony formation; Cell Proliferation Assay |
hsa-miR-204-5p | lung squamous cell cancer | worse prognosis; staging; metastasis; poor survival | "Decreased expression of miR 204 in plasma is assoc ......" | 26497897 | |
hsa-miR-204-5p | lung squamous cell cancer | cell migration | "Deregulated expression of miR-204 has been reporte ......" | 26935060 | Western blot; Colony formation; Cell migration assay |
hsa-miR-204-5p | pancreatic cancer | poor survival | "Two gemcitabine-resistant pancreatic cancer cell l ......" | 21347785 | |
hsa-miR-204-5p | pancreatic cancer | staging | "Using Affymetrix microarrays we established a glob ......" | 26807325 | |
hsa-miR-204-5p | prostate cancer | progression; metastasis; differentiation; staging | "miR 204 is dysregulated in metastatic prostate can ......" | 25630658 | Luciferase |
hsa-miR-204-5p | retinoblastoma | progression | "MiR 204 down regulated in retinoblastoma regulates ......" | 25647033 |
Reported gene related to hsa-miR-204-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-204-5p | breast cancer | BCL2 | "Moreover the level of miR-204 is negatively correl ......" | 26191195 |
hsa-miR-204-5p | colorectal cancer | BCL2 | "This may be explained by the fact that miR-204-5p ......" | 25209181 |
hsa-miR-204-5p | gastric cancer | BCL2 | "miR 204 targets Bcl 2 expression and enhances resp ......" | 23152059 |
hsa-miR-204-5p | liver cancer | BCL2 | "The expressions of Bcl-2 and Sirt1 in the lower mi ......" | 25652855 |
hsa-miR-204-5p | prostate cancer | BCL2 | "Human miR-204-5p potentially targeting BCL2 has be ......" | 27519795 |
hsa-miR-204-5p | gastric cancer | SIRT1 | "MiR 204 down regulates SIRT1 and reverts SIRT1 ind ......" | 23768087 |
hsa-miR-204-5p | liver cancer | SIRT1 | "miR 204 5p targeting SIRT1 regulates hepatocellula ......" | 27748572 |
hsa-miR-204-5p | liver cancer | SIRT1 | "The expressions of Bcl-2 and Sirt1 in the lower mi ......" | 25652855 |
hsa-miR-204-5p | prostate cancer | SIRT1 | "In this study we firstly investigated the regulati ......" | 27686228 |
hsa-miR-204-5p | sarcoma | SIRT1 | "MicroRNA 204 inhibits proliferation migration inva ......" | 25998694 |
hsa-miR-204-5p | glioblastoma | ATF2 | "miR 204 suppresses the development and progression ......" | 27588402 |
hsa-miR-204-5p | lung squamous cell cancer | ATF2 | "Additionally activating transcription factor 2 ATF ......" | 26935060 |
hsa-miR-204-5p | colorectal cancer | HMGA2 | "We identified high mobility group protein A2 HMGA2 ......" | 27095441 |
hsa-miR-204-5p | thyroid cancer | HMGA2 | "MiR 204 regulates HMGA2 expression and inhibits ce ......" | 26406941 |
hsa-miR-204-5p | colorectal cancer | RAB22A | "miR 204 5p inhibits proliferation and invasion and ......" | 25294901 |
hsa-miR-204-5p | gastric cancer | RAB22A | "MicroRNA 204 5p inhibits gastric cancer cell proli ......" | 25429829 |
hsa-miR-204-5p | gastric cancer | SOX4 | "Decreased miR 204 in H pylori associated gastric c ......" | 24984017 |
hsa-miR-204-5p | kidney renal cell cancer | SOX4 | "Upregulation of microRNA 204 inhibits cell prolife ......" | 26323722 |
hsa-miR-204-5p | endometrial cancer | TRPM3 | "Moreover ChIP assays showed that phospho-STAT3 cou ......" | 24321270 |
hsa-miR-204-5p | kidney renal cell cancer | TRPM3 | "TRPM3 and miR 204 establish a regulatory circuit t ......" | 25517751 |
hsa-miR-204-5p | colorectal cancer | UCA1 | "LncRNA UCA1 enhances cell proliferation and 5 fluo ......" | 27046651 |
hsa-miR-204-5p | prostate cancer | UCA1 | "Then we examined whether miR-204 downregulation in ......" | 27686228 |
hsa-miR-204-5p | liver cancer | AGO2 | "In the current study we identified miR-192 and miR ......" | 26710269 |
hsa-miR-204-5p | breast cancer | ANGPT1 | "Dual targeting of ANGPT1 and TGFBR2 genes by miR 2 ......" | 27703260 |
hsa-miR-204-5p | prostate cancer | AR | "Importantly overexpression of miR-204 and knockdow ......" | 25797256 |
hsa-miR-204-5p | ovarian cancer | BDNF | "Restored expression level of miR-204 enables cells ......" | 25962115 |
hsa-miR-204-5p | thyroid cancer | CCND1 | "MiR-204 overexpression decreased cyclin D1 and Ki6 ......" | 26406941 |
hsa-miR-204-5p | gastric cancer | CDH1 | "Up-regulation of miR-204 influenced the levels of ......" | 23768087 |
hsa-miR-204-5p | lung squamous cell cancer | CEACAM5 | "The value of the area under the receiver operating ......" | 26497897 |
hsa-miR-204-5p | colorectal cancer | CREB1 | "We also identified CREB1 as a new target of miR-20 ......" | 27046651 |
hsa-miR-204-5p | prostate cancer | ERG | "We aimed to investigate miR-204 in the context of ......" | 25630658 |
hsa-miR-204-5p | prostate cancer | ETS1 | "We found dualistic miR-204 effects either acting a ......" | 25630658 |
hsa-miR-204-5p | gastric cancer | EZR | "MiR-204 which was predicted to target ezrin was do ......" | 21416062 |
hsa-miR-204-5p | endometrial cancer | FOXC1 | "Dysregulation of microRNA 204 mediates migration a ......" | 21400511 |
hsa-miR-204-5p | esophageal cancer | FOXM1 | "miR 204 inhibits invasion and epithelial mesenchym ......" | 26722467 |
hsa-miR-204-5p | lung squamous cell cancer | HNF1B | "Additionally activating transcription factor 2 ATF ......" | 26935060 |
hsa-miR-204-5p | liver cancer | HOTTIP | "In the current study we identified miR-192 and miR ......" | 26710269 |
hsa-miR-204-5p | acute myeloid leukemia | HOXA10 | "Indeed we confirmed that miR-204 targets HOXA10 an ......" | 18308931 |
hsa-miR-204-5p | thyroid cancer | IGFBP5 | "MiR 204 5p suppresses cell proliferation by inhibi ......" | 25603050 |
hsa-miR-204-5p | breast cancer | JAK2 | "MicroRNA 204 targets JAK2 in breast cancer and ind ......" | 26191195 |
hsa-miR-204-5p | breast cancer | KHDRBS1 | "CONSORT: Sam68 Is Directly Regulated by MiR 204 an ......" | 26656364 |
hsa-miR-204-5p | lung cancer | MALAT1 | "LncRNA MALAT1 exerts oncogenic functions in lung a ......" | 27294002 |
hsa-miR-204-5p | pancreatic cancer | MCL1 | "Using pancreatic cancer cell lines we have shown t ......" | 24025188 |
hsa-miR-204-5p | acute myeloid leukemia | MEIS1 | "Indeed we confirmed that miR-204 targets HOXA10 an ......" | 18308931 |
hsa-miR-204-5p | retinoblastoma | MMP9 | "MiR 204 down regulated in retinoblastoma regulates ......" | 25647033 |
hsa-miR-204-5p | prostate cancer | MYB | "We found dualistic miR-204 effects either acting a ......" | 25630658 |
hsa-miR-204-5p | ovarian cancer | NTF3 | "Up Regulation of miR 204 Enhances Anoikis Sensitiv ......" | 25962115 |
hsa-miR-204-5p | endometrial cancer | NTRK2 | "A TrkB STAT3 miR 204 5p regulatory circuitry contr ......" | 24321270 |
hsa-miR-204-5p | thyroid cancer | PCNA | "MiR-204 overexpression decreased cyclin D1 and Ki6 ......" | 26406941 |
hsa-miR-204-5p | breast cancer | PRDX2 | "Here we show that Trichostatin A TSA could increas ......" | 26436206 |
hsa-miR-204-5p | breast cancer | PTGS2 | "Gene expression analysis of miR-204 and miR-379-tr ......" | 22629385 |
hsa-miR-204-5p | breast cancer | SIX1 | "We also identified that upregulation of Six1 could ......" | 26408179 |
hsa-miR-204-5p | gastric cancer | SNAI1 | "miR 204 regulates the EMT by targeting snai1 to su ......" | 26729198 |
hsa-miR-204-5p | lung cancer | SNAI2 | "In particular MALAT1 upregulated the expression of ......" | 27294002 |
hsa-miR-204-5p | endometrial cancer | STAT3 | "A TrkB STAT3 miR 204 5p regulatory circuitry contr ......" | 24321270 |
hsa-miR-204-5p | gastric cancer | STK11 | "We demonstrated that the regulation of EMT by miR- ......" | 23768087 |
hsa-miR-204-5p | breast cancer | TAM | "When miR-204 is down regulated the inhibition of T ......" | 26436206 |
hsa-miR-204-5p | colon cancer | TFAM | "Dual luciferase reporter assays was performed to e ......" | 26499153 |
hsa-miR-204-5p | breast cancer | TGFBR2 | "Dual targeting of ANGPT1 and TGFBR2 genes by miR 2 ......" | 27703260 |
hsa-miR-204-5p | gastric cancer | USP47 | "MicroRNA 204 5p inhibits gastric cancer cell proli ......" | 25429829 |
hsa-miR-204-5p | gastric cancer | VIM | "Up-regulation of miR-204 influenced the levels of ......" | 23768087 |
hsa-miR-204-5p | prostate cancer | XRN1 | "A dual yet opposite growth regulating function of ......" | 25797256 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-204-5p | IL1RAP | 9 cancers: KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | miRNAWalker2 validate | TCGA KIRC -0.172; TCGA KIRP -0.352; TCGA LIHC -0.102; TCGA LUAD -0.109; TCGA LUSC -0.066; TCGA PAAD -0.168; TCGA PRAD -0.088; TCGA THCA -0.432; TCGA UCEC -0.057 |
hsa-miR-204-5p | PLAUR | 9 cancers: KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA KIRC -0.273; TCGA KIRP -0.148; TCGA LIHC -0.213; TCGA LUAD -0.14; TCGA LUSC -0.136; TCGA PAAD -0.26; TCGA SARC -0.154; TCGA THCA -0.412; TCGA UCEC -0.074 |
hsa-miR-204-5p | ESCO2 | 10 cancers: KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA KIRC -0.21; TCGA KIRP -0.416; TCGA LGG -0.172; TCGA LIHC -0.19; TCGA LUAD -0.167; TCGA PAAD -0.13; TCGA PRAD -0.391; TCGA SARC -0.064; TCGA THCA -0.143; TCGA UCEC -0.203 |
hsa-miR-204-5p | PAQR4 | 9 cancers: KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA KIRC -0.181; TCGA KIRP -0.134; TCGA LIHC -0.21; TCGA LUAD -0.065; TCGA PAAD -0.197; TCGA PRAD -0.143; TCGA SARC -0.078; TCGA THCA -0.155; TCGA UCEC -0.089 |
hsa-miR-204-5p | WDR76 | 10 cancers: KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC | MirTarget | TCGA KIRC -0.076; TCGA KIRP -0.218; TCGA LGG -0.07; TCGA LIHC -0.16; TCGA LUAD -0.134; TCGA LUSC -0.083; TCGA PRAD -0.137; TCGA SARC -0.079; TCGA THCA -0.099; TCGA UCEC -0.091 |
hsa-miR-204-5p | E2F2 | 10 cancers: KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; UCEC | mirMAP | TCGA KIRC -0.198; TCGA KIRP -0.294; TCGA LGG -0.168; TCGA LIHC -0.269; TCGA LUAD -0.093; TCGA PAAD -0.13; TCGA PRAD -0.446; TCGA SARC -0.065; TCGA THCA -0.059; TCGA UCEC -0.223 |
Enriched cancer pathways of putative targets