microRNA information: hsa-miR-205-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-205-3p | miRbase |
Accession: | MIMAT0009197 | miRbase |
Precursor name: | hsa-mir-205 | miRbase |
Precursor accession: | MI0000285 | miRbase |
Symbol: | MIR205 | HGNC |
RefSeq ID: | NR_029622 | GenBank |
Sequence: | GAUUUCAGUGGAGUGAAGUUC |
Reported expression in cancers: hsa-miR-205-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-205-3p | bladder cancer | upregulation | "MicroRNA miRNA expression profile analysis indicat ......" | 26715266 | qPCR |
hsa-miR-205-3p | breast cancer | upregulation | "Targeting miR 205 in breast cancer. Among them miR ......" | 19839716 | |
hsa-miR-205-3p | breast cancer | upregulation | "Recent studies have demonstrated that miR-205 has ......" | 20436283 | |
hsa-miR-205-3p | cervical and endocervical cancer | upregulation | "Serum microRNA 205 as a novel biomarker for cervic ......" | 25788864 | qPCR |
hsa-miR-205-3p | colorectal cancer | downregulation | "Diagnostic and prognostic value of miR 205 in colo ......" | 24935592 | Reverse transcription PCR; qPCR |
hsa-miR-205-3p | colorectal cancer | downregulation | "Aberrant expression of miR-205 has been reported i ......" | 26692949 | qPCR |
hsa-miR-205-3p | endometrial cancer | upregulation | "miR-200a/miR-141 and miR-205 expression in 154 end ......" | 26045795 | qPCR |
hsa-miR-205-3p | endometrial cancer | upregulation | "Pathogenesis of endometrial cancer has been connec ......" | 27655663 | |
hsa-miR-205-3p | esophageal cancer | deregulation | "Differentially-expressed miRNAs were analyzed usin ......" | 23534712 | Reverse transcription PCR |
hsa-miR-205-3p | esophageal cancer | upregulation | "The relative expression levels of the following mi ......" | 25667498 | qPCR |
hsa-miR-205-3p | esophageal cancer | downregulation | "Predictive Value of Serum miR 10b miR 29c and miR ......" | 26554762 | qPCR |
hsa-miR-205-3p | gastric cancer | downregulation | "Down regulation of microRNA 205 promotes gastric c ......" | 24763883 | |
hsa-miR-205-3p | head and neck cancer | upregulation | "Notable was the high expression of miR-21 and miR- ......" | 17475218 | Northern blot |
hsa-miR-205-3p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
hsa-miR-205-3p | kidney renal cell cancer | downregulation | "The expression of miR-205 was detected in RCC and ......" | 25427583 | qPCR |
hsa-miR-205-3p | liver cancer | deregulation | "Interestingly miR-195 miR-25 and miR-16 were up-re ......" | 25519019 | |
hsa-miR-205-3p | liver cancer | deregulation | "In our study we found that down-regulation of miR- ......" | 25997960 | qPCR |
hsa-miR-205-3p | lung cancer | deregulation | "Using a recently published robust rank aggregation ......" | 23225545 | |
hsa-miR-205-3p | lung squamous cell cancer | upregulation | "For example hsa-miR-205 is a miRNA that is highly ......" | 20068099 | Reverse transcription PCR |
hsa-miR-205-3p | lymphoma | downregulation | "MicroRNA profiling of Epstein Barr virus associate ......" | 22870299 | RNA-Seq; qPCR |
hsa-miR-205-3p | melanoma | downregulation | "Differential expression of microRNAs during melano ......" | 22223089 | Microarray |
hsa-miR-205-3p | melanoma | downregulation | "In situ measurement of miR 205 in malignant melano ......" | 22890556 | in situ hybridization |
hsa-miR-205-3p | prostate cancer | downregulation | "Thus downregulation of miR-205 and miR-31 has an i ......" | 21368878 | |
hsa-miR-205-3p | prostate cancer | downregulation | "MiR 130a miR 203 and miR 205 jointly repress key o ......" | 22391564 | |
hsa-miR-205-3p | prostate cancer | downregulation | "miR 205 is frequently downregulated in prostate ca ......" | 23974361 | Microarray; qPCR |
hsa-miR-205-3p | prostate cancer | downregulation | "MicroRNA profiling in prostate cancer the diagnost ......" | 24167554 | qPCR |
hsa-miR-205-3p | prostate cancer | downregulation | "MiR 205 is progressively down regulated in lymph n ......" | 24173237 | |
hsa-miR-205-3p | prostate cancer | downregulation | "MiR-30a and miR-205 are two miRNAs downregulated i ......" | 27160121 | |
hsa-miR-205-3p | sarcoma | deregulation | "We found that the expression of miR-205 was signif ......" | 26708425 |
Reported cancer pathway affected by hsa-miR-205-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-205-3p | bladder cancer | Epithelial mesenchymal transition pathway | "The p63 protein isoform ΔNp63α inhibits epitheli ......" | 23239884 | |
hsa-miR-205-3p | bladder cancer | cell cycle pathway | "Long non coding RNA HOTAIR regulates cyclin J via ......" | 26469956 | |
hsa-miR-205-3p | breast cancer | cell cycle pathway | "Oncosuppressive role of p53 induced miR 205 in tri ......" | 22578566 | |
hsa-miR-205-3p | breast cancer | Apoptosis pathway | "Analysis of miR 205 and miR 155 expression in the ......" | 23372341 | |
hsa-miR-205-3p | breast cancer | Epithelial mesenchymal transition pathway | "Loss of the polycomb protein Mel 18 enhances the e ......" | 23474752 | |
hsa-miR-205-3p | breast cancer | Apoptosis pathway | "Functional cooperation of miR 125a miR 125b and mi ......" | 23519125 | |
hsa-miR-205-3p | breast cancer | Apoptosis pathway | "An increasing number of studies have shown that mi ......" | 24129185 | Western blot; Flow cytometry; Luciferase; MTT assay; Colony formation |
hsa-miR-205-3p | breast cancer | Apoptosis pathway | "MicroRNA 205 inhibits the proliferation and invasi ......" | 26239614 | Luciferase |
hsa-miR-205-3p | breast cancer | Apoptosis pathway | "Here we show a strong correlation between miR-205 ......" | 27362808 | |
hsa-miR-205-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Diagnostic and prognostic value of miR 205 in colo ......" | 24935592 | |
hsa-miR-205-3p | endometrial cancer | Apoptosis pathway | "MiR 205 inhibits cell apoptosis by targeting phosp ......" | 24929707 | Western blot; Luciferase; Flow cytometry |
hsa-miR-205-3p | endometrial cancer | PI3K/Akt signaling pathway; Epithelial mesenchymal transition pathway | "miR 205 promotes epithelial mesenchymal transition ......" | 26446417 | Western blot |
hsa-miR-205-3p | esophageal cancer | Epithelial mesenchymal transition pathway | "To reveal miRNAs' signatures of ESCC we analyzed m ......" | 20588024 | |
hsa-miR-205-3p | esophageal cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "Total RNA was extracted from ESCC cell lines OE21 ......" | 21426561 | Wound Healing Assay; Western blot |
hsa-miR-205-3p | gastric cancer | cell cycle pathway | "Down regulation of microRNA 205 promotes gastric c ......" | 24763883 | Western blot |
hsa-miR-205-3p | gastric cancer | Epithelial mesenchymal transition pathway | "MicroRNA 205 suppresses the invasion and epithelia ......" | 27082508 | Transwell assay |
hsa-miR-205-3p | kidney renal cell cancer | Apoptosis pathway | "This study aims to characterize the function of do ......" | 25427583 | Luciferase; Western blot; Flow cytometry; MTT assay |
hsa-miR-205-3p | lung cancer | Apoptosis pathway | "MiR 205 and miR 218 expression is associated with ......" | 25917317 | |
hsa-miR-205-3p | lung squamous cell cancer | PI3K/Akt signaling pathway; mTOR signaling pathway | "miR 205 targets PTEN and PHLPP2 to augment AKT sig ......" | 23856247 | RNAi |
hsa-miR-205-3p | melanoma | Apoptosis pathway | "Here we report that expression of miR-205 is signi ......" | 21454583 | Luciferase; Colony formation |
hsa-miR-205-3p | pancreatic cancer | Apoptosis pathway | "Here we designed self-assembling gemcitabine conju ......" | 24836307 | |
hsa-miR-205-3p | prostate cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 205 directed transcriptional activation o ......" | 20737563 | Luciferase |
hsa-miR-205-3p | prostate cancer | Apoptosis pathway | "Downregulation of miR 205 and miR 31 confers resis ......" | 21368878 | |
hsa-miR-205-3p | prostate cancer | Epithelial mesenchymal transition pathway | "Loss of p63 and its microRNA 205 target results in ......" | 22949650 | |
hsa-miR-205-3p | prostate cancer | Apoptosis pathway | "MicroRNA 205 a novel regulator of the anti apoptot ......" | 23612742 | Western blot |
hsa-miR-205-3p | prostate cancer | cell cycle pathway; Apoptosis pathway | "miR 205 is frequently downregulated in prostate ca ......" | 23974361 | Colony formation; Western blot; Luciferase |
hsa-miR-205-3p | sarcoma | Apoptosis pathway | "MiR 205 functions as a tumor suppressor via target ......" | 26708425 | Luciferase |
hsa-miR-205-3p | thyroid cancer | cell cycle pathway; Apoptosis pathway | "Modulatory role of miR 205 in angiogenesis and pro ......" | 26342107 | Western blot |
Reported cancer prognosis affected by hsa-miR-205-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-205-3p | bladder cancer | staging; progression | "Coordinated epigenetic repression of the miR 200 f ......" | 20473948 | |
hsa-miR-205-3p | bladder cancer | malignant trasformation; poor survival | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
hsa-miR-205-3p | bladder cancer | worse prognosis; staging; poor survival | "MicroRNA miRNA expression profile analysis indicat ......" | 26715266 | |
hsa-miR-205-3p | breast cancer | malignant trasformation; metastasis | "Suppression of cell growth and invasion by miR 205 ......" | 19238171 | Western blot; Luciferase |
hsa-miR-205-3p | breast cancer | drug resistance | "microRNA 205 regulates HER3 in human breast cancer ......" | 19276373 | |
hsa-miR-205-3p | breast cancer | malignant trasformation | "Targeting miR 205 in breast cancer; Among them miR ......" | 19839716 | |
hsa-miR-205-3p | breast cancer | metastasis | "The ups and downs of miR 205: identifying the role ......" | 20436283 | |
hsa-miR-205-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
hsa-miR-205-3p | breast cancer | tumorigenesis | "ErbB2 down regulates microRNA 205 in breast cancer ......" | 21787752 | Colony formation |
hsa-miR-205-3p | breast cancer | tumorigenesis | "Microarray-based techniques are being useful to ob ......" | 22167321 | |
hsa-miR-205-3p | breast cancer | progression | "Oncosuppressive role of p53 induced miR 205 in tri ......" | 22578566 | |
hsa-miR-205-3p | breast cancer | cell migration | "Analysis of the miRNA expression identified 11 miR ......" | 23497265 | |
hsa-miR-205-3p | breast cancer | staging | "Tumor suppressive function of mir 205 in breast ca ......" | 24098490 | Western blot; Luciferase |
hsa-miR-205-3p | breast cancer | cell migration | "An increasing number of studies have shown that mi ......" | 24129185 | Western blot; Flow cytometry; Luciferase; MTT assay; Colony formation |
hsa-miR-205-3p | breast cancer | metastasis | "miR 205 and miR 200c: Predictive Micro RNAs for Ly ......" | 25013435 | |
hsa-miR-205-3p | breast cancer | drug resistance | "To gain further insight into the molecular mechani ......" | 25633049 | |
hsa-miR-205-3p | breast cancer | metastasis; malignant trasformation | "Pterostilbene inhibits triple negative breast canc ......" | 25792283 | Western blot |
hsa-miR-205-3p | breast cancer | drug resistance | "miR 205 5p mediated downregulation of ErbB/HER rec ......" | 26181203 | |
hsa-miR-205-3p | breast cancer | tumorigenesis | "MicroRNA 205 inhibits the proliferation and invasi ......" | 26239614 | Luciferase |
hsa-miR-205-3p | breast cancer | metastasis; poor survival; staging | "MicroRNA expression profiling identifies decreased ......" | 26916073 | |
hsa-miR-205-3p | breast cancer | drug resistance; immune evasion | "Here we show a strong correlation between miR-205 ......" | 27362808 | |
hsa-miR-205-3p | cervical and endocervical cancer | tumorigenesis | "miR 205 expression promotes cell proliferation and ......" | 23056551 | Western blot |
hsa-miR-205-3p | cervical and endocervical cancer | worse prognosis; staging; metastasis; differentiation; poor survival | "Serum microRNA 205 as a novel biomarker for cervic ......" | 25788864 | |
hsa-miR-205-3p | colon cancer | metastasis | "Estrogen receptor beta reduces colon cancer metast ......" | 27283988 | |
hsa-miR-205-3p | colorectal cancer | tumorigenesis; metastasis; malignant trasformation; progression | "Diagnostic and prognostic value of miR 205 in colo ......" | 24935592 | |
hsa-miR-205-3p | colorectal cancer | drug resistance | "MiR 205 and MiR 373 Are Associated with Aggressive ......" | 27271572 | |
hsa-miR-205-3p | endometrial cancer | poor survival | "Prognostic significance of miR 205 in endometrial ......" | 22514717 | |
hsa-miR-205-3p | endometrial cancer | worse prognosis; metastasis | "miR 200a/miR 141 and miR 205 upregulation might be ......" | 26045795 | |
hsa-miR-205-3p | endometrial cancer | progression; tumorigenesis | "miR 205 promotes epithelial mesenchymal transition ......" | 26446417 | Western blot |
hsa-miR-205-3p | esophageal cancer | malignant trasformation; differentiation | "Total RNA was extracted from ESCC cell lines OE21 ......" | 21426561 | Wound Healing Assay; Western blot |
hsa-miR-205-3p | gastric cancer | progression | "Down regulation of microRNA 205 promotes gastric c ......" | 24763883 | Western blot |
hsa-miR-205-3p | head and neck cancer | poor survival | "Low level expression of microRNAs let 7d and miR 2 ......" | 19179615 | |
hsa-miR-205-3p | head and neck cancer | malignant trasformation | "miR 205 in situ expression and localization in hea ......" | 25422181 | |
hsa-miR-205-3p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
hsa-miR-205-3p | head and neck cancer | metastasis | "The most differentially expressed microRNAs were v ......" | 25956054 | |
hsa-miR-205-3p | liver cancer | poor survival | "Down regulation of miR 205 promotes stemness of he ......" | 25997960 | Luciferase |
hsa-miR-205-3p | lung cancer | staging | "Thus we conducted quantitative reverse transcripti ......" | 22782668 | |
hsa-miR-205-3p | lung cancer | staging | "MiR 205 and MiR 375 microRNA assays to distinguish ......" | 25695220 | |
hsa-miR-205-3p | lung cancer | drug resistance; tumorigenesis | "MiR 205 and miR 218 expression is associated with ......" | 25917317 | |
hsa-miR-205-3p | lung squamous cell cancer | poor survival | "Prognostic value of mature microRNA 21 and microRN ......" | 18719201 | |
hsa-miR-205-3p | lung squamous cell cancer | staging | "This study contained three phases: 1 marker discov ......" | 20526284 | |
hsa-miR-205-3p | lung squamous cell cancer | metastasis; poor survival; worse prognosis | "High-throughput microarray was used to measure miR ......" | 22618509 | |
hsa-miR-205-3p | lung squamous cell cancer | malignant trasformation; progression | "miR 205 targets PTEN and PHLPP2 to augment AKT sig ......" | 23856247 | RNAi |
hsa-miR-205-3p | lung squamous cell cancer | worse prognosis | "Relative expressions of miR 205 5p miR 205 3p and ......" | 23881177 | |
hsa-miR-205-3p | lung squamous cell cancer | poor survival | "The 3-miRNA panel expression miR-192 miR-200c and ......" | 27153322 | |
hsa-miR-205-3p | lymphoma | staging | "Herein we used a global quantitative real-time pol ......" | 25503151 | |
hsa-miR-205-3p | melanoma | progression | "Here we report that expression of miR-205 is signi ......" | 21454583 | Luciferase; Colony formation |
hsa-miR-205-3p | melanoma | progression; staging | "Differential expression of microRNAs during melano ......" | 22223089 | Colony formation |
hsa-miR-205-3p | melanoma | progression; motility; cell migration | "Loss of microRNA 205 expression is associated with ......" | 22525428 | |
hsa-miR-205-3p | melanoma | malignant trasformation; poor survival; staging | "In situ measurement of miR 205 in malignant melano ......" | 22890556 | |
hsa-miR-205-3p | melanoma | metastasis | "Six microRNAs miR-9 miR-145 miR-150 miR-155 miR-20 ......" | 23863473 | |
hsa-miR-205-3p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
hsa-miR-205-3p | ovarian cancer | staging; worse prognosis | "We scanned the circulating plasma miRNAs by TaqMan ......" | 24223734 | |
hsa-miR-205-3p | ovarian cancer | metastasis | "Expression and significance of VEGF miR 205 and ta ......" | 24608381 | |
hsa-miR-205-3p | ovarian cancer | motility; tumorigenesis; cell migration; metastasis; progression | "MiR 205 promotes motility of ovarian cancer cells ......" | 26275944 | Luciferase; Transwell assay |
hsa-miR-205-3p | pancreatic cancer | drug resistance | "Gemcitabine resistant MIA PaCa-2 cells possessed d ......" | 23073476 | |
hsa-miR-205-3p | pancreatic cancer | staging | "Based on relevance to cancer a seven-miRNA signatu ......" | 25184537 | |
hsa-miR-205-3p | pancreatic cancer | metastasis; worse prognosis | "This study performed profiling of microRNAs miRNAs ......" | 25258651 | |
hsa-miR-205-3p | pancreatic cancer | staging | "At 25 weeks the miRNA microarray analysis revealed ......" | 26516699 | |
hsa-miR-205-3p | prostate cancer | drug resistance | "MicroRNA 205 directed transcriptional activation o ......" | 20737563 | Luciferase |
hsa-miR-205-3p | prostate cancer | drug resistance; staging | "Downregulation of miR 205 and miR 31 confers resis ......" | 21368878 | |
hsa-miR-205-3p | prostate cancer | metastasis | "Next generation sequencing technology was applied ......" | 21980368 | |
hsa-miR-205-3p | prostate cancer | worse prognosis; recurrence | "Epigenetic induced repression of microRNA 205 is a ......" | 22869146 | |
hsa-miR-205-3p | prostate cancer | metastasis; cell migration | "Loss of p63 and its microRNA 205 target results in ......" | 22949650 | |
hsa-miR-205-3p | prostate cancer | drug resistance | "Epithelial to mesenchymal transition leads to doce ......" | 23041061 | |
hsa-miR-205-3p | prostate cancer | metastasis; poor survival; malignant trasformation | "miR 205 negatively regulates the androgen receptor ......" | 23571738 | Western blot; Luciferase |
hsa-miR-205-3p | prostate cancer | metastasis; worse prognosis; drug resistance | "MicroRNA 205 a novel regulator of the anti apoptot ......" | 23612742 | Western blot |
hsa-miR-205-3p | prostate cancer | malignant trasformation; metastasis | "miR 205 hinders the malignant interplay between pr ......" | 23924028 | |
hsa-miR-205-3p | prostate cancer | staging | "miR 205 is frequently downregulated in prostate ca ......" | 23974361 | Colony formation; Western blot; Luciferase |
hsa-miR-205-3p | prostate cancer | metastasis; progression | "MiR 205 is progressively down regulated in lymph n ......" | 24173237 | |
hsa-miR-205-3p | prostate cancer | drug resistance | "miR 205 impairs the autophagic flux and enhances c ......" | 24370341 | |
hsa-miR-205-3p | prostate cancer | cell migration; metastasis | "MicroRNA 205 inhibits cancer cell migration and in ......" | 26059417 | |
hsa-miR-205-3p | prostate cancer | poor survival | "MiR 205 suppresses autophagy and enhances radiosen ......" | 26813458 | |
hsa-miR-205-3p | prostate cancer | metastasis; recurrence | "Through next generation miRNA sequencing we recent ......" | 26990571 | |
hsa-miR-205-3p | sarcoma | metastasis; malignant trasformation | "miR 205 suppresses the proliferative and migratory ......" | 26396534 | Western blot |
hsa-miR-205-3p | sarcoma | progression | "MiR 205 functions as a tumor suppressor via target ......" | 26708425 | Luciferase |
hsa-miR-205-3p | thyroid cancer | progression | "Modulatory role of miR 205 in angiogenesis and pro ......" | 26342107 | Western blot |
Reported gene related to hsa-miR-205-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-205-3p | breast cancer | VEGFA | "Adding VEGFA and FGF2 exogenously to chemosensitiv ......" | 27362808 |
hsa-miR-205-3p | glioblastoma | VEGFA | "MicroRNA 205 functions as a tumor suppressor in hu ......" | 22159356 |
hsa-miR-205-3p | ovarian cancer | VEGFA | "The role of miR 205 in the VEGF mediated promotion ......" | 25597268 |
hsa-miR-205-3p | ovarian cancer | VEGFA | "VEGF is significantly expressed in the serum of ep ......" | 24608381 |
hsa-miR-205-3p | prostate cancer | VEGFA | "Additionally for two genes that are deregulated in ......" | 22815235 |
hsa-miR-205-3p | sarcoma | VEGFA | "miR 205 suppresses the proliferative and migratory ......" | 26396534 |
hsa-miR-205-3p | thyroid cancer | VEGFA | "Expression of vascular endothelial growth factor A ......" | 26342107 |
hsa-miR-205-3p | bladder cancer | CDH1 | "ΔNp63α E-cadherin and miR-205 were coexpressed i ......" | 23239884 |
hsa-miR-205-3p | breast cancer | CDH1 | "A small-scale immunohistochemistry analysis showed ......" | 26916073 |
hsa-miR-205-3p | endometrial cancer | CDH1 | "The overexpression of miR-205 inhibited E-cadherin ......" | 26446417 |
hsa-miR-205-3p | esophageal cancer | CDH1 | "Western blot revealed that knockdown of miR-205 ex ......" | 21426561 |
hsa-miR-205-3p | melanoma | CDH1 | "Furthermore re-introduction of ZEB2 into melanoma ......" | 22525428 |
hsa-miR-205-3p | breast cancer | ERBB3 | "These findings establish the tumor suppressive rol ......" | 19839716 |
hsa-miR-205-3p | breast cancer | ERBB3 | "miR-205 is a tumor suppressor in human breast canc ......" | 24129185 |
hsa-miR-205-3p | breast cancer | ERBB3 | "microRNA 205 regulates HER3 in human breast cancer ......" | 19276373 |
hsa-miR-205-3p | melanoma | ERBB3 | "Furthermore the ectopic expression of miR-205 had ......" | 23638671 |
hsa-miR-205-3p | endometrial cancer | PTEN | "A luciferase reporter assay qRT-PCR and western bl ......" | 24929707 |
hsa-miR-205-3p | endometrial cancer | PTEN | "Furthermore decreased expression of a miR-205 targ ......" | 22514717 |
hsa-miR-205-3p | endometrial cancer | PTEN | "Long non coding RNA derived miR 205 5p modulates h ......" | 26807189 |
hsa-miR-205-3p | lung squamous cell cancer | PTEN | "miR 205 targets PTEN and PHLPP2 to augment AKT sig ......" | 23856247 |
hsa-miR-205-3p | bladder cancer | ZEB1 | "ZEB1 is also known to repress miR-200c-141 transcr ......" | 20473948 |
hsa-miR-205-3p | breast cancer | ZEB1 | "These findings establish the tumor suppressive rol ......" | 19839716 |
hsa-miR-205-3p | ovarian cancer | ZEB1 | "MiR 205 promotes motility of ovarian cancer cells ......" | 26275944 |
hsa-miR-205-3p | esophageal cancer | ZEB2 | "These results imply that miR-205 is an ESCC-specif ......" | 21426561 |
hsa-miR-205-3p | kidney renal cell cancer | ZEB2 | "This study aims to characterize the function of do ......" | 25427583 |
hsa-miR-205-3p | melanoma | ZEB2 | "Mechanistically miR-205 overexpression results in ......" | 22525428 |
hsa-miR-205-3p | lung cancer | ADC | "SQCC was distinguished from normal tissue and ADC ......" | 23207443 |
hsa-miR-205-3p | lung squamous cell cancer | ADC | "The measurement of miR-205 may be another tool for ......" | 21263248 |
hsa-miR-205-3p | breast cancer | E2F1 | "Re-expression of miR-205 where absent strongly red ......" | 22578566 |
hsa-miR-205-3p | melanoma | E2F1 | "The expression levels of E2F1 and E2F5 were correl ......" | 21454583 |
hsa-miR-205-3p | lung cancer | SCLC1 | "Two microRNA panels yielded high diagnostic accura ......" | 23043084 |
hsa-miR-205-3p | lung squamous cell cancer | SCLC1 | "Quantitative reverse-transcription PCR quantitativ ......" | 24438615 |
hsa-miR-205-3p | breast cancer | SRC | "Mechanistic investigations revealed a significant ......" | 25792283 |
hsa-miR-205-3p | prostate cancer | SRC | "Functional analyses showed that both the overexpre ......" | 23974361 |
hsa-miR-205-3p | bladder cancer | TP53 | "Here we report that the p53 family member and p63 ......" | 23239884 |
hsa-miR-205-3p | breast cancer | TP53 | "Oncosuppressive role of p53 induced miR 205 in tri ......" | 22578566 |
hsa-miR-205-3p | prostate cancer | TP53INP1 | "MiR 30a and miR 205 are downregulated in hypoxia a ......" | 27160121 |
hsa-miR-205-3p | prostate cancer | TP53INP1 | "MiR 205 suppresses autophagy and enhances radiosen ......" | 26813458 |
hsa-miR-205-3p | bladder cancer | TP63 | "The p63 protein isoform ΔNp63α inhibits epitheli ......" | 23239884 |
hsa-miR-205-3p | prostate cancer | TP63 | "Loss of p63 and its microRNA 205 target results in ......" | 22949650 |
hsa-miR-205-3p | cervical and endocervical cancer | AGO2 | "To further understand the biological roles of miR- ......" | 23056551 |
hsa-miR-205-3p | endometrial cancer | AKT1 | "Meanwhile the modulatory role of miR-205 in the AK ......" | 24929707 |
hsa-miR-205-3p | breast cancer | AMOT | "MicroRNA 205 inhibits the proliferation and invasi ......" | 26239614 |
hsa-miR-205-3p | prostate cancer | AR | "miR 205 negatively regulates the androgen receptor ......" | 23571738 |
hsa-miR-205-3p | prostate cancer | BCL2 | "MicroRNA 205 a novel regulator of the anti apoptot ......" | 23612742 |
hsa-miR-205-3p | prostate cancer | BCL2L2 | "By downregulating Bcl-w and E2F6 miR-205 and miR-3 ......" | 21368878 |
hsa-miR-205-3p | colorectal cancer | CAMP | "MicroRNA 205 functions as a tumor suppressor in co ......" | 26692949 |
hsa-miR-205-3p | melanoma | CASP3 | "miR-205 overexpression resulted in induction of ap ......" | 21454583 |
hsa-miR-205-3p | liver cancer | CD24 | "Down regulation of miR 205 promotes stemness of he ......" | 25997960 |
hsa-miR-205-3p | endometrial cancer | CDC37 | "MiR 205 inhibits cell apoptosis by targeting phosp ......" | 24929707 |
hsa-miR-205-3p | melanoma | CDKN2A | "Stable overexpression of miR-205 suppressed melano ......" | 21454583 |
hsa-miR-205-3p | prostate cancer | CENPF | "MicroRNA 205 inhibits cancer cell migration and in ......" | 26059417 |
hsa-miR-205-3p | sarcoma | CFD | "Among them the expression of miR-205 was down-regu ......" | 24525843 |
hsa-miR-205-3p | colorectal cancer | CREB1 | "MicroRNA 205 functions as a tumor suppressor in co ......" | 26692949 |
hsa-miR-205-3p | pancreatic cancer | CSF2 | "Forced expression in TAS cells of miR-200b/-200c a ......" | 27447559 |
hsa-miR-205-3p | melanoma | CYCS | "miR-205 overexpression resulted in induction of ap ......" | 21454583 |
hsa-miR-205-3p | prostate cancer | DICER1 | "The expression change of miR-30a miR-205 and Dicer ......" | 27160121 |
hsa-miR-205-3p | lung cancer | DOK4 | "In addition over-expression of the well known squa ......" | 21563230 |
hsa-miR-205-3p | melanoma | E2F5 | "The expression levels of E2F1 and E2F5 were correl ......" | 21454583 |
hsa-miR-205-3p | prostate cancer | E2F6 | "By downregulating Bcl-w and E2F6 miR-205 and miR-3 ......" | 21368878 |
hsa-miR-205-3p | prostate cancer | EPCAM | "Oppositely re-induction of the epithelial phenotyp ......" | 24992580 |
hsa-miR-205-3p | breast cancer | ERBB2 | "ErbB2 down regulates microRNA 205 in breast cancer ......" | 21787752 |
hsa-miR-205-3p | bladder cancer | ERVW-4 | "ΔNp63α knockdown reduced the expression of the p ......" | 23239884 |
hsa-miR-205-3p | endometrial cancer | ESRRG | "miR 205 promotes tumor proliferation and invasion ......" | 23589079 |
hsa-miR-205-3p | kidney renal cell cancer | EZH2 | "Long Noncoding RNA MALAT1 Promotes Aggressive Rena ......" | 25600645 |
hsa-miR-205-3p | breast cancer | FGF2 | "Adding VEGFA and FGF2 exogenously to chemosensitiv ......" | 27362808 |
hsa-miR-205-3p | lung squamous cell cancer | FZD3 | "Our data analysis also showed that miR-98 and miR- ......" | 25521201 |
hsa-miR-205-3p | breast cancer | HMBS | "The ups and downs of miR 205: identifying the role ......" | 20436283 |
hsa-miR-205-3p | breast cancer | HMGB3 | "Tumor suppressive function of mir 205 in breast ca ......" | 24098490 |
hsa-miR-205-3p | prostate cancer | HNRNPK | "Additionally for two genes that are deregulated in ......" | 22815235 |
hsa-miR-205-3p | bladder cancer | HOTAIR | "Furthermore a long non-coding RNA HOTAIR HOX trans ......" | 26469956 |
hsa-miR-205-3p | prostate cancer | IL24 | "In this study the authors demonstrated that miRNA- ......" | 20737563 |
hsa-miR-205-3p | prostate cancer | IL32 | "In this study the authors demonstrated that miRNA- ......" | 20737563 |
hsa-miR-205-3p | prostate cancer | IL6 | "Genes regulated by miR-205 are enriched in for exa ......" | 23571738 |
hsa-miR-205-3p | prostate cancer | KIDINS220 | "Overall such findings suggest miR-205 as a brake a ......" | 23924028 |
hsa-miR-205-3p | colorectal cancer | KLF4 | "We found that introduction of miR-205 into Caco-2W ......" | 27271572 |
hsa-miR-205-3p | breast cancer | LAMC1 | "Re-expression of miR-205 where absent strongly red ......" | 22578566 |
hsa-miR-205-3p | kidney renal cell cancer | LARP6 | "In vivo functions of miR-205 in ACHN cells were me ......" | 25427583 |
hsa-miR-205-3p | sarcoma | LRP1 | "miR 205 down regulation promotes proliferation of ......" | 24525843 |
hsa-miR-205-3p | kidney renal cell cancer | MALAT1 | "Long Noncoding RNA MALAT1 Promotes Aggressive Rena ......" | 25600645 |
hsa-miR-205-3p | lung cancer | MCL1 | "MiR 205 and miR 218 expression is associated with ......" | 25917317 |
hsa-miR-205-3p | prostate cancer | MED1 | "Epigenetic induced repression of microRNA 205 is a ......" | 22869146 |
hsa-miR-205-3p | pancreatic cancer | MIA | "Here we designed self-assembling gemcitabine conju ......" | 24836307 |
hsa-miR-205-3p | melanoma | MMS | "Our data suggest that miR-203 is a new prognostic ......" | 23638671 |
hsa-miR-205-3p | colorectal cancer | MUC2 | "We found that introduction of miR-205 into Caco-2W ......" | 27271572 |
hsa-miR-205-3p | endometrial cancer | NR4A1 | "miR 200a/miR 141 and miR 205 upregulation might be ......" | 26045795 |
hsa-miR-205-3p | liver cancer | OMA1 | "MicroRNA 205 regulates ubiquitin specific peptidas ......" | 26129839 |
hsa-miR-205-3p | prostate cancer | PCA3 | "Urinary miR 183 and miR 205 do not surpass PCA3 in ......" | 25720086 |
hsa-miR-205-3p | breast cancer | PCGF2 | "Here we demonstrate that Mel-18 negatively regulat ......" | 23474752 |
hsa-miR-205-3p | lung squamous cell cancer | PHLPP2 | "miR 205 targets PTEN and PHLPP2 to augment AKT sig ......" | 23856247 |
hsa-miR-205-3p | colon cancer | PROX1 | "Here we elucidate a molecular mechanism whereby ER ......" | 27283988 |
hsa-miR-205-3p | prostate cancer | PTK2 | "The overexpression of miR-205 suppressed c-SRC and ......" | 23974361 |
hsa-miR-205-3p | lung squamous cell cancer | RPS6KA3 | "Our data analysis also showed that miR-98 and miR- ......" | 25521201 |
hsa-miR-205-3p | prostate cancer | SETD2 | "We found that miR-205 is the most downmodulated mi ......" | 23924028 |
hsa-miR-205-3p | endometrial cancer | SNAI1 | "The overexpression of miR-205 inhibited E-cadherin ......" | 26446417 |
hsa-miR-205-3p | sarcoma | TGFA | "In this study we detected the expression level of ......" | 26708425 |
hsa-miR-205-3p | pancreatic cancer | THAS | "Forced expression in TAS cells of miR-200b/-200c a ......" | 27447559 |
hsa-miR-205-3p | colorectal cancer | TLR4 | "To investigate the effects of miR-205 and miR-373 ......" | 27271572 |
hsa-miR-205-3p | endometrial cancer | TNS1 | "MiR 205 inhibits cell apoptosis by targeting phosp ......" | 24929707 |
hsa-miR-205-3p | breast cancer | TXK | "The reintroduction of miR-205 in SKBr3 cells inhib ......" | 19276373 |
hsa-miR-205-3p | gastric cancer | YY1 | "Further analyses indicated that miR-205 was able t ......" | 24763883 |
hsa-miR-205-3p | kidney renal cell cancer | ZEB2-AS1 | "The luciferase reporter assay was used to assess Z ......" | 25427583 |