microRNA information: hsa-miR-206
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-206 | miRbase |
| Accession: | MIMAT0000462 | miRbase |
| Precursor name: | hsa-mir-206 | miRbase |
| Precursor accession: | MI0000490 | miRbase |
| Symbol: | MIR206 | HGNC |
| RefSeq ID: | NR_029713 | GenBank |
| Sequence: | UGGAAUGUAAGGAAGUGUGUGG |
Reported expression in cancers: hsa-miR-206
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-206 | breast cancer | downregulation | "Recently several microRNAs miRNAs that directly ta ......" | 21755340 | |
| hsa-miR-206 | breast cancer | downregulation | "Decreased expression of microRNA 206 in breast can ......" | 23696595 | |
| hsa-miR-206 | breast cancer | downregulation | "Downregulation of microRNA 206 promotes invasion a ......" | 27318091 | |
| hsa-miR-206 | cervical and endocervical cancer | downregulation | "Decreased microRNA 206 and its function in cervica ......" | 26775359 | qPCR |
| hsa-miR-206 | colon cancer | upregulation | "Unbiased screening of over 650 miRNAs identified m ......" | 23006636 | |
| hsa-miR-206 | colorectal cancer | upregulation | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | qPCR |
| hsa-miR-206 | colorectal cancer | upregulation | "miR 206 is an independent prognostic factor and in ......" | 26406866 | |
| hsa-miR-206 | gastric cancer | downregulation | "Downregulation of microRNA 206 is a potent prognos ......" | 23751352 | qPCR |
| hsa-miR-206 | gastric cancer | downregulation | "MicroRNA 206 suppresses gastric cancer cell growth ......" | 24855559 | |
| hsa-miR-206 | gastric cancer | downregulation | "In this study we investigated the effects of micro ......" | 26186594 | |
| hsa-miR-206 | head and neck cancer | downregulation | "Our studies of microRNA miRNA expression signature ......" | 27169691 | |
| hsa-miR-206 | kidney renal cell cancer | deregulation | "Exploring the miRNA mRNA regulatory network in cle ......" | 24977165 | RNA-Seq |
| hsa-miR-206 | liver cancer | downregulation | "MicroRNA 206 down regulated in hepatocellular carc ......" | 25436301 | qPCR |
| hsa-miR-206 | lung cancer | downregulation | "In lung adenocarcinoma tissues we demonstrated tha ......" | 27014910 | |
| hsa-miR-206 | lung cancer | downregulation | "miR-206 has recently been implicated in cancer. Ho ......" | 27446414 | |
| hsa-miR-206 | lung squamous cell cancer | downregulation | "MiR-206 is low expression in lung cancers and asso ......" | 26919096 | |
| hsa-miR-206 | ovarian cancer | downregulation | "Previous studies have demonstrated that ERα is a ......" | 24604205 | |
| hsa-miR-206 | sarcoma | upregulation | "MicroRNAs miRNAs are endogenous short approximatel ......" | 19710019 | |
| hsa-miR-206 | sarcoma | downregulation | "MicroRNA-206 has proven to be down-regulated in ma ......" | 23886177 | |
| hsa-miR-206 | sarcoma | deregulation | "Moreover the patients with low miR-133b expression ......" | 25120799 |
Reported cancer pathway affected by hsa-miR-206
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-206 | breast cancer | Apoptosis pathway | "The role of miR 206 in the epidermal growth factor ......" | 19423651 | Luciferase |
| hsa-miR-206 | breast cancer | Epithelial mesenchymal transition pathway | "MiR 206 suppresses epithelial mesenchymal transiti ......" | 27014911 | |
| hsa-miR-206 | breast cancer | Apoptosis pathway | "Regulation of the T box transcription factor Tbx3 ......" | 27100732 | Luciferase; Colony formation |
| hsa-miR-206 | cervical and endocervical cancer | Apoptosis pathway | "Decreased microRNA 206 and its function in cervica ......" | 26775359 | |
| hsa-miR-206 | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 206 attenuates tumor proliferation and mi ......" | 25607234 | |
| hsa-miR-206 | colorectal cancer | Apoptosis pathway | "MicroRNA 206 functions as a tumor suppressor in co ......" | 26515696 | Western blot; Luciferase |
| hsa-miR-206 | gastric cancer | cell cycle pathway | "miR 206 inhibits gastric cancer proliferation in p ......" | 23348698 | |
| hsa-miR-206 | gastric cancer | cell cycle pathway | "In this study we investigated the effects of micro ......" | 26186594 | Western blot |
| hsa-miR-206 | gastric cancer | cell cycle pathway | "LncRNA RMRP promotes carcinogenesis by acting as a ......" | 27192121 | RNAi; Flow cytometry; Colony formation |
| hsa-miR-206 | glioblastoma | cell cycle pathway | "MicroRNA 206 Inhibited the Progression of Glioblas ......" | 27558109 | Luciferase |
| hsa-miR-206 | head and neck cancer | MAPK signaling pathway | "Dual receptor EGFR and c MET inhibition by tumor s ......" | 27169691 | |
| hsa-miR-206 | kidney renal cell cancer | cell cycle pathway | "miR 206 functions as a novel cell cycle regulator ......" | 26808577 | Colony formation; Flow cytometry; Luciferase |
| hsa-miR-206 | liver cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 206 overexpression promotes apoptosis ind ......" | 24919811 | Flow cytometry; Cell Proliferation Assay; Wound Healing Assay; Western blot |
| hsa-miR-206 | liver cancer | Apoptosis pathway | "MicroRNA 206 down regulated in hepatocellular carc ......" | 25436301 | Cell migration assay |
| hsa-miR-206 | lung cancer | Apoptosis pathway | "MicroRNA 206 is associated with invasion and metas ......" | 21157919 | Transwell assay |
| hsa-miR-206 | lung cancer | mTOR signaling pathway | "miR 206 regulates cisplatin resistance and EMT in ......" | 27014910 | |
| hsa-miR-206 | lung squamous cell cancer | Epithelial mesenchymal transition pathway; mTOR signaling pathway | "MiR 206 inhibits HGF induced epithelial mesenchyma ......" | 26919096 | |
| hsa-miR-206 | pancreatic cancer | cell cycle pathway | "MicroRNA 206 functions as a pleiotropic modulator ......" | 25500542 | |
| hsa-miR-206 | sarcoma | Apoptosis pathway | "MicroRNA 206 expression levels correlate with clin ......" | 20502458 | |
| hsa-miR-206 | sarcoma | Apoptosis pathway | "Roles of microRNA 206 in osteosarcoma pathogenesis ......" | 23886177 |
Reported cancer prognosis affected by hsa-miR-206
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-206 | bladder cancer | progression | "Long non coding RNA Malat1 promotes gallbladder ca ......" | 27191262 | |
| hsa-miR-206 | breast cancer | metastasis | "The third identifies miR-335 miR-206 and miR-126 a ......" | 18373886 | |
| hsa-miR-206 | breast cancer | drug resistance | "The role of miR 206 in the epidermal growth factor ......" | 19423651 | Luciferase |
| hsa-miR-206 | breast cancer | staging; progression | "miR 206 is down regulated in breast cancer and inh ......" | 23466356 | Colony formation; Western blot; Luciferase |
| hsa-miR-206 | breast cancer | poor survival | "Two SNPs miR-34b/34c rs4938723 HR = 0.57 95 % CI = ......" | 23526039 | |
| hsa-miR-206 | breast cancer | poor survival; progression; staging; metastasis | "Decreased expression of microRNA 206 in breast can ......" | 23696595 | |
| hsa-miR-206 | breast cancer | metastasis | "Hsa miR 206 inhibits the migration and invasion of ......" | 24373402 | Western blot; Luciferase |
| hsa-miR-206 | breast cancer | metastasis | "The expression of miRNAs in patients with primary ......" | 24846313 | |
| hsa-miR-206 | breast cancer | metastasis | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | |
| hsa-miR-206 | breast cancer | cell migration; metastasis | "miR 206 inhibits cell migration through direct tar ......" | 25074552 | |
| hsa-miR-206 | breast cancer | progression | "Overexpression of miR 206 suppresses glycolysis pr ......" | 26093295 | |
| hsa-miR-206 | breast cancer | cell migration | "Hsa miR 206 represses the proliferation and invasi ......" | 26125274 | Luciferase |
| hsa-miR-206 | breast cancer | metastasis | "Mechanism of Regulatory Effect of MicroRNA 206 on ......" | 26879016 | Western blot; Luciferase |
| hsa-miR-206 | breast cancer | staging; metastasis | "MiR 206 suppresses epithelial mesenchymal transiti ......" | 27014911 | |
| hsa-miR-206 | breast cancer | poor survival | "Regulation of the T box transcription factor Tbx3 ......" | 27100732 | Luciferase; Colony formation |
| hsa-miR-206 | breast cancer | metastasis; progression; drug resistance | "MicroRNA 206 inhibits stemness and metastasis of b ......" | 27435395 | |
| hsa-miR-206 | cervical and endocervical cancer | progression; tumorigenesis; staging; metastasis; differentiation; poor survival | "Decreased microRNA 206 and its function in cervica ......" | 26775359 | |
| hsa-miR-206 | colorectal cancer | metastasis; progression | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | |
| hsa-miR-206 | colorectal cancer | malignant trasformation | "MicroRNA 206 attenuates tumor proliferation and mi ......" | 25607234 | |
| hsa-miR-206 | colorectal cancer | poor survival; cell migration | "miR 206 is an independent prognostic factor and in ......" | 26406866 | |
| hsa-miR-206 | colorectal cancer | metastasis; differentiation; progression; malignant trasformation | "MicroRNA 206 functions as a tumor suppressor in co ......" | 26515696 | Western blot; Luciferase |
| hsa-miR-206 | colorectal cancer | poor survival | "The expression levels of miR-206 miR-219 miR-192 m ......" | 27666868 | |
| hsa-miR-206 | gastric cancer | progression; tumorigenesis; staging; metastasis; recurrence; poor survival | "Downregulation of microRNA 206 is a potent prognos ......" | 23751352 | |
| hsa-miR-206 | gastric cancer | metastasis; staging; tumorigenesis; cell migration | "MicroRNA 206 suppresses gastric cancer cell growth ......" | 24855559 | Colony formation |
| hsa-miR-206 | gastric cancer | metastasis | "Activation of PAX3 MET pathways due to miR 206 los ......" | 25653235 | Transwell assay |
| hsa-miR-206 | gastric cancer | worse prognosis; staging; metastasis; poor survival | "Prognostic significance of combined microRNA 206 a ......" | 25960238 | |
| hsa-miR-206 | gastric cancer | tumorigenesis; staging | "LncRNA RMRP promotes carcinogenesis by acting as a ......" | 27192121 | RNAi; Flow cytometry; Colony formation |
| hsa-miR-206 | glioblastoma | progression; poor survival | "MicroRNA 206 Inhibited the Progression of Glioblas ......" | 27558109 | Luciferase |
| hsa-miR-206 | head and neck cancer | progression | "Several miRNAs miRLet-7A miR-1 miR-206 miR-153 miR ......" | 26239836 | |
| hsa-miR-206 | head and neck cancer | staging | "Dual receptor EGFR and c MET inhibition by tumor s ......" | 27169691 | |
| hsa-miR-206 | kidney renal cell cancer | tumorigenesis | "With the advent of second-generation sequencing th ......" | 21253009 | |
| hsa-miR-206 | liver cancer | progression; tumorigenesis; staging; metastasis; differentiation | "MicroRNA 206 down regulated in hepatocellular carc ......" | 25436301 | Cell migration assay |
| hsa-miR-206 | liver cancer | staging | "In the discovery stage 2 serum samples pooled from ......" | 25962820 | |
| hsa-miR-206 | lung cancer | metastasis; motility | "MicroRNA 206 is associated with invasion and metas ......" | 21157919 | Transwell assay |
| hsa-miR-206 | lung cancer | tumorigenesis; differentiation | "Quantitative proteomics and protein network analys ......" | 24390363 | |
| hsa-miR-206 | lung cancer | metastasis; cell migration | "Comprehensive gene and microRNA expression profili ......" | 26075299 | Wound Healing Assay; Luciferase |
| hsa-miR-206 | lung cancer | drug resistance; cell migration | "miR 206 regulates cisplatin resistance and EMT in ......" | 27014910 | |
| hsa-miR-206 | lung squamous cell cancer | metastasis; cell migration | "MiR 206 inhibits HGF induced epithelial mesenchyma ......" | 26919096 | |
| hsa-miR-206 | melanoma | worse prognosis; staging; poor survival; progression | "Decreased serum microRNA 206 level predicts unfavo ......" | 26045823 | |
| hsa-miR-206 | pancreatic cancer | progression | "MicroRNA 206 functions as a pleiotropic modulator ......" | 25500542 | |
| hsa-miR-206 | prostate cancer | progression | "Micro RNAs were isolated using the mirVana miRNA I ......" | 21880514 | |
| hsa-miR-206 | sarcoma | differentiation | "The muscle specific microRNA miR 206 blocks human ......" | 19620785 | |
| hsa-miR-206 | sarcoma | drug resistance; poor survival; staging; metastasis; differentiation | "MicroRNA 206 expression levels correlate with clin ......" | 20502458 | |
| hsa-miR-206 | sarcoma | differentiation | "miR 206 integrates multiple components of differen ......" | 22541669 | |
| hsa-miR-206 | sarcoma | progression; malignant trasformation; staging; metastasis; differentiation | "Roles of microRNA 206 in osteosarcoma pathogenesis ......" | 23886177 | |
| hsa-miR-206 | sarcoma | malignant trasformation | "SMARCB1 expression in epithelioid sarcoma is regul ......" | 24327545 | |
| hsa-miR-206 | sarcoma | worse prognosis; metastasis; recurrence; poor survival; progression; tumorigenesis | "Serum levels of microRNA 133b and microRNA 206 exp ......" | 25120799 | |
| hsa-miR-206 | sarcoma | differentiation | "SMYD1 and G6PD modulation are critical events for ......" | 25644430 | Colony formation |
| hsa-miR-206 | sarcoma | malignant trasformation | "Epigenetic regulation of SMARCB1 By miR 206 381 an ......" | 27223121 | |
| hsa-miR-206 | thyroid cancer | metastasis | "miR 206 inhibits metastasis relevant traits by deg ......" | 25955685 |
Reported gene related to hsa-miR-206
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-206 | breast cancer | ESR1 | "The micro ribonucleic acid miRNA miR 206 targets t ......" | 17312270 |
| hsa-miR-206 | breast cancer | ESR1 | "MiR 206 suppresses epithelial mesenchymal transiti ......" | 27014911 |
| hsa-miR-206 | breast cancer | ESR1 | "miR 206 Expression is down regulated in estrogen r ......" | 18593897 |
| hsa-miR-206 | breast cancer | ESR1 | "17β-estradiol dose-dependently decreased miR-206 ......" | 26093295 |
| hsa-miR-206 | ovarian cancer | ESR1 | "microRNA 206 overexpression inhibits cellular prol ......" | 24604205 |
| hsa-miR-206 | colorectal cancer | MET | "Real-time RT-PCR or Western blotting was used to d ......" | 26515696 |
| hsa-miR-206 | gastric cancer | MET | "Conversely upregulation of c-Met was confirmed in ......" | 26186594 |
| hsa-miR-206 | head and neck cancer | MET | "Dual receptor EGFR and c MET inhibition by tumor s ......" | 27169691 |
| hsa-miR-206 | lung squamous cell cancer | MET | "MiR 206 inhibits HGF induced epithelial mesenchyma ......" | 26919096 |
| hsa-miR-206 | breast cancer | EGFR | "In conclusion miR-206 contributes to EGFR-mediated ......" | 19423651 |
| hsa-miR-206 | head and neck cancer | EGFR | "Dual receptor EGFR and c MET inhibition by tumor s ......" | 27169691 |
| hsa-miR-206 | lung squamous cell cancer | EGFR | "Tumor suppressive microRNA 206 as a dual inhibitor ......" | 25522678 |
| hsa-miR-206 | breast cancer | GJA1 | "Hsa miR 206 inhibits the migration and invasion of ......" | 24373402 |
| hsa-miR-206 | breast cancer | GJA1 | "Mechanism of Regulatory Effect of MicroRNA 206 on ......" | 26879016 |
| hsa-miR-206 | breast cancer | GJA1 | "Hsa miR 206 represses the proliferation and invasi ......" | 26125274 |
| hsa-miR-206 | gastric cancer | CCND2 | "To investigate associations of microRNA miR-206 an ......" | 25960238 |
| hsa-miR-206 | gastric cancer | CCND2 | "Further studies demonstrated that miR-206 could su ......" | 23348698 |
| hsa-miR-206 | sarcoma | KIDINS220 | "Here we show that SMYD1 silencing does not interfe ......" | 25644430 |
| hsa-miR-206 | sarcoma | KIDINS220 | "We found that HO-1 was elevated and its effector t ......" | 27488535 |
| hsa-miR-206 | pancreatic cancer | ANXA2 | "MicroRNA 206 functions as a pleiotropic modulator ......" | 25500542 |
| hsa-miR-206 | glioblastoma | BCL2 | "MicroRNA 206 Inhibited the Progression of Glioblas ......" | 27558109 |
| hsa-miR-206 | breast cancer | BRCA1 | "Decreased miR 206 expression in BRCA1 wild type tr ......" | 25202071 |
| hsa-miR-206 | breast cancer | BRD2 | "MiR-206 levels in matched pairs of cancer tissue a ......" | 23696595 |
| hsa-miR-206 | liver cancer | CASP3 | "In addition we measured the expression of miR-206 ......" | 24919811 |
| hsa-miR-206 | liver cancer | CASR | "However the role of miR-206 in human hepatocellula ......" | 24919811 |
| hsa-miR-206 | melanoma | CDK4 | "MicroRNA 206 induces G1 arrest in melanoma by inhi ......" | 24289491 |
| hsa-miR-206 | breast cancer | CORO1C | "In this study we show that miR-206 was decreased i ......" | 25074552 |
| hsa-miR-206 | thyroid cancer | CYP19A1 | "miR-206 was negatively associated with metastasis ......" | 25955685 |
| hsa-miR-206 | colorectal cancer | FMNL2 | "MicroRNA 206 functions as a tumor suppressor in co ......" | 26515696 |
| hsa-miR-206 | sarcoma | G6PD | "SMYD1 and G6PD modulation are critical events for ......" | 25644430 |
| hsa-miR-206 | sarcoma | HDAC4 | "Heme Oxygenase 1 Controls an HDAC4 miR 206 Pathway ......" | 27488535 |
| hsa-miR-206 | sarcoma | HDAC9 | "Effects of SnPP on miR-206 expression and RMS tumo ......" | 27488535 |
| hsa-miR-206 | lung squamous cell cancer | HGF | "MiR 206 inhibits HGF induced epithelial mesenchyma ......" | 26919096 |
| hsa-miR-206 | sarcoma | HMOX1 | "Heme Oxygenase 1 Controls an HDAC4 miR 206 Pathway ......" | 27488535 |
| hsa-miR-206 | colon cancer | KLF4 | "Computational modeling highlighted the stem-cell m ......" | 23006636 |
| hsa-miR-206 | pancreatic cancer | KRAS | "MicroRNA 206 functions as a pleiotropic modulator ......" | 25500542 |
| hsa-miR-206 | breast cancer | LOC100128922 | "Mechanism of Regulatory Effect of MicroRNA 206 on ......" | 26879016 |
| hsa-miR-206 | bladder cancer | MALAT1 | "Long non coding RNA Malat1 promotes gallbladder ca ......" | 27191262 |
| hsa-miR-206 | thyroid cancer | MKL1 | "miR 206 inhibits metastasis relevant traits by deg ......" | 25955685 |
| hsa-miR-206 | breast cancer | MMP2 | "Up-regulation of miR-206 in TNBC contributed to a ......" | 26125274 |
| hsa-miR-206 | breast cancer | MMP9 | "Up-regulation of miR-206 in TNBC contributed to a ......" | 26125274 |
| hsa-miR-206 | sarcoma | MSC | "The inhibitory transcription factor MSC also plays ......" | 22541669 |
| hsa-miR-206 | sarcoma | MYOD1 | "The inhibitory transcription factor MSC also plays ......" | 22541669 |
| hsa-miR-206 | sarcoma | NFKB1 | "High miR-206 expression strongly correlated with g ......" | 20502458 |
| hsa-miR-206 | colorectal cancer | NOTCH3 | "MicroRNA 206 attenuates tumor proliferation and mi ......" | 25607234 |
| hsa-miR-206 | breast cancer | PARP1 | "Decreased miR 206 expression in BRCA1 wild type tr ......" | 25202071 |
| hsa-miR-206 | gastric cancer | PAX3 | "Activation of PAX3 MET pathways due to miR 206 los ......" | 25653235 |
| hsa-miR-206 | melanoma | PCNA | "MicroRNA 206 induces G1 arrest in melanoma by inhi ......" | 24289491 |
| hsa-miR-206 | sarcoma | PDP1 | "As an alternative we used DCA in combination with ......" | 25644430 |
| hsa-miR-206 | breast cancer | PFKFB3 | "Overexpression of miR 206 suppresses glycolysis pr ......" | 26093295 |
| hsa-miR-206 | gastric cancer | RMRP | "LncRNA RMRP promotes carcinogenesis by acting as a ......" | 27192121 |
| hsa-miR-206 | sarcoma | RUNX1 | "Modulation of the transcription factors RUNX1 and ......" | 22541669 |
| hsa-miR-206 | sarcoma | SMYD1 | "SMYD1 and G6PD modulation are critical events for ......" | 25644430 |
| hsa-miR-206 | lung cancer | SNAI1 | "In addition we revealed that miR-206 overexpressio ......" | 27014910 |
| hsa-miR-206 | lung squamous cell cancer | SOX9 | "miR 206 inhibits non small cell lung cancer cell p ......" | 26309565 |
| hsa-miR-206 | breast cancer | TBX3 | "Regulation of the T box transcription factor Tbx3 ......" | 27100732 |
| hsa-miR-206 | breast cancer | VEGFA | "Additionally the decreased levels of miR-206 were ......" | 27318091 |
| hsa-miR-206 | sarcoma | ZBTB18 | "Modulation of the transcription factors RUNX1 and ......" | 22541669 |
| hsa-miR-206 | lung cancer | ZEB1 | "In addition we revealed that miR-206 overexpressio ......" | 27014910 |