microRNA information: hsa-miR-21-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-21-3p | miRbase |
Accession: | MIMAT0004494 | miRbase |
Precursor name: | hsa-mir-21 | miRbase |
Precursor accession: | MI0000077 | miRbase |
Symbol: | MIR21 | HGNC |
RefSeq ID: | NR_029493 | GenBank |
Sequence: | CAACACCAGUCGAUGGGCUGU |
Reported expression in cancers: hsa-miR-21-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-21-3p | B cell lymphoma | upregulation | "Clinical significance and detection of microRNA 21 ......" | 24400911 | |
hsa-miR-21-3p | B cell lymphoma | upregulation | "Expression and clinical significance of miR 21 in ......" | 24763002 | qPCR |
hsa-miR-21-3p | bladder cancer | upregulation | "To investigate a potential alteration in the expre ......" | 24078506 | qPCR |
hsa-miR-21-3p | breast cancer | upregulation | "MicroRNA miR 21 overexpression in human breast can ......" | 18812439 | Microarray; qPCR |
hsa-miR-21-3p | breast cancer | upregulation | "Clinical significance of miR 21 expression in brea ......" | 19212625 | qPCR |
hsa-miR-21-3p | breast cancer | upregulation | "The microRNA-21 gene miR-21 has been reported to b ......" | 19308091 | |
hsa-miR-21-3p | breast cancer | upregulation | "A key oncomir in carcinogenesis is miR-21 which is ......" | 21219636 | Microarray |
hsa-miR-21-3p | breast cancer | upregulation | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | qPCR |
hsa-miR-21-3p | breast cancer | upregulation | "High expression of miR 21 in tumor stroma correlat ......" | 21917003 | in situ hybridization |
hsa-miR-21-3p | breast cancer | upregulation | "MicroRNA expression profiles have been used for th ......" | 24930006 | |
hsa-miR-21-3p | breast cancer | upregulation | "Differential expression of miR 139 miR 486 and miR ......" | 25027758 | qPCR; Microarray |
hsa-miR-21-3p | breast cancer | upregulation | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | qPCR; in situ hybridization |
hsa-miR-21-3p | breast cancer | upregulation | "Among these we identified miRNAs previously associ ......" | 25277099 | |
hsa-miR-21-3p | breast cancer | upregulation | "Stromal expression of miR 21 identifies high risk ......" | 25440114 | |
hsa-miR-21-3p | breast cancer | upregulation | "Serum microRNA 21 as a potential diagnostic biomar ......" | 25516467 | |
hsa-miR-21-3p | breast cancer | upregulation | "Upregulation of miR-21 microRNA-21 and downregulat ......" | 25647415 | |
hsa-miR-21-3p | breast cancer | upregulation | "Circulating miR-21 is upregulated in breast cancer ......" | 25669446 | |
hsa-miR-21-3p | breast cancer | upregulation | "Prediction of poor prognosis in breast cancer pati ......" | 25706383 | |
hsa-miR-21-3p | breast cancer | upregulation | "In this study we reported that miR-21 was highly e ......" | 25735723 | |
hsa-miR-21-3p | breast cancer | upregulation | "MicroRNA-21 miR-21 on chromosome 17q21.3 is one of ......" | 26342497 | |
hsa-miR-21-3p | breast cancer | upregulation | "High expression levels of miR 21 and miR 210 predi ......" | 26349663 | |
hsa-miR-21-3p | breast cancer | upregulation | "Diagnostic prognostic and predictive value of Micr ......" | 26396924 | Reverse transcription PCR |
hsa-miR-21-3p | breast cancer | upregulation | "Advances in Research on miR 21 and Breast Cancer. ......" | 26486006 | |
hsa-miR-21-3p | breast cancer | upregulation | "A key oncomir in carcinogenesis is miR-21 which is ......" | 26549725 | qPCR |
hsa-miR-21-3p | breast cancer | upregulation | "The function of MiR 21 expression differences and ......" | 27113307 | qPCR |
hsa-miR-21-3p | breast cancer | upregulation | "Serum microRNA 21 expression as a prognostic and t ......" | 27696295 | qPCR |
hsa-miR-21-3p | cervical and endocervical cancer | upregulation | "Increased exosomal microRNA 21 and microRNA 146a l ......" | 24406730 | qPCR |
hsa-miR-21-3p | cervical and endocervical cancer | upregulation | "Although multiple miRNAs are found involved in rad ......" | 25769949 | |
hsa-miR-21-3p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
hsa-miR-21-3p | cervical and endocervical cancer | upregulation | "This study aimed to characterize the miR-21 and ev ......" | 26261606 | |
hsa-miR-21-3p | cervical and endocervical cancer | upregulation | "However the underlying mechanism of miR-21 upregul ......" | 27220494 | |
hsa-miR-21-3p | colon cancer | downregulation | "Downregulation of TGFβR2 could be attributed to d ......" | 22072622 | |
hsa-miR-21-3p | colon cancer | downregulation | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | Microarray; qPCR |
hsa-miR-21-3p | colorectal cancer | upregulation | "Altered expression of miR 21 miR 31 miR 143 and mi ......" | 18196926 | qPCR |
hsa-miR-21-3p | colorectal cancer | upregulation | "Locked nucleic acid in situ hybridization analysis ......" | 19509156 | in situ hybridization |
hsa-miR-21-3p | colorectal cancer | upregulation | "Clinicopathological significance of microRNA 21 an ......" | 19921579 | qPCR |
hsa-miR-21-3p | colorectal cancer | upregulation | "High levels of microRNA 21 in the stroma of colore ......" | 21069438 | in situ hybridization |
hsa-miR-21-3p | colorectal cancer | upregulation | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | qPCR |
hsa-miR-21-3p | colorectal cancer | upregulation | "Expression of miR 21 miR 31 miR 96 and miR 135b is ......" | 22844381 | qPCR |
hsa-miR-21-3p | colorectal cancer | upregulation | "In this study we show that the expression of miR-2 ......" | 23174819 | |
hsa-miR-21-3p | colorectal cancer | upregulation | "Serum miR 21 as a diagnostic and prognostic biomar ......" | 23704278 | |
hsa-miR-21-3p | colorectal cancer | upregulation | "Prognostic role of microRNA 21 in colorectal cance ......" | 24265822 | |
hsa-miR-21-3p | colorectal cancer | upregulation | "Clinical significance of microRNA 21 as a biomarke ......" | 25421755 | Microarray |
hsa-miR-21-3p | colorectal cancer | upregulation | "Diagnostic value of circulating miR 21 for colorec ......" | 25524942 | |
hsa-miR-21-3p | colorectal cancer | upregulation | "Stromal expression of miR 21 in T3 4a colorectal c ......" | 25609245 | in situ hybridization |
hsa-miR-21-3p | colorectal cancer | upregulation | "Novel evidence for an oncogenic role of microRNA 2 ......" | 25994220 | |
hsa-miR-21-3p | colorectal cancer | upregulation | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | RNA-Seq |
hsa-miR-21-3p | colorectal cancer | upregulation | "Investigation of MicroRNA 21 Expression Levels in ......" | 27432735 | qPCR |
hsa-miR-21-3p | colorectal cancer | upregulation | "MicroRNA-21 miR-21 is up-regulated in many cancers ......" | 27495250 | |
hsa-miR-21-3p | endometrial cancer | upregulation | "MiR-21 has been identified as one of the most comm ......" | 27655698 | |
hsa-miR-21-3p | esophageal cancer | upregulation | "MicroRNA 21 regulates the proliferation and invasi ......" | 19276261 | in situ hybridization |
hsa-miR-21-3p | esophageal cancer | upregulation | "Clinical impact of serum exosomal microRNA 21 as a ......" | 23224754 | qPCR |
hsa-miR-21-3p | esophageal cancer | upregulation | "By Agilent microarray six deregulated miRNAs from ......" | 23560033 | Microarray; qPCR |
hsa-miR-21-3p | esophageal cancer | upregulation | "We measured the serum levels of miR-21 miR-145 miR ......" | 23838916 | qPCR |
hsa-miR-21-3p | esophageal cancer | upregulation | "miR-21 a putative tumor oncomiR is a frequently ov ......" | 24221338 | |
hsa-miR-21-3p | esophageal cancer | upregulation | "We found that there was an overexpression of miR-2 ......" | 24756761 | |
hsa-miR-21-3p | esophageal cancer | upregulation | "Plasma levels of miR-16 miR-21 miR-22 miR-126 miR- ......" | 26221263 | qPCR |
hsa-miR-21-3p | esophageal cancer | upregulation | "Importantly the high ESCC marked-ZD esophagus had ......" | 26918602 | |
hsa-miR-21-3p | esophageal cancer | upregulation | "The present study explored the function of exosome ......" | 27035745 | |
hsa-miR-21-3p | gastric cancer | upregulation | "miR 21 microRNA expression in human gastric carcin ......" | 18507035 | qPCR |
hsa-miR-21-3p | gastric cancer | upregulation | "The most highly expressed miRNAs in gastric cancer ......" | 19175831 | |
hsa-miR-21-3p | gastric cancer | upregulation | "We found that miR-16 and miR-21 were upregulated u ......" | 21081469 | |
hsa-miR-21-3p | gastric cancer | upregulation | "In the analysis by real-time PCR-based miRNA array ......" | 22407237 | qPCR; Microarray |
hsa-miR-21-3p | gastric cancer | upregulation | "One prominent oncogenic microRNA miR-21 was previo ......" | 22464652 | |
hsa-miR-21-3p | gastric cancer | upregulation | "miR 21 Is a Promising Novel Biomarker for Lymph No ......" | 22792096 | |
hsa-miR-21-3p | gastric cancer | upregulation | "Prognostic impact of circulating miR 21 in the pla ......" | 23267156 | |
hsa-miR-21-3p | gastric cancer | upregulation | "microRNA-21 miR-21 has been implicated in many can ......" | 23466500 | |
hsa-miR-21-3p | gastric cancer | upregulation | "Elevated expression of mature miR 21 and miR 155 i ......" | 23554630 | |
hsa-miR-21-3p | gastric cancer | upregulation | "We identified five miRNAs that were most consisten ......" | 24040025 | qPCR |
hsa-miR-21-3p | gastric cancer | upregulation | "MicroRNA microarray was applied to assess the miRN ......" | 24054006 | Microarray |
hsa-miR-21-3p | gastric cancer | upregulation | "Overexpression of miR-21 significantly suppressed ......" | 24154840 | |
hsa-miR-21-3p | gastric cancer | upregulation | "MiR-21 is the most consistently reported miRNA wit ......" | 24337687 | |
hsa-miR-21-3p | gastric cancer | upregulation | "In the group of consistently reported microRNAs mi ......" | 24902858 | |
hsa-miR-21-3p | gastric cancer | upregulation | "Expression Analysis of mir 21 and mir 221 in Cance ......" | 26209976 | qPCR |
hsa-miR-21-3p | gastric cancer | upregulation | "Moreover over-expression of miR-21 significantly d ......" | 27040946 | |
hsa-miR-21-3p | gastric cancer | upregulation | "Significance of microRNA 21 in gastric cancer. Rec ......" | 27179559 | |
hsa-miR-21-3p | glioblastoma | upregulation | "MiR-21 up-regulation has been reported for the maj ......" | 18829576 | |
hsa-miR-21-3p | glioblastoma | upregulation | "In this study we examined the expression levels of ......" | 20353279 | qPCR |
hsa-miR-21-3p | glioblastoma | upregulation | "Here we demonstrate for the first time that platel ......" | 22922228 | |
hsa-miR-21-3p | glioblastoma | upregulation | "Single-stranded antisense miR-21 inhibitor anti-mi ......" | 24969623 | |
hsa-miR-21-3p | glioblastoma | upregulation | "The expression of miRNA-21 was detected by quantit ......" | 25394756 | qPCR |
hsa-miR-21-3p | head and neck cancer | upregulation | "Notable was the high expression of miR-21 and miR- ......" | 17475218 | Northern blot |
hsa-miR-21-3p | head and neck cancer | upregulation | "In this present study the expression profiles of t ......" | 22811001 | qPCR |
hsa-miR-21-3p | head and neck cancer | upregulation | "Our findings showed that significant elevated expr ......" | 25677760 | |
hsa-miR-21-3p | head and neck cancer | upregulation | "To explore circulating miRNAs as cancer therapy bi ......" | 25950115 | qPCR; Microarray |
hsa-miR-21-3p | kidney renal cell cancer | upregulation | "We selected 28 clear-cell type human renal cell ca ......" | 20035975 | qPCR |
hsa-miR-21-3p | kidney renal cell cancer | upregulation | "Up regulation of microRNA 21 correlates with lower ......" | 22347428 | qPCR |
hsa-miR-21-3p | kidney renal cell cancer | upregulation | "The clinical utility of miR 21 as a diagnostic and ......" | 22580180 | qPCR |
hsa-miR-21-3p | kidney renal cell cancer | upregulation | "MiR-21 expression was significantly upregulated in ......" | 24902663 | |
hsa-miR-21-3p | liver cancer | upregulation | "We evaluated the expression of miRNA in human hepa ......" | 17681183 | Microarray |
hsa-miR-21-3p | liver cancer | upregulation | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
hsa-miR-21-3p | liver cancer | upregulation | "Serum microRNA 21 as marker for necroinflammation ......" | 22066022 | |
hsa-miR-21-3p | liver cancer | upregulation | "In the present study we identified the role of mic ......" | 22322403 | |
hsa-miR-21-3p | liver cancer | upregulation | "The microarray results were validated by quantitat ......" | 22977465 | qPCR; Microarray |
hsa-miR-21-3p | liver cancer | upregulation | "We determined the expression levels of the most fr ......" | 23229173 | qPCR |
hsa-miR-21-3p | liver cancer | upregulation | "We observed that oncogenic miR-21 was upregulated ......" | 25087183 | |
hsa-miR-21-3p | liver cancer | upregulation | "It has been reported that miR-21 is upregulated in ......" | 25687183 | |
hsa-miR-21-3p | liver cancer | upregulation | "Anti miR 21 Suppresses Hepatocellular Carcinoma Gr ......" | 25758165 | |
hsa-miR-21-3p | liver cancer | upregulation | "Significance of serum microRNA 21 in diagnosis of ......" | 25973032 | |
hsa-miR-21-3p | liver cancer | upregulation | "Increased expression of miR 21 predicts poor progn ......" | 26261620 | qPCR |
hsa-miR-21-3p | liver cancer | upregulation | "MicroRNAs miRNAs are reported as a group of small ......" | 26302751 | qPCR |
hsa-miR-21-3p | liver cancer | upregulation | "Both miR-21 and miR-183 are upregulated in hepatoc ......" | 26400524 | qPCR |
hsa-miR-21-3p | lung cancer | upregulation | "High expression of serum miR 21 and tumor miR 200c ......" | 21516486 | Microarray; Reverse transcription PCR; qPCR |
hsa-miR-21-3p | lung cancer | upregulation | "In the panel of consistently reported up-regulated ......" | 22672859 | |
hsa-miR-21-3p | lung cancer | upregulation | "Evaluation of dynamic change of serum miR 21 and m ......" | 22782668 | Reverse transcription PCR; qPCR |
hsa-miR-21-3p | lung cancer | upregulation | "Detection of lung cancer with blood microRNA 21 ex ......" | 22866162 | Reverse transcription PCR; qPCR |
hsa-miR-21-3p | lung cancer | upregulation | "However for each cell subtype we identified miRNAs ......" | 25344866 | |
hsa-miR-21-3p | lung cancer | upregulation | "MicroRNA-21 miR-21 is an oncomiR that is frequentl ......" | 26741162 | |
hsa-miR-21-3p | lung cancer | upregulation | "Two miRNAs miR-21 and miR-155 were found to be sig ......" | 26867772 | |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "Prognostic value of mature microRNA 21 and microRN ......" | 18719201 | qPCR |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "In our previous study we have shown that expressio ......" | 22956424 | qPCR |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "We further validated our results by RT-qPCR for di ......" | 23756108 | qPCR |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "Expression of microRNA 21 in non small cell lung c ......" | 24452750 | Northern blot |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "Serum miR 152 miR 148a miR 148b and miR 21 as nove ......" | 25501703 | qPCR |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "MicroRNA 21 regulates non small cell lung cancer c ......" | 26309536 | qPCR |
hsa-miR-21-3p | lung squamous cell cancer | upregulation | "Up Regulation of miR 21 Expression Predicate Advan ......" | 26453197 | qPCR |
hsa-miR-21-3p | lymphoma | upregulation | "Relevance of miR 21 in HIV and non HIV related lym ......" | 24961346 | |
hsa-miR-21-3p | lymphoma | upregulation | "Overexpression of microRNA 21 in peripheral blood ......" | 26439034 | |
hsa-miR-21-3p | melanoma | upregulation | "Overexpression of microRNA-21 miR-21 has been obse ......" | 22716245 | |
hsa-miR-21-3p | melanoma | upregulation | "Arsenic exposed Keratinocytes Exhibit Differential ......" | 27054085 | qPCR |
hsa-miR-21-3p | ovarian cancer | upregulation | "We analyzed the miRNA expression profiles of prima ......" | 23554878 | qPCR |
hsa-miR-21-3p | ovarian cancer | upregulation | "Real-time quantitative PCR was used to determine t ......" | 25744846 | qPCR |
hsa-miR-21-3p | ovarian cancer | upregulation | "Human epididymis protein 4 expression positively c ......" | 26733162 | Microarray |
hsa-miR-21-3p | pancreatic cancer | upregulation | "Whereas the expression of miR-21 a frequently up-r ......" | 22261338 | |
hsa-miR-21-3p | pancreatic cancer | upregulation | "Chromatin immunoprecipitation assays were used to ......" | 23726431 | |
hsa-miR-21-3p | pancreatic cancer | upregulation | "Four miRNAs miR-17-5p miR-21 miR-155 and miR-196a ......" | 24007214 | |
hsa-miR-21-3p | pancreatic cancer | upregulation | "Stromal microRNA 21 levels predict response to 5 f ......" | 25132574 | in situ hybridization |
hsa-miR-21-3p | pancreatic cancer | upregulation | "Circulating miR 483 3p and miR 21 is highly expres ......" | 25384963 | qPCR |
hsa-miR-21-3p | pancreatic cancer | upregulation | "We identified hsa-miR-21 hsa-miR-23a hsa-miR-23b a ......" | 26121640 | |
hsa-miR-21-3p | prostate cancer | upregulation | "The effect of normalization was tested with miR-21 ......" | 22788411 | |
hsa-miR-21-3p | prostate cancer | upregulation | "Association of microRNA 21 expression with clinico ......" | 27040772 | qPCR; in situ hybridization |
hsa-miR-21-3p | prostate cancer | upregulation | "PBMC were extracted to examine the relative expres ......" | 27434290 | |
hsa-miR-21-3p | prostate cancer | upregulation | "miR 15/miR 16 loss miR 21 upregulation or deregula ......" | 27652312 | |
hsa-miR-21-3p | retinoblastoma | downregulation | "Seed targeting anti miR 21 inhibiting malignant pr ......" | 24607444 | |
hsa-miR-21-3p | sarcoma | deregulation | "MicroRNA expression was profiled in samples of nor ......" | 21693658 | Microarray; RNA-Seq |
hsa-miR-21-3p | thyroid cancer | downregulation | "Antisense miR 21 enhances differentiation/apoptosi ......" | 26289851 |
Reported cancer pathway affected by hsa-miR-21-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-21-3p | B cell lymphoma | Apoptosis pathway | "OncomiR addiction in an in vivo model of microRNA ......" | 20693987 | |
hsa-miR-21-3p | B cell lymphoma | PI3K/Akt signaling pathway | "MicroRNA 21 regulates the sensitivity of diffuse l ......" | 23275230 | Luciferase |
hsa-miR-21-3p | B cell lymphoma | Apoptosis pathway | "Inhibition of miR 21 induces biological and behavi ......" | 23548551 | Western blot; Luciferase |
hsa-miR-21-3p | B cell lymphoma | Apoptosis pathway | "MicroRNA-21 miR-21 is considered to play a key rol ......" | 25543482 | Western blot; Luciferase |
hsa-miR-21-3p | bladder cancer | Apoptosis pathway | "microRNA 21 modulates cell proliferation and sensi ......" | 21468550 | Western blot; Flow cytometry |
hsa-miR-21-3p | bladder cancer | cell cycle pathway | "microRNA 21 Regulates Cell Proliferation and Migra ......" | 26230405 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "Programmed cell death 4 PDCD4 is an important func ......" | 17991735 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "Hyaluronan CD44 interaction with protein kinase Ce ......" | 19633292 | |
hsa-miR-21-3p | breast cancer | cell cycle pathway | "33' Diindolylmethane negatively regulates Cdc25A a ......" | 20724916 | Western blot |
hsa-miR-21-3p | breast cancer | cell cycle pathway | "Up regulation of miR 21 mediates resistance to tra ......" | 21471222 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "MicroRNA 21 modulates chemosensitivity of breast c ......" | 21820606 | MTT assay; Western blot; Flow cytometry; Luciferase |
hsa-miR-21-3p | breast cancer | Epithelial mesenchymal transition pathway | "MiR 21 regulates epithelial mesenchymal transition ......" | 22435731 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "DNA damage induces NF κB dependent microRNA 21 up ......" | 22547075 | |
hsa-miR-21-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "Cell viability was analyzed by MTT assay; After MC ......" | 22832383 | MTT assay; Flow cytometry; Western blot |
hsa-miR-21-3p | breast cancer | cell cycle pathway | "Radiation resistance due to high expression of miR ......" | 23216894 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "In vivo monitoring of angiogenesis inhibition via ......" | 23951172 | Western blot |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "miR 21 targets Fas ligand mediated apoptosis in br ......" | 24710931 | Western blot; Luciferase; Flow cytometry |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "High expression of miR 21 in triple negative breas ......" | 24930006 | |
hsa-miR-21-3p | breast cancer | PI3K/Akt signaling pathway | "The regulation and function of miR 21 FOXO3a miR 3 ......" | 25647415 | |
hsa-miR-21-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA-21 miR-21 inhibition is a promising biolo ......" | 26169933 | Western blot |
hsa-miR-21-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "To investigate the effects of miR-21 on paclitaxel ......" | 26555418 | Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | breast cancer | PI3K/Akt signaling pathway | "PIK3R1 targeting by miR 21 suppresses tumor cell m ......" | 26676464 | Luciferase |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "Kallistatin inhibited oncogenic miR-21 synthesis a ......" | 26790955 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "Silencing of MicroRNA 21 confers the sensitivity t ......" | 26796263 | |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "Deregulation of miR 21 and miR 155 and their putat ......" | 26877850 | |
hsa-miR-21-3p | breast cancer | cell cycle pathway | "The effect of ZA on cell viability was measured by ......" | 26905520 | MTT assay; Flow cytometry; Western blot |
hsa-miR-21-3p | breast cancer | Apoptosis pathway | "Silibinin Induced Apoptosis and Downregulation of ......" | 27066095 | |
hsa-miR-21-3p | cervical and endocervical cancer | Apoptosis pathway | "Long noncoding RNA MEG3 is downregulated in cervic ......" | 26574780 | |
hsa-miR-21-3p | cervical and endocervical cancer | Apoptosis pathway | "Relevance of miR 21 in regulation of tumor suppres ......" | 26975392 | Luciferase |
hsa-miR-21-3p | cervical and endocervical cancer | mTOR signaling pathway | "MiR 21 modulates radiosensitivity of cervical canc ......" | 27220494 | |
hsa-miR-21-3p | colon cancer | cell cycle pathway; Apoptosis pathway | "microRNA 21 negatively regulates Cdc25A and cell c ......" | 19826040 | |
hsa-miR-21-3p | colon cancer | cell cycle pathway; Apoptosis pathway | "Targeting miR 21 enhances the sensitivity of human ......" | 24275137 | Colony formation |
hsa-miR-21-3p | colon cancer | Ras signaling pathway; Apoptosis pathway | "To determine how the oncogene miR-21 regulates the ......" | 25663768 | Western blot; Luciferase; Flow cytometry; Transwell assay |
hsa-miR-21-3p | colon cancer | Apoptosis pathway | "Drug resistance of colon cancer cells to 5 fluorou ......" | 26418978 | MTT assay |
hsa-miR-21-3p | colorectal cancer | Apoptosis pathway | "miR 21 targets the tumor suppressor RhoB and regul ......" | 21872591 | Luciferase |
hsa-miR-21-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "Clinical correlations of miR 21 expression in colo ......" | 22476768 | |
hsa-miR-21-3p | colorectal cancer | Ras signaling pathway | "Control of MicroRNA 21 expression in colorectal ca ......" | 22553926 | |
hsa-miR-21-3p | colorectal cancer | PI3K/Akt signaling pathway; cell cycle pathway; Apoptosis pathway | "MiR 21 regulates biological behavior through the P ......" | 23174819 | Luciferase |
hsa-miR-21-3p | colorectal cancer | Apoptosis pathway | "Novel evidence for an oncogenic role of microRNA 2 ......" | 25994220 | |
hsa-miR-21-3p | esophageal cancer | Apoptosis pathway | "MiR 21 down regulation suppresses cell growth inva ......" | 23504349 | Western blot; Luciferase |
hsa-miR-21-3p | esophageal cancer | Apoptosis pathway | "MiR 203 suppresses tumor growth and invasion and d ......" | 24001611 | |
hsa-miR-21-3p | esophageal cancer | PI3K/Akt signaling pathway; Apoptosis pathway | "A novel chemotherapeutic arene rutheniumII drug Ra ......" | 24324076 | MTT assay |
hsa-miR-21-3p | esophageal cancer | Epithelial mesenchymal transition pathway | "Nicotine upregulates microRNA 21 and promotes TGF ......" | 24756761 | |
hsa-miR-21-3p | esophageal cancer | Apoptosis pathway | "Characterization and effects of miR 21 expression ......" | 26345812 | Flow cytometry; Western blot |
hsa-miR-21-3p | esophageal cancer | PI3K/Akt signaling pathway; Apoptosis pathway; cell cycle pathway | "MicroRNA 21 promotes cell proliferation migration ......" | 27188433 | Western blot; Flow cytometry; Transwell assay |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "miR 21 plays a pivotal role in gastric cancer path ......" | 18794849 | |
hsa-miR-21-3p | gastric cancer | cell cycle pathway | "MicroRNA 21 inhibits Serpini1 a gene with novel tu ......" | 22464652 | Western blot; Flow cytometry; Luciferase |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "miR 21 confers cisplatin resistance in gastric can ......" | 23466500 | |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "Correlations between the expression levels of miR- ......" | 24154840 | Western blot |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "Celastrol induces apoptosis of gastric cancer cell ......" | 24434352 | Western blot; Luciferase |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "MicroRNA 21 stimulates gastric cancer growth and i ......" | 24659669 | Western blot |
hsa-miR-21-3p | gastric cancer | cell cycle pathway; mTOR signaling pathway | "Celastrol induces cell cycle arrest by MicroRNA 21 ......" | 26500453 | Flow cytometry; Western blot |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "miR 21 inhibits the effects of cyclooxygenase 2 in ......" | 26604791 | Western blot; Wound Healing Assay |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway | "The present study aimed to investigate the role of ......" | 27040946 | |
hsa-miR-21-3p | gastric cancer | Apoptosis pathway; cell cycle pathway | "Significance of microRNA 21 in gastric cancer; Rec ......" | 27179559 | |
hsa-miR-21-3p | gastric cancer | Epithelial mesenchymal transition pathway; PI3K/Akt signaling pathway | "MicroRNA 21 promotes TGF β1 induced epithelial me ......" | 27611950 | Western blot |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "MicroRNA 21 is an antiapoptotic factor in human gl ......" | 16024602 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway; cell cycle pathway | "MicroRNA 21 targets a network of key tumor suppres ......" | 18829576 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "MicroRNA 21 down regulates the expression of tumor ......" | 19013014 | Luciferase |
hsa-miR-21-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "Downregulation of miR 21 inhibits EGFR pathway and ......" | 20048743 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway; cell cycle pathway | "MicroRNA 21 inhibitor sensitizes human glioblastom ......" | 20113523 | MTT assay; Flow cytometry; Western blot |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "MiR 21 protected human glioblastoma U87MG cells fr ......" | 20633539 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "A miR 21 inhibitor enhances apoptosis and reduces ......" | 21618027 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "Downregulation of Pdcd4 by mir 21 facilitates glio ......" | 21636706 | Colony formation |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "Cell survival apoptosis and molecular targets were ......" | 22353043 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "MicroRNA 21 inhibitor sensitizes human glioblastom ......" | 22528454 | |
hsa-miR-21-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "MiR 21 modulates hTERT through a STAT3 dependent m ......" | 22709411 | MTT assay; Luciferase |
hsa-miR-21-3p | glioblastoma | Epithelial mesenchymal transition pathway; Apoptosis pathway | "NPV LDE 225 Erismodegib inhibits epithelial mesenc ......" | 23482671 | Luciferase; Western blot |
hsa-miR-21-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "MiR 21 mediates the radiation resistance of gliobl ......" | 23904372 | Flow cytometry; Western blot |
hsa-miR-21-3p | glioblastoma | PI3K/Akt signaling pathway | "It is largely unknown whether the blockade of miR- ......" | 24012640 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "MiR 21 up regulation mediates glioblastoma cancer ......" | 25394756 | Flow cytometry; Western blot; Luciferase; RNAi |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "Delivery of anti microRNA 21 antisense oligodeoxyn ......" | 25572456 | Luciferase |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "Sulforaphane enhances temozolomide induced apoptos ......" | 25991372 | |
hsa-miR-21-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "Downregulation of microRNA-21 miR-21 especially in ......" | 26142886 | |
hsa-miR-21-3p | glioblastoma | cell cycle pathway | "Nanoparticle Delivered Antisense MicroRNA 21 Enhan ......" | 26559642 | |
hsa-miR-21-3p | glioblastoma | Apoptosis pathway | "Anti cancer effect of R3V6 peptide mediated delive ......" | 27355932 | |
hsa-miR-21-3p | glioblastoma | cell cycle pathway | "MicroRNA-21 miR-21 and microRNA-10b miR-10b are on ......" | 27508339 | |
hsa-miR-21-3p | head and neck cancer | Apoptosis pathway | "An initial screening of 4 primary HNSCC 4 normal m ......" | 18798260 | Flow cytometry |
hsa-miR-21-3p | head and neck cancer | cell cycle pathway | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Flow cytometry |
hsa-miR-21-3p | head and neck cancer | Epithelial mesenchymal transition pathway | "miR-21 miR-31 miR-504 and miR-10b are important on ......" | 23340306 | |
hsa-miR-21-3p | kidney renal cell cancer | Apoptosis pathway | "miR 21 modulates cell apoptosis by targeting multi ......" | 21820586 | Western blot; Luciferase |
hsa-miR-21-3p | kidney renal cell cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 21 is overexpressed in renal cell carcino ......" | 23558936 | Flow cytometry; MTT assay; Western blot |
hsa-miR-21-3p | liver cancer | cell cycle pathway | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
hsa-miR-21-3p | liver cancer | PI3K/Akt signaling pathway; cell cycle pathway; Apoptosis pathway | "MicroRNA 21 acts as an oncomir through multiple ta ......" | 20447717 | |
hsa-miR-21-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "miRNAs are small non-coding RNAs which target comp ......" | 24496037 | |
hsa-miR-21-3p | liver cancer | cell cycle pathway | "MicroRNA 21 promotes cell proliferation in human h ......" | 25687183 | Western blot; Luciferase |
hsa-miR-21-3p | liver cancer | Ras signaling pathway | "Effects of VEGF/VEGFR/K ras signaling pathways on ......" | 25730004 | |
hsa-miR-21-3p | liver cancer | Apoptosis pathway | "Furthermore miR-21 was increased by BA in D/C-trea ......" | 26222667 | |
hsa-miR-21-3p | liver cancer | cell cycle pathway | "MicroRNA 21 is a potential link between non alcoho ......" | 26282675 | Colony formation |
hsa-miR-21-3p | liver cancer | Apoptosis pathway | "MiR 21 and miR 183 can simultaneously target SOCS6 ......" | 26400524 | Western blot; Luciferase |
hsa-miR-21-3p | liver cancer | Apoptosis pathway | "Degradation of miR 21 induces apoptosis and inhibi ......" | 26427512 | |
hsa-miR-21-3p | lung cancer | Apoptosis pathway | "MiR 21 is an EGFR regulated anti apoptotic factor ......" | 19597153 | |
hsa-miR-21-3p | lung cancer | Apoptosis pathway | "Modulation of K Ras dependent lung tumorigenesis b ......" | 20832755 | |
hsa-miR-21-3p | lung cancer | Apoptosis pathway | "Glossy ganoderma spore oil promotes apoptosis of h ......" | 21842656 | Flow cytometry |
hsa-miR-21-3p | lung cancer | Wnt signaling pathway; cell cycle pathway; Apoptosis pathway; PPAR signaling pathway; MAPK signaling pathway | "A systematic analysis of predicted miR 21 targets ......" | 22244963 | |
hsa-miR-21-3p | lung cancer | cell cycle pathway | "miR 21 induces cell cycle at S phase and modulates ......" | 22806311 | Luciferase; Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | lung cancer | cell cycle pathway; Apoptosis pathway; PI3K/Akt signaling pathway | "Effect of microRNA 21 on multidrug resistance reve ......" | 25323306 | |
hsa-miR-21-3p | lung cancer | cell cycle pathway; Apoptosis pathway | "The effect and mechanism of microRNA 21 on cis dic ......" | 27266356 | Flow cytometry; Western blot |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway | "Overexpression of miR 21 promotes proliferation an ......" | 22335905 | Western blot; Luciferase; Flow cytometry |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway | "MiR 21 suppresses the anticancer activities of cur ......" | 24293118 | MTT assay; Western blot |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway | "MiR 21 overexpression is associated with acquired ......" | 24331411 | RNAi; Western blot |
hsa-miR-21-3p | lung squamous cell cancer | cell cycle pathway | "Expression of microRNA 21 in non small cell lung c ......" | 24452750 | |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "Silencing miR 21 sensitizes non small cell lung ca ......" | 24804226 | Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway | "Downregulation of microRNA 21 expression restrains ......" | 25477028 | Western blot |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 21 regulates non small cell lung cancer c ......" | 26309536 | Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | lung squamous cell cancer | Apoptosis pathway | "Triptolide reduces proliferation and enhances apop ......" | 26847601 | |
hsa-miR-21-3p | lymphoma | Apoptosis pathway | "A subset of these miRNAs was associated with outco ......" | 23725219 | |
hsa-miR-21-3p | lymphoma | Apoptosis pathway | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
hsa-miR-21-3p | lymphoma | Apoptosis pathway; cell cycle pathway | "Relevance of miR 21 in HIV and non HIV related lym ......" | 24961346 | |
hsa-miR-21-3p | melanoma | Apoptosis pathway | "MicroRNA miR 21 regulates the metastatic behavior ......" | 21940630 | |
hsa-miR-21-3p | melanoma | Apoptosis pathway | "The status of microRNA 21 expression and its clini ......" | 22130252 | |
hsa-miR-21-3p | melanoma | Apoptosis pathway | "microRNA 21 is upregulated in malignant melanoma a ......" | 22716245 | |
hsa-miR-21-3p | melanoma | Apoptosis pathway | "Increased miR-21 expression has been observed duri ......" | 26116372 | |
hsa-miR-21-3p | ovarian cancer | Apoptosis pathway | "The inhibition of miR 21 promotes apoptosis and ch ......" | 24472409 | Western blot |
hsa-miR-21-3p | ovarian cancer | Apoptosis pathway | "Icariin regulates the proliferation and apoptosis ......" | 25845681 | MTT assay; Flow cytometry; Western blot |
hsa-miR-21-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Cell cycle distribution and apoptosis were examine ......" | 19112422 | Flow cytometry |
hsa-miR-21-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Antisense inhibition of microRNA 21 or 221 arrests ......" | 19730150 | |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "MicroRNA 21 in pancreatic cancer: correlation with ......" | 20460539 | |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "Bcl 2 upregulation induced by miR 21 via a direct ......" | 21376256 | Luciferase |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "The serum miR 21 level serves as a predictor for t ......" | 23177026 | |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "Resveratrol induces apoptosis of pancreatic cancer ......" | 23359184 | MTT assay; Western blot |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "Targeting miR 21 for the therapy of pancreatic can ......" | 23481326 | |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "Chemosensitivity induced by down regulation of mic ......" | 23564788 | |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "Hypoxia induces the overexpression of microRNA 21 ......" | 23726431 | Flow cytometry |
hsa-miR-21-3p | pancreatic cancer | Apoptosis pathway | "MiR 21 upregulation induced by promoter zone histo ......" | 24460329 | |
hsa-miR-21-3p | pancreatic cancer | PI3K/Akt signaling pathway | "The purpose of this study was to investigate the i ......" | 25846727 | MTT assay; Western blot; Luciferase |
hsa-miR-21-3p | prostate cancer | Apoptosis pathway | "MicroRNA 21 directly targets MARCKS and promotes a ......" | 19302977 | |
hsa-miR-21-3p | prostate cancer | Apoptosis pathway | "Interestingly NVP-LDE-225 induced PDCD4 and apopto ......" | 23567619 | |
hsa-miR-21-3p | retinoblastoma | cell cycle pathway | "Seed targeting anti miR 21 inhibiting malignant pr ......" | 24607444 | Flow cytometry; Colony formation |
hsa-miR-21-3p | sarcoma | NA | "Aberrant expression of microRNAs miRNAs including ......" | 19906824 | |
hsa-miR-21-3p | thyroid cancer | Apoptosis pathway; cell cycle pathway | "Antisense miR 21 enhances differentiation/apoptosi ......" | 26289851 | Flow cytometry |
Reported cancer prognosis affected by hsa-miR-21-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-21-3p | B cell lymphoma | malignant trasformation | "Using microarray analysis on prototypic cell lines ......" | 17487835 | |
hsa-miR-21-3p | B cell lymphoma | poor survival | "We therefore investigated whether microRNAs also h ......" | 18318758 | |
hsa-miR-21-3p | B cell lymphoma | poor survival | "Finally eight miRNAs were found to correlate with ......" | 18537969 | |
hsa-miR-21-3p | B cell lymphoma | malignant trasformation | "OncomiR addiction in an in vivo model of microRNA ......" | 20693987 | |
hsa-miR-21-3p | B cell lymphoma | worse prognosis; staging; poor survival | "Clinical significance and detection of microRNA 21 ......" | 24400911 | |
hsa-miR-21-3p | B cell lymphoma | staging; worse prognosis | "Expression and clinical significance of miR 21 in ......" | 24763002 | |
hsa-miR-21-3p | B cell lymphoma | poor survival | "Differential expression of miR 155 and miR 21 in t ......" | 25265435 | |
hsa-miR-21-3p | B cell lymphoma | malignant trasformation | "In this review we discuss miRNAs with essential fu ......" | 25541152 | |
hsa-miR-21-3p | B cell lymphoma | tumorigenesis | "MicroRNA-21 miR-21 is considered to play a key rol ......" | 25543482 | Western blot; Luciferase |
hsa-miR-21-3p | B cell lymphoma | progression; poor survival | "MicroRNA 21 plays an oncogenic role by targeting F ......" | 25909227 | |
hsa-miR-21-3p | acute myeloid leukemia | metastasis; tumorigenesis; recurrence; differentiation | "miR 21 is overexpressed in NPM1 mutant acute myelo ......" | 25543261 | |
hsa-miR-21-3p | bladder cancer | tumorigenesis; drug resistance | "microRNA 21 modulates cell proliferation and sensi ......" | 21468550 | Western blot; Flow cytometry |
hsa-miR-21-3p | bladder cancer | poor survival; recurrence | "High miR-21 expression correlated with worse overa ......" | 22704449 | |
hsa-miR-21-3p | bladder cancer | poor survival | "miR-21 and miR-205 were over expressed in high gra ......" | 22999546 | |
hsa-miR-21-3p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
hsa-miR-21-3p | bladder cancer | drug resistance | "microRNA 21 Regulates Cell Proliferation and Migra ......" | 26230405 | |
hsa-miR-21-3p | bladder cancer | staging; metastasis; worse prognosis; progression | "Expression and clinical significance of microRNA 2 ......" | 26622898 | |
hsa-miR-21-3p | breast cancer | malignant trasformation | "To obtain insight into miRNA deregulation in breas ......" | 18089790 | |
hsa-miR-21-3p | breast cancer | malignant trasformation | "Real-time quantitative PCR RQ-PCR is a sensitive a ......" | 18718003 | |
hsa-miR-21-3p | breast cancer | staging; metastasis; worse prognosis; poor survival; progression | "MicroRNA miR 21 overexpression in human breast can ......" | 18812439 | |
hsa-miR-21-3p | breast cancer | staging; poor survival; metastasis; progression; worse prognosis | "High miR 21 expression in breast cancer associated ......" | 18932017 | |
hsa-miR-21-3p | breast cancer | malignant trasformation; staging | "Clinical significance of miR 21 expression in brea ......" | 19212625 | |
hsa-miR-21-3p | breast cancer | tumorigenesis | "Identification of miR 21 targets in breast cancer ......" | 19253296 | Luciferase |
hsa-miR-21-3p | breast cancer | progression; metastasis | "BMP 6 inhibits microRNA 21 expression in breast ca ......" | 19308091 | Luciferase |
hsa-miR-21-3p | breast cancer | drug resistance | "Hyaluronan CD44 interaction with protein kinase Ce ......" | 19633292 | |
hsa-miR-21-3p | breast cancer | drug resistance | "Downregulation of miR 21 enhances chemotherapeutic ......" | 20082533 | |
hsa-miR-21-3p | breast cancer | tumorigenesis; metastasis | "MicroRNA 21 regulates breast cancer invasion partl ......" | 20346171 | Western blot; Luciferase |
hsa-miR-21-3p | breast cancer | staging; metastasis | "Direct serum assay for microRNA 21 concentrations ......" | 21036945 | |
hsa-miR-21-3p | breast cancer | staging; poor survival; metastasis | "For example miR-21 is overexpressed in both male a ......" | 21059829 | |
hsa-miR-21-3p | breast cancer | motility | "Induction of miR 21 by retinoic acid in estrogen r ......" | 21131358 | |
hsa-miR-21-3p | breast cancer | tumorigenesis; malignant trasformation; progression | "Knockdown of miR 21 in human breast cancer cell li ......" | 21219636 | Western blot; Luciferase |
hsa-miR-21-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
hsa-miR-21-3p | breast cancer | recurrence; poor survival; worse prognosis | "MicroRNA microarray analysis was performed to comp ......" | 21271219 | |
hsa-miR-21-3p | breast cancer | worse prognosis; progression; metastasis | "miR 21 Expression in Pregnancy Associated Breast C ......" | 21326627 | |
hsa-miR-21-3p | breast cancer | drug resistance | "Up regulation of miR 21 mediates resistance to tra ......" | 21471222 | |
hsa-miR-21-3p | breast cancer | drug resistance | "MicroRNA 21 modulates chemosensitivity of breast c ......" | 21820606 | MTT assay; Western blot; Flow cytometry; Luciferase |
hsa-miR-21-3p | breast cancer | worse prognosis | "High expression of miR 21 in tumor stroma correlat ......" | 21917003 | |
hsa-miR-21-3p | breast cancer | malignant trasformation | "Through immunohistochemistry analyses of tissue mi ......" | 22086602 | |
hsa-miR-21-3p | breast cancer | malignant trasformation | "The relative concentrations of four circulating mi ......" | 22350790 | |
hsa-miR-21-3p | breast cancer | drug resistance | "Expression levels of miR-210 miR-21 miR-29a and mi ......" | 22370716 | |
hsa-miR-21-3p | breast cancer | metastasis; cell migration | "MiR 21 regulates epithelial mesenchymal transition ......" | 22435731 | |
hsa-miR-21-3p | breast cancer | metastasis | "Real Time RT-PCR was performed to identify the miR ......" | 22524830 | |
hsa-miR-21-3p | breast cancer | metastasis; drug resistance | "DNA damage induces NF κB dependent microRNA 21 up ......" | 22547075 | |
hsa-miR-21-3p | breast cancer | metastasis | "miR 21 is targeted by omega 3 polyunsaturated fatt ......" | 22678116 | |
hsa-miR-21-3p | breast cancer | tumor size | "Circulating microRNA 92a and microRNA 21 as novel ......" | 23052693 | |
hsa-miR-21-3p | breast cancer | drug resistance; progression; metastasis; poor survival | "Radiation resistance due to high expression of miR ......" | 23216894 | |
hsa-miR-21-3p | breast cancer | staging; poor survival; tumor size; metastasis | "MicroRNA 21 as an indicator of aggressive phenotyp ......" | 23485999 | |
hsa-miR-21-3p | breast cancer | progression; drug resistance | "Here we find that nucleolin NCL a major nucleolar ......" | 23610125 | |
hsa-miR-21-3p | breast cancer | metastasis | "The anti metastatic activity of collagenase 2 in b ......" | 23851508 | |
hsa-miR-21-3p | breast cancer | metastasis; tumorigenesis | "Genetic heterogeneity of breast cancer metastasis ......" | 23936642 | Western blot |
hsa-miR-21-3p | breast cancer | metastasis | "In vivo monitoring of angiogenesis inhibition via ......" | 23951172 | Western blot |
hsa-miR-21-3p | breast cancer | malignant trasformation | "Here we identified 33 miRNAs with similar deregula ......" | 24104550 | |
hsa-miR-21-3p | breast cancer | worse prognosis | "MicroRNA 21 in breast cancer: diagnostic and progn ......" | 24248894 | |
hsa-miR-21-3p | breast cancer | tumorigenesis; staging | "Clinical significance of serum miR 21 in breast ca ......" | 24385703 | |
hsa-miR-21-3p | breast cancer | metastasis; malignant trasformation | "The overexpression of miR-21 miR-10b and miR-19a i ......" | 24416156 | |
hsa-miR-21-3p | breast cancer | metastasis | "The difference in miR 21 expression levels between ......" | 24488617 | |
hsa-miR-21-3p | breast cancer | drug resistance; progression; poor survival | "Hyaluronan CD44 interaction promotes c Jun signali ......" | 24606718 | |
hsa-miR-21-3p | breast cancer | tumor size; drug resistance | "Higher miR 21 expression in invasive breast carcin ......" | 24781337 | |
hsa-miR-21-3p | breast cancer | worse prognosis | "High expression of miR 21 in triple negative breas ......" | 24930006 | |
hsa-miR-21-3p | breast cancer | tumor size | "The aim of the present study was to assess the eff ......" | 25009660 | |
hsa-miR-21-3p | breast cancer | metastasis | "Differential expression of miR 139 miR 486 and miR ......" | 25027758 | |
hsa-miR-21-3p | breast cancer | metastasis; tumor size | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | |
hsa-miR-21-3p | breast cancer | poor survival | "Changes in serum levels of miR 21 miR 210 and miR ......" | 25086636 | |
hsa-miR-21-3p | breast cancer | drug resistance | "miR 21 Expression in Cancer Cells may Not Predict ......" | 25177545 | |
hsa-miR-21-3p | breast cancer | metastasis; motility; worse prognosis | "Among these we identified miRNAs previously associ ......" | 25277099 | |
hsa-miR-21-3p | breast cancer | poor survival; metastasis | "Prognostic and clinicopathological significance of ......" | 25337203 | |
hsa-miR-21-3p | breast cancer | metastasis | "The objective of the present study is to evaluate ......" | 25369070 | |
hsa-miR-21-3p | breast cancer | recurrence; poor survival | "Stromal expression of miR 21 identifies high risk ......" | 25440114 | |
hsa-miR-21-3p | breast cancer | worse prognosis; poor survival | "Prediction of poor prognosis in breast cancer pati ......" | 25706383 | |
hsa-miR-21-3p | breast cancer | metastasis; worse prognosis; poor survival; recurrence | "Quantitative measurement of serum microRNA 21 expr ......" | 25729725 | |
hsa-miR-21-3p | breast cancer | drug resistance | "Formulation of Anti miR 21 and 4 Hydroxytamoxifen ......" | 25880495 | MTT assay |
hsa-miR-21-3p | breast cancer | staging; metastasis | "Pilot Study of Serum MicroRNA 21 as a Diagnostic a ......" | 26063582 | |
hsa-miR-21-3p | breast cancer | cell migration | "DNA microarray and real-time PCR analyses further ......" | 26098771 | |
hsa-miR-21-3p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
hsa-miR-21-3p | breast cancer | metastasis | "Stat3 regulates ErbB 2 expression and co opts ErbB ......" | 26212010 | |
hsa-miR-21-3p | breast cancer | staging | "MicroRNA 21 Expression in Primary Breast Cancer Ti ......" | 26342497 | Fluorescent in situ hybridization |
hsa-miR-21-3p | breast cancer | poor survival | "High expression levels of miR 21 and miR 210 predi ......" | 26349663 | |
hsa-miR-21-3p | breast cancer | metastasis; progression | "In particular miR-21 an oncogenic miRNA is a major ......" | 26387848 | |
hsa-miR-21-3p | breast cancer | staging | "Diagnostic prognostic and predictive value of Micr ......" | 26396924 | |
hsa-miR-21-3p | breast cancer | malignant trasformation; worse prognosis | "In order to obtain insight into miRNA de-regulatio ......" | 26408705 | |
hsa-miR-21-3p | breast cancer | drug resistance | "MicroRNA 21 links epithelial to mesenchymal transi ......" | 26452030 | |
hsa-miR-21-3p | breast cancer | staging | "Advances in Research on miR 21 and Breast Cancer; ......" | 26486006 | |
hsa-miR-21-3p | breast cancer | tumorigenesis; drug resistance | "A key oncomir in carcinogenesis is miR-21 which is ......" | 26549725 | Colony formation; Western blot |
hsa-miR-21-3p | breast cancer | drug resistance | "To investigate the effects of miR-21 on paclitaxel ......" | 26555418 | Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | breast cancer | drug resistance | "Prior studies suggest that miRNAs are important to ......" | 26666820 | |
hsa-miR-21-3p | breast cancer | cell migration; worse prognosis | "PIK3R1 targeting by miR 21 suppresses tumor cell m ......" | 26676464 | Luciferase |
hsa-miR-21-3p | breast cancer | metastasis; motility | "Moreover miR-21 a well-documented oncogenic miRNA ......" | 26769851 | |
hsa-miR-21-3p | breast cancer | progression | "Kallistatin inhibited oncogenic miR-21 synthesis a ......" | 26790955 | |
hsa-miR-21-3p | breast cancer | progression; metastasis; worse prognosis | "miR 21 Might be Involved in Breast Cancer Promotio ......" | 26891730 | |
hsa-miR-21-3p | breast cancer | metastasis | "The function of MiR 21 expression differences and ......" | 27113307 | |
hsa-miR-21-3p | breast cancer | metastasis | "We evaluated the expression levels of miR-21 miR-1 ......" | 27197674 | |
hsa-miR-21-3p | breast cancer | staging | "We report for the first time an extremely high pre ......" | 27404381 | |
hsa-miR-21-3p | breast cancer | metastasis | "The connection of miR 21 and miR 155 with regulati ......" | 27420617 | |
hsa-miR-21-3p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
hsa-miR-21-3p | breast cancer | poor survival | "In this multicenter study a 10-miRNA classifier in ......" | 27566954 | |
hsa-miR-21-3p | breast cancer | staging | "We employed qRT-PCR to determine expression level ......" | 27596294 | |
hsa-miR-21-3p | breast cancer | progression; poor survival; metastasis; worse prognosis | "Prognostic value of circulating microRNA 21 for br ......" | 27684463 | |
hsa-miR-21-3p | breast cancer | worse prognosis; drug resistance | "Serum microRNA 21 expression as a prognostic and t ......" | 27696295 | |
hsa-miR-21-3p | cervical and endocervical cancer | drug resistance | "miR 21 modulates resistance of HR HPV positive cer ......" | 25769949 | Luciferase; Colony formation |
hsa-miR-21-3p | cervical and endocervical cancer | malignant trasformation; progression | "Overexpression of miR 21 promotes the proliferatio ......" | 25963606 | |
hsa-miR-21-3p | cervical and endocervical cancer | metastasis; progression; worse prognosis | "This study aimed to characterize the miR-21 and ev ......" | 26261606 | |
hsa-miR-21-3p | cervical and endocervical cancer | staging; metastasis; tumor size | "Long noncoding RNA MEG3 is downregulated in cervic ......" | 26574780 | |
hsa-miR-21-3p | cervical and endocervical cancer | metastasis | "Regulator role of HPV E7 protein on miR 21 express ......" | 26884851 | Western blot |
hsa-miR-21-3p | cervical and endocervical cancer | drug resistance; poor survival | "Relevance of miR 21 in regulation of tumor suppres ......" | 26975392 | Luciferase |
hsa-miR-21-3p | cervical and endocervical cancer | metastasis; cell migration | "Circulating MicroRNA 21 Is Involved in Lymph Node ......" | 27101583 | |
hsa-miR-21-3p | colon cancer | staging; poor survival | "MicroRNA microarray expression profiling of tumors ......" | 18230780 | |
hsa-miR-21-3p | colon cancer | staging; worse prognosis | "This study examines the potential clinical utility ......" | 19737943 | |
hsa-miR-21-3p | colon cancer | progression; tumorigenesis | "microRNA 21 negatively regulates Cdc25A and cell c ......" | 19826040 | |
hsa-miR-21-3p | colon cancer | metastasis | "This short review will focus on our recent finding ......" | 19836969 | |
hsa-miR-21-3p | colon cancer | motility; metastasis | "miR 21 and miR 31 converge on TIAM1 to regulate mi ......" | 20826792 | Transwell assay |
hsa-miR-21-3p | colon cancer | staging; poor survival; drug resistance | "Deregulated expression of sprouty2 and microRNA 21 ......" | 21099344 | |
hsa-miR-21-3p | colon cancer | tumorigenesis; staging | "We performed microarray analysis of mRNA expressio ......" | 21806946 | Colony formation |
hsa-miR-21-3p | colon cancer | tumorigenesis | "MicroRNA 21 mediated regulation of Sprouty2 protei ......" | 22322462 | |
hsa-miR-21-3p | colon cancer | drug resistance | "The expressions of microRNAs were profiled with a ......" | 22382630 | RNA Immunoprecipitation; RNA immunoprecipitation |
hsa-miR-21-3p | colon cancer | metastasis | "miR 21 miR 17 and miR 19a induced by phosphatase o ......" | 22677902 | RNAi |
hsa-miR-21-3p | colon cancer | staging; poor survival; recurrence | "The prognostic importance of miR 21 in stage II co ......" | 23011541 | |
hsa-miR-21-3p | colon cancer | tumorigenesis | "In particular miR-21 is an oncogenic miRNA that ha ......" | 23207927 | |
hsa-miR-21-3p | colon cancer | differentiation | "Down regulation of miR 21 Induces Differentiation ......" | 23544170 | |
hsa-miR-21-3p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-21-3p | colon cancer | metastasis | "Difluorinated curcumin CDF restores PTEN expressio ......" | 23894315 | |
hsa-miR-21-3p | colon cancer | poor survival; drug resistance; worse prognosis; staging | "High miR 21 expression from FFPE tissues is associ ......" | 24122631 | |
hsa-miR-21-3p | colon cancer | drug resistance | "Targeting miR 21 enhances the sensitivity of human ......" | 24275137 | Colony formation |
hsa-miR-21-3p | colon cancer | staging | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | |
hsa-miR-21-3p | colon cancer | recurrence | "RNA microarray and TaqMan Array analysis were perf ......" | 24921248 | |
hsa-miR-21-3p | colon cancer | staging | "The aim of the present study was to analyse the pr ......" | 25051407 | |
hsa-miR-21-3p | colon cancer | poor survival | "Differential MIR 21 expression in plasma from mese ......" | 25569638 | |
hsa-miR-21-3p | colon cancer | malignant trasformation | "To determine how the oncogene miR-21 regulates the ......" | 25663768 | Western blot; Luciferase; Flow cytometry; Transwell assay |
hsa-miR-21-3p | colon cancer | progression; differentiation; drug resistance | "miR 21 and miR 145 cooperation in regulation of co ......" | 25928322 | Western blot |
hsa-miR-21-3p | colon cancer | worse prognosis | "Antisense oligonucleotides against microRNA 21 red ......" | 26236156 | Colony formation; Cell migration assay; Western blot |
hsa-miR-21-3p | colon cancer | drug resistance | "Drug resistance of colon cancer cells to 5 fluorou ......" | 26418978 | MTT assay |
hsa-miR-21-3p | colon cancer | staging | "The aim of this study was to examine the expressio ......" | 26465597 | |
hsa-miR-21-3p | colon cancer | recurrence | "Serum expression levels of miR 17 miR 21 and miR 9 ......" | 26781797 | |
hsa-miR-21-3p | colorectal cancer | metastasis | "MicroRNA 21 miR 21 post transcriptionally downregu ......" | 17968323 | Luciferase |
hsa-miR-21-3p | colorectal cancer | metastasis; staging | "Altered expression of miR 21 miR 31 miR 143 and mi ......" | 18196926 | |
hsa-miR-21-3p | colorectal cancer | staging; tumorigenesis; malignant trasformation | "Locked nucleic acid in situ hybridization analysis ......" | 19509156 | |
hsa-miR-21-3p | colorectal cancer | staging; progression | "Clinicopathological significance of microRNA 21 an ......" | 19921579 | |
hsa-miR-21-3p | colorectal cancer | metastasis | "Relevance of miR 21 and miR 143 expression in tiss ......" | 20620599 | |
hsa-miR-21-3p | colorectal cancer | metastasis; progression | "Curcumin regulates miR 21 expression and inhibits ......" | 20815812 | |
hsa-miR-21-3p | colorectal cancer | staging; poor survival | "High levels of microRNA 21 in the stroma of colore ......" | 21069438 | |
hsa-miR-21-3p | colorectal cancer | staging; metastasis; poor survival; worse prognosis | "Clinicopathological and prognostic value of microR ......" | 21412018 | |
hsa-miR-21-3p | colorectal cancer | progression; recurrence | "MicroRNA 21 and PDCD4 expression in colorectal can ......" | 21546206 | |
hsa-miR-21-3p | colorectal cancer | staging | "Detection of miR 92a and miR 21 in stool samples a ......" | 21930727 | |
hsa-miR-21-3p | colorectal cancer | progression | "miR 21 functionally interacts with the 3'UTR of ch ......" | 22099878 | Luciferase |
hsa-miR-21-3p | colorectal cancer | metastasis; progression; staging | "Expression of target miRs in micro-dissected paraf ......" | 22120473 | |
hsa-miR-21-3p | colorectal cancer | staging | "Prognostic significance of PDCD4 expression and as ......" | 22267128 | |
hsa-miR-21-3p | colorectal cancer | drug resistance; staging; differentiation | "The expression of microRNA-21 miR-21 was determine ......" | 22289545 | |
hsa-miR-21-3p | colorectal cancer | staging; poor survival; cell migration | "Clinical correlations of miR 21 expression in colo ......" | 22476768 | |
hsa-miR-21-3p | colorectal cancer | staging; metastasis; progression | "Expression of miR 21 miR 31 miR 96 and miR 135b is ......" | 22844381 | |
hsa-miR-21-3p | colorectal cancer | staging; metastasis; differentiation; progression | "MiR 21 regulates biological behavior through the P ......" | 23174819 | Luciferase |
hsa-miR-21-3p | colorectal cancer | worse prognosis; staging | "Serum miR 21 and miR 92a as biomarkers in the diag ......" | 23625654 | |
hsa-miR-21-3p | colorectal cancer | staging | "Genome-wide microarray analysis of miRNA expressio ......" | 23673725 | |
hsa-miR-21-3p | colorectal cancer | metastasis; poor survival; tumor size; worse prognosis | "Serum miR 21 as a diagnostic and prognostic biomar ......" | 23704278 | |
hsa-miR-21-3p | colorectal cancer | staging; worse prognosis | "TaqMan quantitative real-time PCR was used to quan ......" | 23719259 | |
hsa-miR-21-3p | colorectal cancer | staging; poor survival | "The prognostic significance of APC gene mutation a ......" | 23773491 | |
hsa-miR-21-3p | colorectal cancer | progression; staging; malignant trasformation; differentiation | "Pleiotropic actions of miR 21 highlight the critic ......" | 23788041 | |
hsa-miR-21-3p | colorectal cancer | poor survival; recurrence; worse prognosis | "Prognostic implications of serum microRNA 21 in co ......" | 23970420 | |
hsa-miR-21-3p | colorectal cancer | metastasis | "Epigenetic regulation of miR 21 in colorectal canc ......" | 24149370 | |
hsa-miR-21-3p | colorectal cancer | staging; poor survival; worse prognosis | "Prognostic role of microRNA 21 in colorectal cance ......" | 24265822 | |
hsa-miR-21-3p | colorectal cancer | metastasis; staging | "Differential expression of serum miR 126 miR 141 a ......" | 24653631 | |
hsa-miR-21-3p | colorectal cancer | staging | "Correlation of over expressions of miR 21 and Notc ......" | 24780321 | Western blot |
hsa-miR-21-3p | colorectal cancer | worse prognosis; poor survival | "MicroRNA 21 promotes tumour malignancy via increas ......" | 24832083 | |
hsa-miR-21-3p | colorectal cancer | staging | "Elevated level of microRNA 21 in the serum of pati ......" | 25178939 | |
hsa-miR-21-3p | colorectal cancer | worse prognosis; poor survival | "Diagnostic and prognostic value of microRNA 21 in ......" | 25178983 | |
hsa-miR-21-3p | colorectal cancer | progression; staging | "Inflammation and MiR 21 pathways functionally inte ......" | 25310697 | |
hsa-miR-21-3p | colorectal cancer | staging; progression; metastasis; poor survival; worse prognosis | "Clinical significance of microRNA 21 as a biomarke ......" | 25421755 | |
hsa-miR-21-3p | colorectal cancer | progression; staging; metastasis; poor survival; recurrence | "Stromal expression of miR 21 in T3 4a colorectal c ......" | 25609245 | |
hsa-miR-21-3p | colorectal cancer | metastasis | "Emerging role of microRNA 21 in colorectal cancer; ......" | 25769454 | |
hsa-miR-21-3p | colorectal cancer | malignant trasformation; staging; poor survival | "Notably deregulation of the key oncogene miR-21 wa ......" | 25788261 | |
hsa-miR-21-3p | colorectal cancer | progression | "Cancer biopsy colonic mucosa from the resected spe ......" | 25989926 | |
hsa-miR-21-3p | colorectal cancer | immune resistance | "MicroRNA MIR21 and T Cells in Colorectal Cancer; E ......" | 26419959 | |
hsa-miR-21-3p | colorectal cancer | poor survival; drug resistance; progression | "MicroRNA MIR21 miR 21 and PTGS2 Expression in Colo ......" | 26957558 | |
hsa-miR-21-3p | colorectal cancer | worse prognosis | "Screening miRNAs for early diagnosis of colorectal ......" | 27022275 | |
hsa-miR-21-3p | colorectal cancer | staging; worse prognosis | "Serological under expression of microRNA 21 microR ......" | 27142899 | |
hsa-miR-21-3p | colorectal cancer | poor survival; recurrence; worse prognosis | "Tissue microRNA 21 expression predicted recurrence ......" | 27226723 | |
hsa-miR-21-3p | colorectal cancer | staging; metastasis; worse prognosis | "Stromal Expression of MicroRNA 21 in Advanced Colo ......" | 27240857 | |
hsa-miR-21-3p | colorectal cancer | staging | "Plasma Expression Levels of Circulating miR 21 are ......" | 27349026 | |
hsa-miR-21-3p | colorectal cancer | staging; metastasis | "Investigation of MicroRNA 21 Expression Levels in ......" | 27432735 | |
hsa-miR-21-3p | colorectal cancer | metastasis | "Investigating intra tumor heterogeneity and expres ......" | 27565378 | |
hsa-miR-21-3p | endometrial cancer | staging | "Highly increased maspin expression corresponds wit ......" | 21330826 | |
hsa-miR-21-3p | esophageal cancer | metastasis | "MicroRNA 21 regulates the proliferation and invasi ......" | 19276261 | Luciferase |
hsa-miR-21-3p | esophageal cancer | metastasis; staging | "The expression of miR-21 miR-106a miR-148a miR-205 ......" | 20628822 | |
hsa-miR-21-3p | esophageal cancer | poor survival | "Using 98 formalin-fixed paraffin-embedded samples ......" | 21248297 | |
hsa-miR-21-3p | esophageal cancer | staging | "MicroRNA 21 induces cell proliferation and invasio ......" | 21475818 | |
hsa-miR-21-3p | esophageal cancer | recurrence | "We selected three oncogenic miRNAs miR-21 miR-184 ......" | 21673684 | |
hsa-miR-21-3p | esophageal cancer | poor survival; worse prognosis | "Prognostic impact of circulating miR 21 and miR 37 ......" | 22519435 | |
hsa-miR-21-3p | esophageal cancer | metastasis; staging; differentiation; worse prognosis | "Serum miR 21 expression in human esophageal squamo ......" | 22799367 | |
hsa-miR-21-3p | esophageal cancer | drug resistance | "Inhibition of microRNA 21 increases radiosensitivi ......" | 22958183 | Western blot |
hsa-miR-21-3p | esophageal cancer | staging; metastasis; poor survival; recurrence; worse prognosis; drug resistance | "There are several microRNAs that have been consist ......" | 23092342 | |
hsa-miR-21-3p | esophageal cancer | poor survival | "The expression levels of miR-21 p = 0.027 miR-181b ......" | 23175214 | |
hsa-miR-21-3p | esophageal cancer | staging; metastasis; progression | "Clinical impact of serum exosomal microRNA 21 as a ......" | 23224754 | |
hsa-miR-21-3p | esophageal cancer | staging; metastasis; differentiation | "To identify whether saliva supernatant miR-21 can ......" | 23464420 | |
hsa-miR-21-3p | esophageal cancer | malignant trasformation | "MiR 21 down regulation suppresses cell growth inva ......" | 23504349 | Western blot; Luciferase |
hsa-miR-21-3p | esophageal cancer | metastasis; differentiation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
hsa-miR-21-3p | esophageal cancer | progression; worse prognosis; poor survival | "We measured the serum levels of miR-21 miR-145 miR ......" | 23838916 | |
hsa-miR-21-3p | esophageal cancer | malignant trasformation; cell migration | "Expression tissue distribution and function of miR ......" | 24039846 | |
hsa-miR-21-3p | esophageal cancer | progression; staging; metastasis | "Down regulation of PTEN expression modulated by dy ......" | 24221338 | Western blot |
hsa-miR-21-3p | esophageal cancer | worse prognosis; poor survival | "The expression of miR 21 and miR 375 predict progn ......" | 24680681 | |
hsa-miR-21-3p | esophageal cancer | staging | "Diagnostic values of salivary versus and plasma mi ......" | 24968850 | |
hsa-miR-21-3p | esophageal cancer | recurrence | "Pooled hazard ratios of miR-21 and miR-375 for OS ......" | 25097879 | |
hsa-miR-21-3p | esophageal cancer | malignant trasformation | "MicroRNA 21 promotes cell growth and migration by ......" | 25400316 | Luciferase |
hsa-miR-21-3p | esophageal cancer | worse prognosis | "Association of miR 21 with esophageal cancer progn ......" | 26125864 | |
hsa-miR-21-3p | esophageal cancer | progression; poor survival | "Plasma levels of miR-16 miR-21 miR-22 miR-126 miR- ......" | 26221263 | |
hsa-miR-21-3p | esophageal cancer | staging; metastasis | "Characterization and effects of miR 21 expression ......" | 26345812 | Flow cytometry; Western blot |
hsa-miR-21-3p | esophageal cancer | poor survival | "Evaluation of miR 21 and miR 375 as prognostic bio ......" | 26481465 | |
hsa-miR-21-3p | esophageal cancer | cell migration; progression; metastasis; recurrence; worse prognosis | "Exosome shuttling microRNA 21 promotes cell migrat ......" | 27035745 | |
hsa-miR-21-3p | esophageal cancer | drug resistance; cell migration | "MicroRNA 21 promotes cell proliferation migration ......" | 27188433 | Western blot; Flow cytometry; Transwell assay |
hsa-miR-21-3p | esophageal cancer | recurrence; worse prognosis | "Differential expression of miR 21 and miR 75 in es ......" | 27508050 | |
hsa-miR-21-3p | esophageal cancer | drug resistance | "Circulating miR 21 as an independent predictive bi ......" | 27508093 | |
hsa-miR-21-3p | gastric cancer | tumorigenesis; worse prognosis | "miR 21 microRNA expression in human gastric carcin ......" | 18507035 | |
hsa-miR-21-3p | gastric cancer | progression | "miR 21 plays a pivotal role in gastric cancer path ......" | 18794849 | |
hsa-miR-21-3p | gastric cancer | poor survival | "Several microarray studies have reported microRNA ......" | 19951901 | |
hsa-miR-21-3p | gastric cancer | metastasis | "Differential expression of miRNAs was studied usin ......" | 20726036 | |
hsa-miR-21-3p | gastric cancer | poor survival; staging; drug resistance | "Prognostic significance of miR 181b and miR 21 in ......" | 21876743 | |
hsa-miR-21-3p | gastric cancer | progression; metastasis; differentiation; cell migration | "microRNA 21 promotes tumor proliferation and invas ......" | 22267008 | Wound Healing Assay; Western blot; Luciferase |
hsa-miR-21-3p | gastric cancer | differentiation | "CSC characteristics were checked using spheroid fo ......" | 22374783 | Colony formation |
hsa-miR-21-3p | gastric cancer | tumorigenesis; staging; metastasis; tumor size | "MicroRNA 21 is a new marker of circulating tumor c ......" | 22430134 | |
hsa-miR-21-3p | gastric cancer | metastasis; poor survival; staging | "miR 21 Is a Promising Novel Biomarker for Lymph No ......" | 22792096 | |
hsa-miR-21-3p | gastric cancer | metastasis; tumorigenesis; staging | "Plasma microRNAs miR 223 miR 21 and miR 218 as nov ......" | 22860003 | |
hsa-miR-21-3p | gastric cancer | poor survival | "Prognostic impact of circulating miR 21 in the pla ......" | 23267156 | |
hsa-miR-21-3p | gastric cancer | drug resistance; poor survival | "miR 21 confers cisplatin resistance in gastric can ......" | 23466500 | |
hsa-miR-21-3p | gastric cancer | metastasis; staging | "In a pilot study serum levels of miR-21 miR-27a mi ......" | 23806809 | |
hsa-miR-21-3p | gastric cancer | tumorigenesis; staging; metastasis; differentiation | "Oxidative stress upregulates PDCD4 expression in p ......" | 23888942 | |
hsa-miR-21-3p | gastric cancer | drug resistance | "Correlations between the expression levels of miR- ......" | 24154840 | Western blot |
hsa-miR-21-3p | gastric cancer | worse prognosis; tumor size; poor survival; staging | "Serum microRNA 21 levels are related to tumor size ......" | 24260069 | |
hsa-miR-21-3p | gastric cancer | worse prognosis; metastasis; differentiation | "Plasma post operative miR 21 expression in the pro ......" | 24460332 | |
hsa-miR-21-3p | gastric cancer | progression | "MicroRNA 21 stimulates gastric cancer growth and i ......" | 24659669 | Western blot |
hsa-miR-21-3p | gastric cancer | tumorigenesis; progression; malignant trasformation | "miR 21 regulates N methyl N nitro N' nitrosoguanid ......" | 24821435 | |
hsa-miR-21-3p | gastric cancer | progression; staging; metastasis | "Stromal miR 21 is more important than miR 21 of tu ......" | 25041158 | |
hsa-miR-21-3p | gastric cancer | poor survival; staging; metastasis; differentiation | "Prognostic role of microRNA 21 in gastric cancer: ......" | 25230738 | |
hsa-miR-21-3p | gastric cancer | staging | "Circulating MicroRNA 21 Is a Potential Diagnostic ......" | 26063956 | |
hsa-miR-21-3p | gastric cancer | recurrence | "Expression of exosomal miRNAs was evaluated with A ......" | 26208314 | |
hsa-miR-21-3p | gastric cancer | poor survival; worse prognosis | "Hsa miR 21 and Hsa miR 29 in Tissue as Potential D ......" | 26509997 | |
hsa-miR-21-3p | gastric cancer | staging; drug resistance | "Two stage cyclic enzymatic amplification method fo ......" | 26720919 | |
hsa-miR-21-3p | gastric cancer | recurrence | "MiR 21 5p as a predictor of recurrence in young ga ......" | 26824898 | |
hsa-miR-21-3p | gastric cancer | drug resistance | "The present study aimed to investigate the role of ......" | 27040946 | |
hsa-miR-21-3p | gastric cancer | progression | "Significance of microRNA 21 in gastric cancer; Rec ......" | 27179559 | |
hsa-miR-21-3p | gastric cancer | drug resistance | "Mel 18 negatively regulates stem cell like propert ......" | 27542229 | |
hsa-miR-21-3p | gastric cancer | cell migration | "MicroRNA 21 promotes TGF β1 induced epithelial me ......" | 27611950 | Western blot |
hsa-miR-21-3p | glioblastoma | malignant trasformation | "MicroRNA 21 is an antiapoptotic factor in human gl ......" | 16024602 | |
hsa-miR-21-3p | glioblastoma | drug resistance | "MicroRNA 21 targets LRRFIP1 and contributes to VM ......" | 19559015 | |
hsa-miR-21-3p | glioblastoma | progression; malignant trasformation | "Downregulation of miR 21 inhibits EGFR pathway and ......" | 20048743 | |
hsa-miR-21-3p | glioblastoma | drug resistance | "MiR 21 protected human glioblastoma U87MG cells fr ......" | 20633539 | |
hsa-miR-21-3p | glioblastoma | drug resistance | "A miR 21 inhibitor enhances apoptosis and reduces ......" | 21618027 | |
hsa-miR-21-3p | glioblastoma | tumorigenesis | "Downregulation of Pdcd4 by mir 21 facilitates glio ......" | 21636706 | Colony formation |
hsa-miR-21-3p | glioblastoma | progression; poor survival | "MiR 195 miR 196b miR 181c miR 21 expression levels ......" | 21895872 | |
hsa-miR-21-3p | glioblastoma | poor survival | "Cell survival apoptosis and molecular targets were ......" | 22353043 | |
hsa-miR-21-3p | glioblastoma | metastasis | "We determined CSF levels of several cancer-associa ......" | 22492962 | |
hsa-miR-21-3p | glioblastoma | recurrence | "MicroRNA 21 inhibitor sensitizes human glioblastom ......" | 22528454 | |
hsa-miR-21-3p | glioblastoma | tumorigenesis | "MiR 21 modulates hTERT through a STAT3 dependent m ......" | 22709411 | MTT assay; Luciferase |
hsa-miR-21-3p | glioblastoma | drug resistance | "MicroRNA 21 inhibition enhances in vitro chemosens ......" | 22753745 | |
hsa-miR-21-3p | glioblastoma | recurrence | "Plasma MicroRNA 21 concentration may be a useful b ......" | 22891879 | |
hsa-miR-21-3p | glioblastoma | progression | "Here we demonstrate for the first time that platel ......" | 22922228 | |
hsa-miR-21-3p | glioblastoma | drug resistance | "Silencing of miR 21 by locked nucleic acid lipid n ......" | 23732394 | |
hsa-miR-21-3p | glioblastoma | drug resistance | "MiR 21 mediates the radiation resistance of gliobl ......" | 23904372 | Flow cytometry; Western blot |
hsa-miR-21-3p | glioblastoma | progression | "It is largely unknown whether the blockade of miR- ......" | 24012640 | |
hsa-miR-21-3p | glioblastoma | differentiation | "Using this in vitro system a microarray-based high ......" | 24155920 | |
hsa-miR-21-3p | glioblastoma | tumorigenesis; poor survival | "MicroRNA 21 promotes glioblastoma tumorigenesis by ......" | 25059666 | |
hsa-miR-21-3p | glioblastoma | tumor size | "Delivery of anti microRNA 21 antisense oligodeoxyn ......" | 25572456 | Luciferase |
hsa-miR-21-3p | glioblastoma | drug resistance; poor survival | "Modulation of miR 21 signaling by MPS1 in human gl ......" | 25991676 | |
hsa-miR-21-3p | glioblastoma | drug resistance | "Downregulation of microRNA-21 miR-21 especially in ......" | 26142886 | |
hsa-miR-21-3p | glioblastoma | worse prognosis; staging | "Mir 21 Sox2 Axis Delineates Glioblastoma Subtypes ......" | 26558781 | |
hsa-miR-21-3p | head and neck cancer | poor survival | "In this study miRNA expression profiles of head an ......" | 19179615 | |
hsa-miR-21-3p | head and neck cancer | staging; poor survival | "Here we used quantitative real-time polymerase cha ......" | 19901002 | |
hsa-miR-21-3p | head and neck cancer | staging; differentiation; tumor size | "Three hypoxia-related microRNAs hsa-miR-210 hsa-mi ......" | 20187102 | |
hsa-miR-21-3p | head and neck cancer | drug resistance; progression; poor survival | "Stem cell marker Nanog and Stat 3 signaling promot ......" | 21685938 | |
hsa-miR-21-3p | head and neck cancer | worse prognosis | "In this present study the expression profiles of t ......" | 22811001 | |
hsa-miR-21-3p | head and neck cancer | poor survival; worse prognosis | "Our findings showed that significant elevated expr ......" | 25677760 | |
hsa-miR-21-3p | head and neck cancer | progression; metastasis | "Abnormal activation of STAT3 and miR-21 plays a vi ......" | 26690371 | |
hsa-miR-21-3p | kidney renal cell cancer | poor survival | "miR 21 modulates cell apoptosis by targeting multi ......" | 21820586 | Western blot; Luciferase |
hsa-miR-21-3p | kidney renal cell cancer | poor survival; staging | "Up regulation of microRNA 21 correlates with lower ......" | 22347428 | Western blot |
hsa-miR-21-3p | kidney renal cell cancer | staging; poor survival | "The clinical utility of miR 21 as a diagnostic and ......" | 22580180 | |
hsa-miR-21-3p | kidney renal cell cancer | progression | "MicroRNA 21 is overexpressed in renal cell carcino ......" | 23558936 | Flow cytometry; MTT assay; Western blot |
hsa-miR-21-3p | kidney renal cell cancer | poor survival; worse prognosis | "Combination of expression levels of miR 21 and miR ......" | 24428907 | |
hsa-miR-21-3p | kidney renal cell cancer | metastasis | "MicroRNA 21 miR 21 post transcriptionally downregu ......" | 24902663 | Western blot; Luciferase; Colony formation |
hsa-miR-21-3p | kidney renal cell cancer | poor survival | "Impact of miR 21 miR 126 and miR 221 as prognostic ......" | 25279769 | |
hsa-miR-21-3p | kidney renal cell cancer | poor survival | "Using vote-counting strategy and robust rank aggre ......" | 25974855 | |
hsa-miR-21-3p | kidney renal cell cancer | worse prognosis; poor survival | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
hsa-miR-21-3p | kidney renal cell cancer | worse prognosis | "SATB1 is Down regulated in Clear Cell Renal Cell C ......" | 27107063 | |
hsa-miR-21-3p | liver cancer | cell migration | "MicroRNA 21 regulates expression of the PTEN tumor ......" | 17681183 | |
hsa-miR-21-3p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
hsa-miR-21-3p | liver cancer | malignant trasformation | "Elevated expression of the miR 17 92 polycistron a ......" | 18688024 | |
hsa-miR-21-3p | liver cancer | progression | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
hsa-miR-21-3p | liver cancer | tumorigenesis | "MicroRNA 21 acts as an oncomir through multiple ta ......" | 20447717 | |
hsa-miR-21-3p | liver cancer | drug resistance; poor survival | "MicroRNA 21 induces resistance to the anti tumour ......" | 20978511 | |
hsa-miR-21-3p | liver cancer | recurrence | "Sequencing and bioinformatics based analyses of th ......" | 21283620 | |
hsa-miR-21-3p | liver cancer | metastasis; tumorigenesis; recurrence | "We examined expression patterns of 4 microRNAs mic ......" | 21458843 | |
hsa-miR-21-3p | liver cancer | malignant trasformation; staging | "Serum microRNA 21 as marker for necroinflammation ......" | 22066022 | |
hsa-miR-21-3p | liver cancer | staging; worse prognosis | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | |
hsa-miR-21-3p | liver cancer | cell migration | "miR 21 promotes migration and invasion by the miR ......" | 22322403 | |
hsa-miR-21-3p | liver cancer | progression | "MicroRNA 21 suppresses PTEN and hSulf 1 expression ......" | 23684551 | |
hsa-miR-21-3p | liver cancer | cell migration | "MicroRNA 21 regulates the migration and invasion o ......" | 23708209 | |
hsa-miR-21-3p | liver cancer | tumorigenesis | "MicroRNA 21 promotes hepatocellular carcinoma HepG ......" | 24112539 | Luciferase; MTT assay |
hsa-miR-21-3p | liver cancer | cell migration | "miRNAs are small non-coding RNAs which target comp ......" | 24496037 | |
hsa-miR-21-3p | liver cancer | tumor size; recurrence | "Expression of serum miR 16 let 7f and miR 21 in pa ......" | 24697119 | |
hsa-miR-21-3p | liver cancer | staging | "Expression of serum exosomal microRNA 21 in human ......" | 24963487 | |
hsa-miR-21-3p | liver cancer | tumorigenesis | "Hepatitis B virus X protein promotes hepatocellula ......" | 25087183 | Colony formation |
hsa-miR-21-3p | liver cancer | worse prognosis; poor survival | "miR 21 expression predicts prognosis in hepatocell ......" | 25150373 | |
hsa-miR-21-3p | liver cancer | poor survival | "Eleven miRNAs miR- miR-19a miR-101-3p miR-199a-5p ......" | 25275448 | |
hsa-miR-21-3p | liver cancer | drug resistance | "Indole 3 carbinol inhibits tumorigenicity of hepat ......" | 25447674 | |
hsa-miR-21-3p | liver cancer | poor survival; recurrence | "Here we investigated the correlation between micro ......" | 25544773 | |
hsa-miR-21-3p | liver cancer | progression; tumorigenesis | "MicroRNA 21 promotes cell proliferation in human h ......" | 25687183 | Western blot; Luciferase |
hsa-miR-21-3p | liver cancer | progression; metastasis | "High Mobility Group Box 1 Promotes Hepatocellular ......" | 25720799 | |
hsa-miR-21-3p | liver cancer | worse prognosis | "Effects of VEGF/VEGFR/K ras signaling pathways on ......" | 25730004 | |
hsa-miR-21-3p | liver cancer | cell migration | "Anti miR 21 Suppresses Hepatocellular Carcinoma Gr ......" | 25758165 | |
hsa-miR-21-3p | liver cancer | drug resistance | "Dehydroepiandrosterone Activation of G protein cou ......" | 25969534 | |
hsa-miR-21-3p | liver cancer | staging; worse prognosis | "Significance of serum microRNA 21 in diagnosis of ......" | 25973032 | |
hsa-miR-21-3p | liver cancer | staging | "Potential Role of Circulating microRNA 21 for Hepa ......" | 26114756 | |
hsa-miR-21-3p | liver cancer | progression | "MiR 21 promoted proliferation and migration in hep ......" | 26210448 | |
hsa-miR-21-3p | liver cancer | poor survival | "Moreover we further validated the confirmed miRNAs ......" | 26231037 | |
hsa-miR-21-3p | liver cancer | worse prognosis; staging; differentiation; poor survival; progression | "Increased expression of miR 21 predicts poor progn ......" | 26261620 | |
hsa-miR-21-3p | liver cancer | tumorigenesis; progression | "MicroRNA 21 is a potential link between non alcoho ......" | 26282675 | Colony formation |
hsa-miR-21-3p | liver cancer | malignant trasformation; progression | "MicroRNAs miRNAs are reported as a group of small ......" | 26302751 | RNAi |
hsa-miR-21-3p | liver cancer | drug resistance | "MiR 21 mediates sorafenib resistance of hepatocell ......" | 26311740 | |
hsa-miR-21-3p | liver cancer | poor survival; cell migration | "Long noncoding RNA GAS5 suppresses the migration a ......" | 26404135 | |
hsa-miR-21-3p | liver cancer | malignant trasformation | "Using gene expression microarrays and high-through ......" | 26646011 | |
hsa-miR-21-3p | lung cancer | tumorigenesis | "MiR 21 is an EGFR regulated anti apoptotic factor ......" | 19597153 | |
hsa-miR-21-3p | lung cancer | tumorigenesis; poor survival | "Modulation of K Ras dependent lung tumorigenesis b ......" | 20832755 | |
hsa-miR-21-3p | lung cancer | poor survival; staging; progression; tumorigenesis | "The expression of miR-21 miR-17 and miR-155 was me ......" | 21350005 | |
hsa-miR-21-3p | lung cancer | worse prognosis; staging; metastasis; poor survival | "High expression of serum miR 21 and tumor miR 200c ......" | 21516486 | |
hsa-miR-21-3p | lung cancer | malignant trasformation | "In the training set miR-21 and miR-210 display hig ......" | 21864403 | |
hsa-miR-21-3p | lung cancer | malignant trasformation; progression | "A systematic analysis of predicted miR 21 targets ......" | 22244963 | |
hsa-miR-21-3p | lung cancer | staging; poor survival; recurrence | "Evaluation of dynamic change of serum miR 21 and m ......" | 22782668 | |
hsa-miR-21-3p | lung cancer | differentiation | "The rBM 3-D culture-specific miRNA profile was hig ......" | 23036707 | |
hsa-miR-21-3p | lung cancer | malignant trasformation | "Using quantitative reverse transcriptase PCR analy ......" | 23462458 | |
hsa-miR-21-3p | lung cancer | drug resistance; tumorigenesis | "Effect of microRNA 21 on multidrug resistance reve ......" | 25323306 | |
hsa-miR-21-3p | lung cancer | worse prognosis | "However for each cell subtype we identified miRNAs ......" | 25344866 | |
hsa-miR-21-3p | lung cancer | metastasis; differentiation | "Inhibition of NADPH oxidase protects against metas ......" | 25563770 | |
hsa-miR-21-3p | lung cancer | drug resistance | "Abnormal Expression of miR 21 and miR 95 in Cancer ......" | 25831148 | |
hsa-miR-21-3p | lung cancer | drug resistance | "This resistance is associated with the increase in ......" | 26080425 | |
hsa-miR-21-3p | lung cancer | staging | "Genome-wide screening of DNA methylation and pyros ......" | 26134223 | |
hsa-miR-21-3p | lung cancer | poor survival | "MicroRNA-21 miR-21 is an oncomiR that is frequentl ......" | 26741162 | |
hsa-miR-21-3p | lung cancer | poor survival | "Tissues were microdissected to obtain >90% tumor o ......" | 27081085 | |
hsa-miR-21-3p | lung cancer | drug resistance | "The effect and mechanism of microRNA 21 on cis dic ......" | 27266356 | Flow cytometry; Western blot |
hsa-miR-21-3p | lung squamous cell cancer | poor survival | "Prognostic value of mature microRNA 21 and microRN ......" | 18719201 | |
hsa-miR-21-3p | lung squamous cell cancer | progression; staging; metastasis | "MicroRNA 21 miR 21 represses tumor suppressor PTEN ......" | 20223231 | Western blot; Luciferase |
hsa-miR-21-3p | lung squamous cell cancer | worse prognosis; staging; poor survival | "Deregulated expression of miR 21 miR 143 and miR 1 ......" | 20363096 | |
hsa-miR-21-3p | lung squamous cell cancer | worse prognosis; poor survival | "MiR 21 overexpression in human primary squamous ce ......" | 20508945 | |
hsa-miR-21-3p | lung squamous cell cancer | staging; recurrence | "In an exploratory study we determined whether expr ......" | 20975375 | |
hsa-miR-21-3p | lung squamous cell cancer | poor survival | "Expression of miR-21 miR-29b miR-34a/b/c miR-155 a ......" | 20978195 | |
hsa-miR-21-3p | lung squamous cell cancer | staging; metastasis | "Identification of plasma microRNA 21 as a biomarke ......" | 21627863 | |
hsa-miR-21-3p | lung squamous cell cancer | worse prognosis; staging; metastasis; poor survival | "The aim of this study was to investigate miR-21 ex ......" | 21721011 | |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance; poor survival | "Increased miR-21 expression significantly increase ......" | 22237007 | |
hsa-miR-21-3p | lung squamous cell cancer | metastasis | "The miRs were quantified by microarray hybridizati ......" | 22295063 | |
hsa-miR-21-3p | lung squamous cell cancer | poor survival | "Prognostic role of microRNA 21 in non small cell l ......" | 22901216 | |
hsa-miR-21-3p | lung squamous cell cancer | metastasis; drug resistance; staging | "MicroRNA 21 miR 21 expression promotes growth meta ......" | 22956424 | Luciferase |
hsa-miR-21-3p | lung squamous cell cancer | poor survival; recurrence; worse prognosis | "High expression of miR 21 and miR 155 predicts rec ......" | 23099007 | |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance; staging | "Reduction of Plasma MicroRNA 21 is Associated with ......" | 23483517 | |
hsa-miR-21-3p | lung squamous cell cancer | worse prognosis; metastasis; poor survival | "The prognostic value of miR 21 and miR 155 in non ......" | 23817461 | |
hsa-miR-21-3p | lung squamous cell cancer | progression; worse prognosis; poor survival | "Let 7g and miR 21 expression in non small cell lun ......" | 23820752 | |
hsa-miR-21-3p | lung squamous cell cancer | worse prognosis | "Relative expressions of miR 205 5p miR 205 3p and ......" | 23881177 | |
hsa-miR-21-3p | lung squamous cell cancer | poor survival; drug resistance; progression; worse prognosis | "In radically resected NSCLC patients the expressio ......" | 24198203 | |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance | "MiR 21 overexpression is associated with acquired ......" | 24331411 | RNAi; Western blot |
hsa-miR-21-3p | lung squamous cell cancer | malignant trasformation; progression; staging | "Expression of microRNA 21 in non small cell lung c ......" | 24452750 | |
hsa-miR-21-3p | lung squamous cell cancer | staging; metastasis | "High tumor cell expression of microRNA 21 in node ......" | 24524655 | |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance; poor survival | "Silencing miR 21 sensitizes non small cell lung ca ......" | 24804226 | Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance | "Downregulation of miR 21 increases cisplatin sensi ......" | 24906642 | Colony formation |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance | "The role of TGF β1 miR 21 ROS pathway in bystande ......" | 24992582 | |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance; poor survival | "Some evidence supports a role for microRNA 21 in m ......" | 25058005 | |
hsa-miR-21-3p | lung squamous cell cancer | tumor size | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
hsa-miR-21-3p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
hsa-miR-21-3p | lung squamous cell cancer | progression | "The aim of this study was to determine whether miR ......" | 25436007 | |
hsa-miR-21-3p | lung squamous cell cancer | staging | "Serum miR 152 miR 148a miR 148b and miR 21 as nove ......" | 25501703 | |
hsa-miR-21-3p | lung squamous cell cancer | poor survival | "The expression of miR-21 in NSCLC tissues was dete ......" | 25799148 | Luciferase |
hsa-miR-21-3p | lung squamous cell cancer | metastasis | "MicroRNA 21 regulates non small cell lung cancer c ......" | 26309536 | Western blot; Flow cytometry; MTT assay |
hsa-miR-21-3p | lung squamous cell cancer | staging; worse prognosis; poor survival; metastasis; progression | "Up Regulation of miR 21 Expression Predicate Advan ......" | 26453197 | |
hsa-miR-21-3p | lung squamous cell cancer | staging; drug resistance | "Testing group: Quantitative reverse transcriptase ......" | 26563758 | |
hsa-miR-21-3p | lung squamous cell cancer | poor survival | "Serum miR 21 level: a potential diagnostic and pro ......" | 26628958 | |
hsa-miR-21-3p | lung squamous cell cancer | staging | "To compare the clinical value of serum microRNA21 ......" | 26880855 | |
hsa-miR-21-3p | lung squamous cell cancer | drug resistance | "MicroRNA 21 modulates radiation resistance through ......" | 27035555 | |
hsa-miR-21-3p | lung squamous cell cancer | staging | "We investigated the stage-specific nsclc detection ......" | 27122989 | |
hsa-miR-21-3p | lymphoma | malignant trasformation | "We recently reported that overexpression of miR-21 ......" | 21502955 | |
hsa-miR-21-3p | lymphoma | worse prognosis | "Expressions of miR 21 miR 155 and miR 210 in plasm ......" | 22541087 | |
hsa-miR-21-3p | lymphoma | poor survival; drug resistance | "A subset of these miRNAs was associated with outco ......" | 23725219 | |
hsa-miR-21-3p | lymphoma | poor survival | "Serum miR 21 is a diagnostic and prognostic marker ......" | 23832112 | |
hsa-miR-21-3p | lymphoma | drug resistance | "Using quantitative real-time PCR qRT-PCR we tested ......" | 24222179 | |
hsa-miR-21-3p | lymphoma | differentiation | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
hsa-miR-21-3p | lymphoma | staging; progression | "Herein we used a global quantitative real-time pol ......" | 25503151 | |
hsa-miR-21-3p | lymphoma | staging; poor survival | "Overexpression of microRNA 21 in peripheral blood ......" | 26439034 | Western blot |
hsa-miR-21-3p | melanoma | metastasis; poor survival | "MicroRNA miR 21 regulates the metastatic behavior ......" | 21940630 | |
hsa-miR-21-3p | melanoma | malignant trasformation; progression; metastasis; worse prognosis; staging; poor survival | "The status of microRNA 21 expression and its clini ......" | 22130252 | |
hsa-miR-21-3p | melanoma | malignant trasformation | "microRNA 21 is upregulated in malignant melanoma a ......" | 22716245 | |
hsa-miR-21-3p | melanoma | malignant trasformation | "Construction of circular miRNA sponges targeting m ......" | 24035906 | |
hsa-miR-21-3p | melanoma | malignant trasformation; immune evasion; metastasis | "Increased miR-21 expression has been observed duri ......" | 26116372 | |
hsa-miR-21-3p | melanoma | malignant trasformation; metastasis | "Expression and clinicopathological significance of ......" | 26150475 | |
hsa-miR-21-3p | melanoma | tumorigenesis | "Arsenic exposed Keratinocytes Exhibit Differential ......" | 27054085 | |
hsa-miR-21-3p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
hsa-miR-21-3p | ovarian cancer | staging | "Moreover miRNAs also have possible implications fo ......" | 23237306 | |
hsa-miR-21-3p | ovarian cancer | metastasis | "We analyzed the miRNA expression profiles of prima ......" | 23554878 | |
hsa-miR-21-3p | ovarian cancer | worse prognosis; staging; poor survival | "Identification of serum microRNA 21 as a biomarker ......" | 23621186 | |
hsa-miR-21-3p | ovarian cancer | drug resistance | "Recent studies have shown that microRNA-21 miR-21 ......" | 23824073 | |
hsa-miR-21-3p | ovarian cancer | drug resistance | "miR 21 modulates paclitaxel sensitivity and hypoxi ......" | 24137413 | Western blot; MTT assay |
hsa-miR-21-3p | ovarian cancer | drug resistance; staging; progression; poor survival | "The inhibition of miR 21 promotes apoptosis and ch ......" | 24472409 | Western blot |
hsa-miR-21-3p | ovarian cancer | drug resistance | "Upregulation of miR 21 in cisplatin resistant ovar ......" | 24865582 | |
hsa-miR-21-3p | ovarian cancer | drug resistance | "The passenger strand miR 21 3p plays a role in med ......" | 25579119 | |
hsa-miR-21-3p | ovarian cancer | staging | "Real-time quantitative PCR was used to determine t ......" | 25744846 | |
hsa-miR-21-3p | ovarian cancer | recurrence; progression | "Human epididymis protein 4 expression positively c ......" | 26733162 | |
hsa-miR-21-3p | ovarian cancer | tumorigenesis; progression; drug resistance | "Targeting miR 21 3p inhibits proliferation and inv ......" | 27166999 | Colony formation; Luciferase |
hsa-miR-21-3p | pancreatic cancer | poor survival; staging; differentiation; tumor size | "MicroRNA 21 is overexpressed in pancreatic cancer ......" | 18642050 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance; malignant trasformation | "MicroRNA 21 modulates biological functions of panc ......" | 19435867 | |
hsa-miR-21-3p | pancreatic cancer | malignant trasformation | "Antisense inhibition of microRNA 21 or 221 arrests ......" | 19730150 | |
hsa-miR-21-3p | pancreatic cancer | staging; progression | "Three candidate miRNAs miR-21 miR-155 and miR-221 ......" | 20332664 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance; poor survival | "MicroRNA 21 in pancreatic cancer: correlation with ......" | 20460539 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance; recurrence; poor survival | "Identification of microRNA 21 as a biomarker for c ......" | 20498843 | |
hsa-miR-21-3p | pancreatic cancer | poor survival | "The expression of miR-21 was significantly higher ......" | 21139804 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "Bcl 2 upregulation induced by miR 21 via a direct ......" | 21376256 | Luciferase |
hsa-miR-21-3p | pancreatic cancer | malignant trasformation | "miR-148a/b and miR-375 expression were found decre ......" | 21738581 | |
hsa-miR-21-3p | pancreatic cancer | staging; poor survival | "We screened the differentially expressed serum miR ......" | 22194634 | |
hsa-miR-21-3p | pancreatic cancer | staging; worse prognosis | "Eighty-eight samples of ductal pancreatic adenocar ......" | 22850622 | |
hsa-miR-21-3p | pancreatic cancer | staging; drug resistance; progression; poor survival | "The serum miR 21 level serves as a predictor for t ......" | 23177026 | |
hsa-miR-21-3p | pancreatic cancer | metastasis; drug resistance | "We report a case of notably increased plasma level ......" | 23205084 | |
hsa-miR-21-3p | pancreatic cancer | cell migration | "Hypoxia induced aggressiveness of pancreatic cance ......" | 23272057 | |
hsa-miR-21-3p | pancreatic cancer | tumorigenesis; progression | "Targeting miR 21 for the therapy of pancreatic can ......" | 23481326 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "Chemosensitivity induced by down regulation of mic ......" | 23564788 | |
hsa-miR-21-3p | pancreatic cancer | progression | "Thousands of miRNAs have been screened in PC and s ......" | 23621126 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "Hypoxia induces the overexpression of microRNA 21 ......" | 23726431 | Flow cytometry |
hsa-miR-21-3p | pancreatic cancer | staging; differentiation | "Four miRNAs miR-17-5p miR-21 miR-155 and miR-196a ......" | 24007214 | |
hsa-miR-21-3p | pancreatic cancer | poor survival | "We identified 3 miRNAs MIR21 MIR23A and MIR27A tha ......" | 24120476 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance; malignant trasformation; staging; metastasis | "MiR 21 upregulation induced by promoter zone histo ......" | 24460329 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance; poor survival | "Stromal microRNA 21 levels predict response to 5 f ......" | 25132574 | |
hsa-miR-21-3p | pancreatic cancer | staging | "Based on relevance to cancer a seven-miRNA signatu ......" | 25184537 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "Furthermore several studies have documented that s ......" | 25250326 | |
hsa-miR-21-3p | pancreatic cancer | metastasis; tumorigenesis; drug resistance; progression | "Antisense inhibition of microRNA 21 and microRNA 2 ......" | 25639539 | Flow cytometry |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "The purpose of this study was to investigate the i ......" | 25846727 | MTT assay; Western blot; Luciferase |
hsa-miR-21-3p | pancreatic cancer | poor survival | "We identified three miRNAs miR-21 miR-23a and miR- ......" | 26312859 | |
hsa-miR-21-3p | pancreatic cancer | staging | "At 25 weeks the miRNA microarray analysis revealed ......" | 26516699 | |
hsa-miR-21-3p | pancreatic cancer | staging | "miR 21 expression and clinical outcome in locally ......" | 26862857 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "MicroRNA 21 induces 5 fluorouracil resistance in h ......" | 26864640 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance; poor survival | "Locked Nucleic Acid In Situ Hybridization Analysis ......" | 26977002 | |
hsa-miR-21-3p | pancreatic cancer | drug resistance | "In particular modulations of let-7 miR-29a miR-17- ......" | 27539232 | |
hsa-miR-21-3p | prostate cancer | drug resistance; metastasis; motility | "MicroRNA 21 directly targets MARCKS and promotes a ......" | 19302977 | |
hsa-miR-21-3p | prostate cancer | drug resistance | "In this study we used high-throughput microarray a ......" | 19738047 | |
hsa-miR-21-3p | prostate cancer | drug resistance | "Involvement of microRNA 21 in mediating chemo resi ......" | 20581857 | Luciferase; Western blot |
hsa-miR-21-3p | prostate cancer | progression | "miR-21 has been recognized as an "onco-microRNA" w ......" | 20842666 | |
hsa-miR-21-3p | prostate cancer | progression | "Micro RNAs were isolated using the mirVana miRNA I ......" | 21880514 | |
hsa-miR-21-3p | prostate cancer | recurrence; staging; metastasis; poor survival | "miR 21 as an independent biochemical recurrence pr ......" | 22341810 | |
hsa-miR-21-3p | prostate cancer | staging; progression | "miR 21 may acts as an oncomir by targeting RECK a ......" | 22642976 | |
hsa-miR-21-3p | prostate cancer | recurrence | "miR 21 miR 221 and miR 222 expression and prostate ......" | 23353719 | |
hsa-miR-21-3p | prostate cancer | tumorigenesis; staging | "Essential role of NADPH oxidase dependent reactive ......" | 23682737 | |
hsa-miR-21-3p | prostate cancer | drug resistance | "MicroRNA 21 inhibits p57Kip2 expression in prostat ......" | 25216674 | |
hsa-miR-21-3p | prostate cancer | recurrence | "Investigation of miR 21 miR 141 and miR 221 expres ......" | 25252191 | |
hsa-miR-21-3p | prostate cancer | staging; metastasis; differentiation; recurrence | "High Level Expression of microRNA 21 in Peripheral ......" | 26247873 | |
hsa-miR-21-3p | prostate cancer | worse prognosis | "Promising preliminary results were published conce ......" | 26751899 | |
hsa-miR-21-3p | prostate cancer | drug resistance | "Overexpression of miR-21 increased the resistance ......" | 26843836 | |
hsa-miR-21-3p | prostate cancer | staging; progression; drug resistance; poor survival | "Association of microRNA 21 expression with clinico ......" | 27040772 | |
hsa-miR-21-3p | prostate cancer | staging | "To investigate the diagnostic potential of plasma ......" | 27268927 | |
hsa-miR-21-3p | prostate cancer | worse prognosis; poor survival; staging; metastasis; recurrence | "MicroRNA 21 in peripheral blood mononuclear cells ......" | 27434290 | |
hsa-miR-21-3p | prostate cancer | worse prognosis | "miR 15/miR 16 loss miR 21 upregulation or deregula ......" | 27652312 | |
hsa-miR-21-3p | retinoblastoma | malignant trasformation; progression | "Seed targeting anti miR 21 inhibiting malignant pr ......" | 24607444 | Flow cytometry; Colony formation |
hsa-miR-21-3p | retinoblastoma | metastasis; progression | "MicroRNA 21 Down regulates Rb1 Expression by Targe ......" | 25520758 | |
hsa-miR-21-3p | sarcoma | tumorigenesis | "Aberrant expression of microRNAs miRNAs including ......" | 19906824 | |
hsa-miR-21-3p | sarcoma | tumorigenesis | "MicroRNA 21 is involved in osteosarcoma cell invas ......" | 20480266 | |
hsa-miR-21-3p | sarcoma | metastasis | "Levels of six candidate miRNAs miR-21 miR-199a-3p ......" | 23269581 | |
hsa-miR-21-3p | sarcoma | worse prognosis; staging; drug resistance; poor survival | "Identification of serum microRNA 21 as a biomarker ......" | 23321165 | |
hsa-miR-21-3p | sarcoma | drug resistance | "MicroRNA 21 regulates the sensitivity to cisplatin ......" | 25381586 | |
hsa-miR-21-3p | sarcoma | malignant trasformation; drug resistance; cell migration | "MicroRNA 21 Increases Proliferation and Cisplatin ......" | 27513462 | |
hsa-miR-21-3p | thyroid cancer | staging; metastasis; worse prognosis | "MicroRNA-21 miR-21 specifically targets PDCD4 and ......" | 25316501 | |
hsa-miR-21-3p | thyroid cancer | recurrence | "MiR 9 and miR 21 as prognostic biomarkers for recu ......" | 26007293 | |
hsa-miR-21-3p | thyroid cancer | differentiation; progression | "Antisense miR 21 enhances differentiation/apoptosi ......" | 26289851 | Flow cytometry |
Reported gene related to hsa-miR-21-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-21-3p | B cell lymphoma | PTEN | "MiR-21 level was inversely correlated with the lev ......" | 25909227 |
hsa-miR-21-3p | B cell lymphoma | PTEN | "Moreover knockdown of miR-21 increased PDCD4 and P ......" | 23548551 |
hsa-miR-21-3p | B cell lymphoma | PTEN | "Moreover knockdown of miR-21 increased the express ......" | 25543482 |
hsa-miR-21-3p | B cell lymphoma | PTEN | "This study was aimed to investigate the expression ......" | 24763002 |
hsa-miR-21-3p | bladder cancer | PTEN | "The expression of miR-21 and its target PTEN was d ......" | 21468550 |
hsa-miR-21-3p | bladder cancer | PTEN | "microRNA 21 Regulates Cell Proliferation and Migra ......" | 26230405 |
hsa-miR-21-3p | breast cancer | PTEN | "In addition treated with 5-AZA resulted in signifi ......" | 26387181 |
hsa-miR-21-3p | breast cancer | PTEN | "Here we demonstrated that miR-21 expression was up ......" | 21471222 |
hsa-miR-21-3p | breast cancer | PTEN | "The effect of ZA on miR-21 expression was quantifi ......" | 26905520 |
hsa-miR-21-3p | breast cancer | PTEN | "In the same patients we also compared miR-21 expre ......" | 25027758 |
hsa-miR-21-3p | breast cancer | PTEN | "MicroRNA 21 modulates chemosensitivity of breast c ......" | 21820606 |
hsa-miR-21-3p | breast cancer | PTEN | "In present study we determined the miR-21 levels i ......" | 24930006 |
hsa-miR-21-3p | breast cancer | PTEN | "Induction of miR-21 may enable cancer cells to elu ......" | 22547075 |
hsa-miR-21-3p | breast cancer | PTEN | "PTEN a direct target gene of miR-21 was significan ......" | 26666820 |
hsa-miR-21-3p | breast cancer | PTEN | "The results showed that knockdown of miR-21 by ant ......" | 23951172 |
hsa-miR-21-3p | breast cancer | PTEN | "MiR-21 upregulation contributes to PTEN downregula ......" | 25647415 |
hsa-miR-21-3p | breast cancer | PTEN | "Furthermore miR-21-induced upregulation of CSF-1 m ......" | 22678116 |
hsa-miR-21-3p | breast cancer | PTEN | "After miR-21 was transfected in MCF-7 cells PTEN p ......" | 22832383 |
hsa-miR-21-3p | breast cancer | PTEN | "To further determine the potential involvement of ......" | 19212625 |
hsa-miR-21-3p | cervical and endocervical cancer | PTEN | "Furthermore we identified that miR-21 overexpressi ......" | 26384051 |
hsa-miR-21-3p | cervical and endocervical cancer | PTEN | "Overexpression of miR 21 promotes the proliferatio ......" | 25963606 |
hsa-miR-21-3p | cervical and endocervical cancer | PTEN | "MiR-21 overexpression decreases PTEN increases p-A ......" | 27220494 |
hsa-miR-21-3p | cervical and endocervical cancer | PTEN | "Relevance of miR 21 in regulation of tumor suppres ......" | 26975392 |
hsa-miR-21-3p | colon cancer | PTEN | "Inhibition of microRNA-21 mir‑21 induced upregul ......" | 22322462 |
hsa-miR-21-3p | colon cancer | PTEN | "NTR1 activation stimulates expression of miR-21 an ......" | 21806946 |
hsa-miR-21-3p | colon cancer | PTEN | "Difluorinated curcumin CDF restores PTEN expressio ......" | 23894315 |
hsa-miR-21-3p | colon cancer | PTEN | "Mechanistic evidence showed that down-regulation o ......" | 26236156 |
hsa-miR-21-3p | colon cancer | PTEN | "These findings demonstrate a novel role of AR in t ......" | 22978663 |
hsa-miR-21-3p | colorectal cancer | PTEN | "Expressions of PTEN were significantly down-regula ......" | 24780321 |
hsa-miR-21-3p | colorectal cancer | PTEN | "Quantitative real-time PCR qRT-PCR and Western blo ......" | 27350731 |
hsa-miR-21-3p | colorectal cancer | PTEN | "The levels of mir-21 did not associate with the ex ......" | 22120473 |
hsa-miR-21-3p | colorectal cancer | PTEN | "The PTEN protein levels in CRC tissues and cells h ......" | 23174819 |
hsa-miR-21-3p | colorectal cancer | PTEN | "The prognostic effect of PTEN expression status in ......" | 26787105 |
hsa-miR-21-3p | colorectal cancer | PTEN | "MicroRNA 21 controls hTERT via PTEN in human color ......" | 25603978 |
hsa-miR-21-3p | endometrial cancer | PTEN | "microRNA 21 overexpression contributes to cell pro ......" | 23226804 |
hsa-miR-21-3p | esophageal cancer | PTEN | "We also found that Rawq01 up-regulated the express ......" | 24324076 |
hsa-miR-21-3p | esophageal cancer | PTEN | "The expressions of miR-21 PTEN PI3K and AKT were d ......" | 27188433 |
hsa-miR-21-3p | esophageal cancer | PTEN | "The expression level of miR-21 and PTEN messenger ......" | 22958183 |
hsa-miR-21-3p | esophageal cancer | PTEN | "Role of microRNA 21 and effect on PTEN in Kazakh's ......" | 21104017 |
hsa-miR-21-3p | esophageal cancer | PTEN | "Down regulation of PTEN expression modulated by dy ......" | 24221338 |
hsa-miR-21-3p | gastric cancer | PTEN | "microRNA 21 promotes tumor proliferation and invas ......" | 22267008 |
hsa-miR-21-3p | gastric cancer | PTEN | "Bmi-1 also regulates p53 and PTEN via miR-21 ......" | 27644439 |
hsa-miR-21-3p | gastric cancer | PTEN | "Correlations between the expression levels of miR- ......" | 24154840 |
hsa-miR-21-3p | gastric cancer | PTEN | "MicroRNA 21 promotes TGF β1 induced epithelial me ......" | 27611950 |
hsa-miR-21-3p | gastric cancer | PTEN | "The protein levels of miR-21 targets PTEN and PDCD ......" | 24659669 |
hsa-miR-21-3p | gastric cancer | PTEN | "miR 21 confers cisplatin resistance in gastric can ......" | 23466500 |
hsa-miR-21-3p | glioblastoma | PTEN | "MicroRNA 21 inhibitor sensitizes human glioblastom ......" | 20113523 |
hsa-miR-21-3p | glioblastoma | PTEN | "There was overexpression of the miR-21 target gene ......" | 26559642 |
hsa-miR-21-3p | glioblastoma | PTEN | "Moreover we demonstrate that oligonucleotide-media ......" | 23201752 |
hsa-miR-21-3p | glioblastoma | PTEN | "Downregulation of miR 21 inhibits EGFR pathway and ......" | 20048743 |
hsa-miR-21-3p | glioblastoma | PTEN | "Finally we demonstrate that modulation of tumor su ......" | 22922228 |
hsa-miR-21-3p | liver cancer | PTEN | "MicroRNA 21 suppresses PTEN and hSulf 1 expression ......" | 23684551 |
hsa-miR-21-3p | liver cancer | PTEN | "MicroRNA 21 regulates expression of the PTEN tumor ......" | 17681183 |
hsa-miR-21-3p | liver cancer | PTEN | "PDCD4 and PTEN expression was decreased gradually ......" | 25973032 |
hsa-miR-21-3p | liver cancer | PTEN | "Exposure of HCC cells to sorafenib led to an incre ......" | 26311740 |
hsa-miR-21-3p | lung cancer | PTEN | "Over-expression of miR-21 suppressed its target PT ......" | 23036707 |
hsa-miR-21-3p | lung cancer | PTEN | "The expression of miR-21 PTEN and PDCD4 were deter ......" | 21842656 |
hsa-miR-21-3p | lung cancer | PTEN | "Expressions of microRNA-21 miR-21 PTEN MMP9 and p4 ......" | 25563770 |
hsa-miR-21-3p | lung cancer | PTEN | "In vitro study showed QTsome/AM-21 induced upregul ......" | 26741162 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "Triptolide reduces proliferation and enhances apop ......" | 26847601 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "The level of miR-21 was reversely correlated with ......" | 24331411 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "MiR 21 suppresses the anticancer activities of cur ......" | 24293118 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "MicroRNA 21 miR 21 expression promotes growth meta ......" | 22956424 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "This study aimed to investigate whether NSCLC miR- ......" | 25058005 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "MicroRNA 21 miR 21 represses tumor suppressor PTEN ......" | 20223231 |
hsa-miR-21-3p | lung squamous cell cancer | PTEN | "Whether miR-21 regulated PTEN expression was asses ......" | 25799148 |
hsa-miR-21-3p | melanoma | PTEN | "We previously reported that microRNA-21 miR-21 was ......" | 26731559 |
hsa-miR-21-3p | pancreatic cancer | PTEN | "Protein levels of tumor suppressor targets of the ......" | 19730150 |
hsa-miR-21-3p | pancreatic cancer | PTEN | "Finally invasion and metastasis assays were perfor ......" | 24460329 |
hsa-miR-21-3p | pancreatic cancer | PTEN | "Anti tumor activity of a novel compound CDF is med ......" | 21408027 |
hsa-miR-21-3p | pancreatic cancer | PTEN | "MicroRNA 21 induces 5 fluorouracil resistance in h ......" | 26864640 |
hsa-miR-21-3p | prostate cancer | PTEN | "In the present study we investigated the role of m ......" | 20092645 |
hsa-miR-21-3p | prostate cancer | PTEN | "The results showed that upon exposure to mUA miR-2 ......" | 27725205 |
hsa-miR-21-3p | thyroid cancer | PTEN | "PTEN gene expression was performed as a known targ ......" | 26289851 |
hsa-miR-21-3p | B cell lymphoma | PDCD4 | "Moreover knockdown of miR-21 increased PDCD4 and P ......" | 23548551 |
hsa-miR-21-3p | B cell lymphoma | PDCD4 | "Moreover knockdown of miR-21 increased the express ......" | 25543482 |
hsa-miR-21-3p | acute myeloid leukemia | PDCD4 | "In this study we analyzed the expression of miR-21 ......" | 25543261 |
hsa-miR-21-3p | breast cancer | PDCD4 | "Programmed cell death 4 PDCD4 is an important func ......" | 17991735 |
hsa-miR-21-3p | breast cancer | PDCD4 | "We also demonstrated that BMP-6-induced downregula ......" | 19308091 |
hsa-miR-21-3p | breast cancer | PDCD4 | "The results indicated that the miR-21 inhibition c ......" | 26169933 |
hsa-miR-21-3p | breast cancer | PDCD4 | "Induction of miR-21 may enable cancer cells to elu ......" | 22547075 |
hsa-miR-21-3p | breast cancer | PDCD4 | "The effects were accompanied by up-regulation of t ......" | 22086602 |
hsa-miR-21-3p | breast cancer | PDCD4 | "Increased levels of miR-21 in turn downregulate th ......" | 26212010 |
hsa-miR-21-3p | breast cancer | PDCD4 | "Fenhexamid and fludioxonil stimulated miR-21 expre ......" | 23052036 |
hsa-miR-21-3p | breast cancer | PDCD4 | "This process leads to microRNA-21 miR-21 productio ......" | 19633292 |
hsa-miR-21-3p | breast cancer | PDCD4 | "Through dual-luciferase method it was verified tha ......" | 25566594 |
hsa-miR-21-3p | cervical and endocervical cancer | PDCD4 | "MicroRNA 21 promotes cell proliferation and down r ......" | 19682430 |
hsa-miR-21-3p | chronic myeloid leukemia | PDCD4 | "We identified miR-21 was directly downregulated by ......" | 25575817 |
hsa-miR-21-3p | colon cancer | PDCD4 | "Although microRNA-21 miR-21 is emerging as an onco ......" | 22072622 |
hsa-miR-21-3p | colon cancer | PDCD4 | "This short review will focus on our recent finding ......" | 19836969 |
hsa-miR-21-3p | colon cancer | PDCD4 | "Aldose reductase inhibition suppresses colon cance ......" | 23827854 |
hsa-miR-21-3p | colon cancer | PDCD4 | "METHODS 3-45-dimethylthiazol-2-yl-25-diphenyltetra ......" | 26418978 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "Prognostic significance of PDCD4 expression and as ......" | 22267128 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "Furthermore the absence of miR-21 increased the ex ......" | 25994220 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "Finally in a subgroup of tumor specimens ROC curve ......" | 24149370 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "Curcumin treatment reduced miR-21 promoter activit ......" | 20815812 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "MicroRNA 21 miR 21 post transcriptionally downregu ......" | 17968323 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "Inflammation and MiR 21 pathways functionally inte ......" | 25310697 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "MicroRNA 21 and PDCD4 expression in colorectal can ......" | 21546206 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "Expression patterns of miR-21 RNA and its target t ......" | 19509156 |
hsa-miR-21-3p | colorectal cancer | PDCD4 | "miR-21 and miR-155 expression was assessed in tumo ......" | 21412018 |
hsa-miR-21-3p | endometrial cancer | PDCD4 | "Maspin Pdcd4 and miR-21 expressions were evaluated ......" | 21330826 |
hsa-miR-21-3p | esophageal cancer | PDCD4 | "In ZD esophagus and tongue oncogenic miR-31 and mi ......" | 22689922 |
hsa-miR-21-3p | esophageal cancer | PDCD4 | "It has been reported that miR-21 was upregulated i ......" | 25400316 |
hsa-miR-21-3p | esophageal cancer | PDCD4 | "Exosome shuttling microRNA 21 promotes cell migrat ......" | 27035745 |
hsa-miR-21-3p | esophageal cancer | PDCD4 | "The aim of this study was a to determine a role of ......" | 19276261 |
hsa-miR-21-3p | gastric cancer | PDCD4 | "PDCD4 expression inversely correlated with miR 21 ......" | 22212233 |
hsa-miR-21-3p | gastric cancer | PDCD4 | "Clinicopathological and prognostic significance of ......" | 20372781 |
hsa-miR-21-3p | gastric cancer | PDCD4 | "Oxidative stress upregulates PDCD4 expression in p ......" | 23888942 |
hsa-miR-21-3p | gastric cancer | PDCD4 | "The protein levels of miR-21 targets PTEN and PDCD ......" | 24659669 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "In this study using reverse phase protein arrays R ......" | 25991676 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "Due to inhibition of miR-21 expression of the prog ......" | 27355932 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "Moreover we demonstrate that oligonucleotide-media ......" | 23201752 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "MicroRNA 21 down regulates the expression of tumor ......" | 19013014 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "Programmed cell death 4 PDCD4 is critical in media ......" | 26142886 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "MiR 21 mediates the radiation resistance of gliobl ......" | 23904372 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "The expression of programmed cell death 4 PDCD4 wh ......" | 22353043 |
hsa-miR-21-3p | glioblastoma | PDCD4 | "Downregulation of Pdcd4 by mir 21 facilitates glio ......" | 21636706 |
hsa-miR-21-3p | head and neck cancer | PDCD4 | "Treatment of HSC-3 cells with Nanog- and/or Stat-3 ......" | 21685938 |
hsa-miR-21-3p | kidney renal cell cancer | PDCD4 | "MicroRNA 21 miR 21 post transcriptionally downregu ......" | 24902663 |
hsa-miR-21-3p | kidney renal cell cancer | PDCD4 | "Furthermore miR-21 mimic or inhibitor significantl ......" | 23558936 |
hsa-miR-21-3p | liver cancer | PDCD4 | "miR 21 promotes migration and invasion by the miR ......" | 22322403 |
hsa-miR-21-3p | liver cancer | PDCD4 | "HBx mediated miR 21 upregulation represses tumor s ......" | 23604124 |
hsa-miR-21-3p | liver cancer | PDCD4 | "Transfection of anti-miR-21 rendered HCC cells sen ......" | 20978511 |
hsa-miR-21-3p | liver cancer | PDCD4 | "PDCD4 and PTEN expression was decreased gradually ......" | 25973032 |
hsa-miR-21-3p | lung cancer | PDCD4 | "The expression of miR-21 PTEN and PDCD4 were deter ......" | 21842656 |
hsa-miR-21-3p | lung squamous cell cancer | PDCD4 | "The expression of miR-21 and PDCD4 mRNA in transfe ......" | 25477028 |
hsa-miR-21-3p | lung squamous cell cancer | PDCD4 | "The level of miR-21 was reversely correlated with ......" | 24331411 |
hsa-miR-21-3p | lung squamous cell cancer | PDCD4 | "Sequence prediction and gene expression regulation ......" | 22335905 |
hsa-miR-21-3p | melanoma | PDCD4 | "To measure levels of microRNA miR-21 and its targe ......" | 26150475 |
hsa-miR-21-3p | ovarian cancer | PDCD4 | "Berberine could inhibit miR-21 expression and func ......" | 23824073 |
hsa-miR-21-3p | ovarian cancer | PDCD4 | "Overexpression of miR-21 in cisplatin sensitive ce ......" | 24865582 |
hsa-miR-21-3p | ovarian cancer | PDCD4 | "Programmed cell death 4 PDCD4 is a tumor suppresso ......" | 24888238 |
hsa-miR-21-3p | ovarian cancer | PDCD4 | "Using Western blot analysis miR-21 knockdown enhan ......" | 24472409 |
hsa-miR-21-3p | pancreatic cancer | PDCD4 | "The expression of programmed cell death-4 PDCD4 wa ......" | 23564788 |
hsa-miR-21-3p | pancreatic cancer | PDCD4 | "MicroRNA 21 induces 5 fluorouracil resistance in h ......" | 26864640 |
hsa-miR-21-3p | prostate cancer | PDCD4 | "Additionally resveratrol increased the expression ......" | 23272133 |
hsa-miR-21-3p | prostate cancer | PDCD4 | "IL 6 Inhibits the Targeted Modulation of PDCD4 by ......" | 26252635 |
hsa-miR-21-3p | prostate cancer | PDCD4 | "Interestingly NVP-LDE-225 induced PDCD4 and apopto ......" | 23567619 |
hsa-miR-21-3p | prostate cancer | PDCD4 | "PDCD4 a direct target gene of miR-21 could mediate ......" | 20581857 |
hsa-miR-21-3p | prostate cancer | PDCD4 | "The results showed that upon exposure to mUA miR-2 ......" | 27725205 |
hsa-miR-21-3p | retinoblastoma | PDCD4 | "MicroRNA 21 Down regulates Rb1 Expression by Targe ......" | 25520758 |
hsa-miR-21-3p | thyroid cancer | PDCD4 | "MTCs were consistently associated with miR-21 up-r ......" | 25316501 |
hsa-miR-21-3p | thyroid cancer | PDCD4 | "We also analyzed the immunohistochemical expressio ......" | 22747440 |
hsa-miR-21-3p | breast cancer | STAT3 | "NF-κB-dependent IL-6 up-regulation is responsible ......" | 22547075 |
hsa-miR-21-3p | breast cancer | STAT3 | "Moreover we showed that Stat3 co-opts NErbB-2 func ......" | 26212010 |
hsa-miR-21-3p | breast cancer | STAT3 | "Finally western blotting was performed to determin ......" | 26549725 |
hsa-miR-21-3p | colorectal cancer | STAT3 | "Meanwhile miR-21 loss reduced STAT3 and Bcl-2 acti ......" | 25994220 |
hsa-miR-21-3p | glioblastoma | STAT3 | "Meanwhile the expression of STAT3 and p-STAT3 decr ......" | 20113523 |
hsa-miR-21-3p | glioblastoma | STAT3 | "MiR 21 modulates hTERT through a STAT3 dependent m ......" | 22709411 |
hsa-miR-21-3p | head and neck cancer | STAT3 | "Abnormal activation of STAT3 and miR-21 plays a vi ......" | 26690371 |
hsa-miR-21-3p | liver cancer | STAT3 | "Subsequently we showed that the upregulation of mi ......" | 25087183 |
hsa-miR-21-3p | liver cancer | STAT3 | "Invasion and migration of HCC cells in vitro were ......" | 25720799 |
hsa-miR-21-3p | melanoma | STAT3 | "We found that miR-21 is a member of an IFN-induced ......" | 21940630 |
hsa-miR-21-3p | breast cancer | AR | "Androgens downregulate miR 21 expression in breast ......" | 26862856 |
hsa-miR-21-3p | colon cancer | AR | "Further AR inhibition also increased PDCD4 a putat ......" | 23827854 |
hsa-miR-21-3p | colon cancer | AR | "Inhibition of AR significantly downregulated growt ......" | 22978663 |
hsa-miR-21-3p | liver cancer | AR | "These results suggest that physiological concentra ......" | 25969534 |
hsa-miR-21-3p | prostate cancer | AR | "Using microarray studies we show that resveratrol ......" | 23272133 |
hsa-miR-21-3p | prostate cancer | AR | "We found that the activated AR directly interacts ......" | 20160498 |
hsa-miR-21-3p | prostate cancer | AR | "We show androgen-induced AR binding to the defined ......" | 19738047 |
hsa-miR-21-3p | prostate cancer | AR | "Androgen receptor and microRNA 21 axis downregulat ......" | 24037531 |
hsa-miR-21-3p | glioblastoma | EGFR | "Thus the miR-21 inhibitor might interrupt the acti ......" | 20113523 |
hsa-miR-21-3p | glioblastoma | EGFR | "Further the expression of miR-21 is regulated by E ......" | 24012640 |
hsa-miR-21-3p | glioblastoma | EGFR | "Downregulation of miR 21 inhibits EGFR pathway and ......" | 20048743 |
hsa-miR-21-3p | lung cancer | EGFR | "MiR 21 is an EGFR regulated anti apoptotic factor ......" | 19597153 |
hsa-miR-21-3p | lung cancer | EGFR | "Nickel may contribute to EGFR mutation and synergi ......" | 26026961 |
hsa-miR-21-3p | lung squamous cell cancer | EGFR | "In radically resected NSCLC patients the expressio ......" | 24198203 |
hsa-miR-21-3p | lung squamous cell cancer | EGFR | "MiR 21 overexpression is associated with acquired ......" | 24331411 |
hsa-miR-21-3p | lung squamous cell cancer | EGFR | "Higher expression levels of miR-21 AmiR-27a and mi ......" | 26563758 |
hsa-miR-21-3p | bladder cancer | TP53 | "In contrast generalized increased expression of mi ......" | 23911686 |
hsa-miR-21-3p | bladder cancer | TP53 | "High-grade UCC were characterized by microRNA upre ......" | 19843843 |
hsa-miR-21-3p | bladder cancer | TP53 | "microRNA 21 Regulates Cell Proliferation and Migra ......" | 26230405 |
hsa-miR-21-3p | gastric cancer | TP53 | "Bmi-1 also regulates p53 and PTEN via miR-21 ......" | 27644439 |
hsa-miR-21-3p | glioblastoma | TP53 | "Cell exposure to pifithrin an inhibitor of p53 tra ......" | 23201752 |
hsa-miR-21-3p | glioblastoma | TP53 | "Finally we demonstrate that modulation of tumor su ......" | 22922228 |
hsa-miR-21-3p | glioblastoma | TP53 | "In this study we show for the first time that miR- ......" | 18829576 |
hsa-miR-21-3p | liver cancer | TP53 | "MicroRNA 21 is a potential link between non alcoho ......" | 26282675 |
hsa-miR-21-3p | bladder cancer | BCL2 | "BCL-2 up-regulation could be achieved by miR-21 ov ......" | 21468550 |
hsa-miR-21-3p | breast cancer | BCL2 | "The expression of Bax Bcl-2 and miR-21 in parental ......" | 26555418 |
hsa-miR-21-3p | colorectal cancer | BCL2 | "Meanwhile miR-21 loss reduced STAT3 and Bcl-2 acti ......" | 25994220 |
hsa-miR-21-3p | lung cancer | BCL2 | "Tumors harvested from these lungs have elevated le ......" | 22964582 |
hsa-miR-21-3p | pancreatic cancer | BCL2 | "Resveratrol induces apoptosis of pancreatic cancer ......" | 23359184 |
hsa-miR-21-3p | pancreatic cancer | BCL2 | "Bcl 2 upregulation induced by miR 21 via a direct ......" | 21376256 |
hsa-miR-21-3p | sarcoma | BCL2 | "Changes in the sensitivity of osteosarcoma cells t ......" | 25381586 |
hsa-miR-21-3p | cervical and endocervical cancer | CDC37 | "Furthermore we identified that miR-21 overexpressi ......" | 26384051 |
hsa-miR-21-3p | colorectal cancer | CDC37 | "Here we show that expression of miR-21 in HEK293 a ......" | 21872591 |
hsa-miR-21-3p | esophageal cancer | CDC37 | "Inhibition of microRNA 21 increases radiosensitivi ......" | 22958183 |
hsa-miR-21-3p | gastric cancer | CDC37 | "MicroRNA 21 stimulates gastric cancer growth and i ......" | 24659669 |
hsa-miR-21-3p | gastric cancer | CDC37 | "In addition miR-21 induced cell survival and cispl ......" | 23466500 |
hsa-miR-21-3p | liver cancer | CDC37 | "Indole 3 carbinol inhibits tumorigenicity of hepat ......" | 25447674 |
hsa-miR-21-3p | lung cancer | CDC37 | "Further studies with miR-21 indicated that phospha ......" | 19748927 |
hsa-miR-21-3p | breast cancer | PTGS2 | "Correlations between the dysregulation of miR-21 m ......" | 27420617 |
hsa-miR-21-3p | colorectal cancer | PTGS2 | "Gene expression profile in tumour and paired norma ......" | 25310697 |
hsa-miR-21-3p | colorectal cancer | PTGS2 | "MicroRNA MIR21 miR 21 and PTGS2 Expression in Colo ......" | 26957558 |
hsa-miR-21-3p | gastric cancer | PTGS2 | "miR 21 inhibits the effects of cyclooxygenase 2 in ......" | 26604791 |
hsa-miR-21-3p | liver cancer | PTGS2 | "Correlation of microRNA 16 microRNA 21 and microRN ......" | 24759835 |
hsa-miR-21-3p | pancreatic cancer | PTGS2 | "In a xenograft mouse model of human PC CDF treatme ......" | 21408027 |
hsa-miR-21-3p | breast cancer | CASP3 | "The results indicated that the miR-21 inhibition c ......" | 26169933 |
hsa-miR-21-3p | cervical and endocervical cancer | CASP3 | "The inhibition of miR-21 in E7-overexpressin Hela ......" | 26884851 |
hsa-miR-21-3p | glioblastoma | CASP3 | "MiR 21 protected human glioblastoma U87MG cells fr ......" | 20633539 |
hsa-miR-21-3p | glioblastoma | CASP3 | "There was overexpression of the miR-21 target gene ......" | 26559642 |
hsa-miR-21-3p | glioblastoma | CASP3 | "UA increased the activation of caspase-3 and marke ......" | 22353043 |
hsa-miR-21-3p | breast cancer | IL6 | "NF-κB-dependent IL-6 up-regulation is responsible ......" | 22547075 |
hsa-miR-21-3p | colorectal cancer | IL6 | "IL6 Mediates Immune and Colorectal Cancer Cell Cro ......" | 26184038 |
hsa-miR-21-3p | liver cancer | IL6 | "Hepatitis B virus X protein promotes hepatocellula ......" | 25087183 |
hsa-miR-21-3p | pancreatic cancer | IL6 | "Hypoxia induced aggressiveness of pancreatic cance ......" | 23272057 |
hsa-miR-21-3p | prostate cancer | IL6 | "IL 6 Inhibits the Targeted Modulation of PDCD4 by ......" | 26252635 |
hsa-miR-21-3p | gastric cancer | RECK | "Finally we showed that RECK a known tumor suppress ......" | 18794849 |
hsa-miR-21-3p | liver cancer | RECK | "We verified that HMGB1-induced expression of miR-2 ......" | 25720799 |
hsa-miR-21-3p | pancreatic cancer | RECK | "Protein levels of tumor suppressor targets of the ......" | 19730150 |
hsa-miR-21-3p | prostate cancer | RECK | "miR 21 may acts as an oncomir by targeting RECK a ......" | 22642976 |
hsa-miR-21-3p | sarcoma | RECK | "Furthermore we identified that RECK reversion-indu ......" | 20480266 |
hsa-miR-21-3p | breast cancer | TIMP3 | "Genetic heterogeneity of breast cancer metastasis ......" | 23936642 |
hsa-miR-21-3p | breast cancer | TIMP3 | "The aim of this study was to determine whether mic ......" | 20346171 |
hsa-miR-21-3p | kidney renal cell cancer | TIMP3 | "The effect of TIMP3 on miR-21-induced cell surviva ......" | 21820586 |
hsa-miR-21-3p | liver cancer | TIMP3 | "We verified that HMGB1-induced expression of miR-2 ......" | 25720799 |
hsa-miR-21-3p | melanoma | TIMP3 | "It was previously shown by our group that miR-21 a ......" | 25587717 |
hsa-miR-21-3p | colorectal cancer | TNS1 | "The aim of this study was to determine a role of m ......" | 25603978 |
hsa-miR-21-3p | esophageal cancer | TNS1 | "Inhibition of microRNA 21 increases radiosensitivi ......" | 22958183 |
hsa-miR-21-3p | gastric cancer | TNS1 | "MicroRNA 21 stimulates gastric cancer growth and i ......" | 24659669 |
hsa-miR-21-3p | liver cancer | TNS1 | "Indole 3 carbinol inhibits tumorigenicity of hepat ......" | 25447674 |
hsa-miR-21-3p | lung cancer | TNS1 | "Further studies with miR-21 indicated that phospha ......" | 19748927 |
hsa-miR-21-3p | breast cancer | CDC25A | "33' Diindolylmethane negatively regulates Cdc25A a ......" | 20724916 |
hsa-miR-21-3p | breast cancer | CDC25A | "33' Diindolylmethane inhibits breast cancer cell g ......" | 21761201 |
hsa-miR-21-3p | colon cancer | CDC25A | "microRNA 21 negatively regulates Cdc25A and cell c ......" | 19826040 |
hsa-miR-21-3p | glioblastoma | CDC25A | "Further research demonstrated that the miR-21 inhi ......" | 21618027 |
hsa-miR-21-3p | breast cancer | ESR1 | "miR-21 is higher in ER alpha positive than negativ ......" | 19264808 |
hsa-miR-21-3p | breast cancer | ESR1 | "Odds ratios ORs showed that miR-21 expression was ......" | 25337203 |
hsa-miR-21-3p | breast cancer | ESR1 | "Induction of miR 21 by retinoic acid in estrogen r ......" | 21131358 |
hsa-miR-21-3p | liver cancer | ESR1 | "Dehydroepiandrosterone Activation of G protein cou ......" | 25969534 |
hsa-miR-21-3p | breast cancer | FASLG | "miR 21 targets Fas ligand mediated apoptosis in br ......" | 24710931 |
hsa-miR-21-3p | gastric cancer | FASLG | "miR 21 regulates N methyl N nitro N' nitrosoguanid ......" | 24821435 |
hsa-miR-21-3p | glioblastoma | FASLG | "MiR 21 up regulation mediates glioblastoma cancer ......" | 25394756 |
hsa-miR-21-3p | pancreatic cancer | FASLG | "The serum miR 21 level serves as a predictor for t ......" | 23177026 |
hsa-miR-21-3p | breast cancer | HGS | "With respect to survival outcomes the pooled hazar ......" | 25706383 |
hsa-miR-21-3p | colorectal cancer | HGS | "Pooled hazard ratios HRs of miR-21 for survival an ......" | 24265822 |
hsa-miR-21-3p | colorectal cancer | HGS | "Pooled hazard ratios HRs with 95% confidence inter ......" | 27226723 |
hsa-miR-21-3p | colorectal cancer | HGS | "For prognostic meta-analysis study-specific HRs of ......" | 25178983 |
hsa-miR-21-3p | liver cancer | HRAS | "Finally the expression of the miRNA21 gene in the ......" | 25730004 |
hsa-miR-21-3p | lung cancer | HRAS | "Modulation of K Ras dependent lung tumorigenesis b ......" | 20832755 |
hsa-miR-21-3p | lung squamous cell cancer | HRAS | "Noteworthy we observed a significant association b ......" | 23820752 |
hsa-miR-21-3p | lung squamous cell cancer | HRAS | "Significantly higher miR-21 expression was observe ......" | 25436007 |
hsa-miR-21-3p | breast cancer | MSH2 | "Furthermore the expression of MSH2 and SMAD7 two i ......" | 23372687 |
hsa-miR-21-3p | glioblastoma | MSH2 | "In this study using reverse phase protein arrays R ......" | 25991676 |
hsa-miR-21-3p | glioblastoma | MSH2 | "MiR 21 mediates the radiation resistance of gliobl ......" | 23904372 |
hsa-miR-21-3p | lung cancer | MSH2 | "miR 21 induces cell cycle at S phase and modulates ......" | 22806311 |
hsa-miR-21-3p | gastric cancer | ROS1 | "Thus we conclude that ROS promotes gastric carcino ......" | 23888942 |
hsa-miR-21-3p | lung cancer | ROS1 | "Scavenge of ROS abrogated the up-regulation of miR ......" | 27286259 |
hsa-miR-21-3p | lung squamous cell cancer | ROS1 | "The role of TGF β1 miR 21 ROS pathway in bystande ......" | 24992582 |
hsa-miR-21-3p | prostate cancer | ROS1 | "Finally ROS activated Akt in these cells the inhib ......" | 23682737 |
hsa-miR-21-3p | bladder cancer | SERPINB5 | "Expression and clinical significance of microRNA 2 ......" | 26622898 |
hsa-miR-21-3p | breast cancer | SERPINB5 | "Up-regulation of miR-21 results in retinoid-depend ......" | 21131358 |
hsa-miR-21-3p | endometrial cancer | SERPINB5 | "Highly increased maspin expression corresponds wit ......" | 21330826 |
hsa-miR-21-3p | prostate cancer | SERPINB5 | "Additionally resveratrol increased the expression ......" | 23272133 |
hsa-miR-21-3p | esophageal cancer | CYLD | "Differentially expressed miRNA analysis selected f ......" | 25098614 |
hsa-miR-21-3p | esophageal cancer | CYLD | "miR-148a levels were lower when EAC was more proxi ......" | 20628822 |
hsa-miR-21-3p | esophageal cancer | CYLD | "The aim of this study was to evaluate the prognost ......" | 26481465 |
hsa-miR-21-3p | breast cancer | EGF | "MicroRNA 21 induces breast cancer cell invasion an ......" | 26531758 |
hsa-miR-21-3p | breast cancer | EGF | "When tumor compartment and levels of miR-21 expres ......" | 25440114 |
hsa-miR-21-3p | colorectal cancer | EGF | "Herein we examine the regulation of miR-21 express ......" | 22553926 |
hsa-miR-21-3p | breast cancer | ERBB2 | "In this study we investigate whether combination o ......" | 25669446 |
hsa-miR-21-3p | breast cancer | ERBB2 | "MicroRNA 21 links epithelial to mesenchymal transi ......" | 26452030 |
hsa-miR-21-3p | gastric cancer | ERBB2 | "Overexpression of miR-21 down-regulated PTEN expre ......" | 24154840 |
hsa-miR-21-3p | B cell lymphoma | GBA | "Interestingly expression levels of both miR-155 an ......" | 17487835 |
hsa-miR-21-3p | B cell lymphoma | GBA | "We found no association of miR-155 and miR-21 with ......" | 25265435 |
hsa-miR-21-3p | B cell lymphoma | GBA | "Moreover miR-21 expression levels in serum of pati ......" | 24400911 |
hsa-miR-21-3p | cervical and endocervical cancer | INSR | "In addition we also demonstrated that miR-21 confe ......" | 27220494 |
hsa-miR-21-3p | glioblastoma | INSR | "In this study we found that miR-21 expression was ......" | 21618027 |
hsa-miR-21-3p | lung squamous cell cancer | INSR | "Downregulation of miR-21 in radioresistant NSCLC A ......" | 24804226 |
hsa-miR-21-3p | breast cancer | JUN | "Further analyses revealed that miR-21 is regulated ......" | 24606718 |
hsa-miR-21-3p | colorectal cancer | JUN | "PMA stimulation induced miR-21 expression via moti ......" | 20815812 |
hsa-miR-21-3p | ovarian cancer | JUN | "Upregulation of miR 21 in cisplatin resistant ovar ......" | 24865582 |
hsa-miR-21-3p | breast cancer | MTOR | "Silencing of MicroRNA 21 confers the sensitivity t ......" | 26796263 |
hsa-miR-21-3p | cervical and endocervical cancer | MTOR | "MiR 21 modulates radiosensitivity of cervical canc ......" | 27220494 |
hsa-miR-21-3p | gastric cancer | MTOR | "Celastrol induces cell cycle arrest by MicroRNA 21 ......" | 26500453 |
hsa-miR-21-3p | breast cancer | NFASC | "DNA damage induces NF κB dependent microRNA 21 up ......" | 22547075 |
hsa-miR-21-3p | gastric cancer | NFASC | "Celastrol induces apoptosis of gastric cancer cell ......" | 24434352 |
hsa-miR-21-3p | gastric cancer | NFASC | "NF κB targets miR 16 and miR 21 in gastric cancer ......" | 21081469 |
hsa-miR-21-3p | breast cancer | SMAD7 | "Furthermore the expression of MSH2 and SMAD7 two i ......" | 23372687 |
hsa-miR-21-3p | breast cancer | SMAD7 | "MicroRNA 21 induces breast cancer cell invasion an ......" | 26531758 |
hsa-miR-21-3p | lung squamous cell cancer | SMAD7 | "MicroRNA 21 Regulates Non Small Cell Lung Cancer C ......" | 27185036 |
hsa-miR-21-3p | B cell lymphoma | ABCB6 | "Interestingly expression levels of both miR-155 an ......" | 17487835 |
hsa-miR-21-3p | B cell lymphoma | ABCB6 | "Moreover miR-21 expression levels in serum of pati ......" | 24400911 |
hsa-miR-21-3p | breast cancer | AKR1B1 | "Our aim is to investigate the association of miR-2 ......" | 21820606 |
hsa-miR-21-3p | colon cancer | AKR1B1 | "Aldose reductase inhibition suppresses colon cance ......" | 23827854 |
hsa-miR-21-3p | colorectal cancer | APC | "The prognostic significance of APC gene mutation a ......" | 23773491 |
hsa-miR-21-3p | colorectal cancer | APC | "MicroRNA 21 promotes tumour malignancy via increas ......" | 24832083 |
hsa-miR-21-3p | melanoma | BRAF | "The presence of a BRAF or NRAS mutation had no sig ......" | 26731559 |
hsa-miR-21-3p | melanoma | BRAF | "Notably common BRAF and NRAS mutations in cutaneou ......" | 26116372 |
hsa-miR-21-3p | colorectal cancer | CCL20 | "miR 21 and its target gene CCL20 are both highly o ......" | 23817679 |
hsa-miR-21-3p | colorectal cancer | CCL20 | "miR 21 functionally interacts with the 3'UTR of ch ......" | 22099878 |
hsa-miR-21-3p | colorectal cancer | CD44 | "Enhanced expression of CD44 CD166 and miR-21 with ......" | 27153478 |
hsa-miR-21-3p | pancreatic cancer | CD44 | "In the current study we showed for the first time ......" | 21408027 |
hsa-miR-21-3p | colorectal cancer | CDH1 | "The absence of miR-21 resulted in the reduced expr ......" | 25994220 |
hsa-miR-21-3p | colorectal cancer | CDH1 | "High stromal expression of miR-21 was found in 76 ......" | 25609245 |
hsa-miR-21-3p | breast cancer | CEACAM5 | "This study aimed to explore the diagnostic value o ......" | 24385703 |
hsa-miR-21-3p | lung cancer | CEACAM5 | "We assessed the differences in levels of miR-21 mi ......" | 24190459 |
hsa-miR-21-3p | lymphoma | CHRDL1 | "Additionally functional silencing of MIR21 and MIR ......" | 23725219 |
hsa-miR-21-3p | lymphoma | CHRDL1 | "Using quantitative real-time PCR qRT-PCR we tested ......" | 24222179 |
hsa-miR-21-3p | lung cancer | DECR1 | "Inhibition of NADPH oxidase protects against metas ......" | 25563770 |
hsa-miR-21-3p | prostate cancer | DECR1 | "Essential role of NADPH oxidase dependent reactive ......" | 23682737 |
hsa-miR-21-3p | breast cancer | EPCAM | "In this study we investigate whether combination o ......" | 25669446 |
hsa-miR-21-3p | pancreatic cancer | EPCAM | "In the current study we showed for the first time ......" | 21408027 |
hsa-miR-21-3p | breast cancer | FMOD | "Our method exhibits ultrahigh sensitivity toward m ......" | 23445447 |
hsa-miR-21-3p | sarcoma | FMOD | "Gain-of miR-21 function in MSMC and LSMC reduced T ......" | 19906824 |
hsa-miR-21-3p | colorectal cancer | MAP2K6 | "Rather induction of mature miR-21 by constitutive ......" | 22553926 |
hsa-miR-21-3p | liver cancer | MAP2K6 | "MicroRNA 21 promotes hepatocellular carcinoma HepG ......" | 24112539 |
hsa-miR-21-3p | pancreatic cancer | MIA | "Besides down-regulation of miR-21 expression can i ......" | 23359184 |
hsa-miR-21-3p | pancreatic cancer | MIA | "Bcl 2 upregulation induced by miR 21 via a direct ......" | 21376256 |
hsa-miR-21-3p | colorectal cancer | MMP2 | "Reversion-inducing cysteine-rich protein with kaza ......" | 23788041 |
hsa-miR-21-3p | pancreatic cancer | MMP2 | "Moreover miR-21 positively correlated with the mRN ......" | 19435867 |
hsa-miR-21-3p | lung cancer | MMP9 | "Expressions of microRNA-21 miR-21 PTEN MMP9 and p4 ......" | 25563770 |
hsa-miR-21-3p | melanoma | MMP9 | "To estimate changes in the trend of growth of prim ......" | 25868368 |
hsa-miR-21-3p | breast cancer | NR4A1 | "Levels of miR-21 expression by disease stage tumor ......" | 18932017 |
hsa-miR-21-3p | breast cancer | NR4A1 | "Overexpression of miR-21 was frequently found in h ......" | 21326627 |
hsa-miR-21-3p | melanoma | NRAS | "The presence of a BRAF or NRAS mutation had no sig ......" | 26731559 |
hsa-miR-21-3p | melanoma | NRAS | "Notably common BRAF and NRAS mutations in cutaneou ......" | 26116372 |
hsa-miR-21-3p | breast cancer | PGR | "Higher miR 21 expression in invasive breast carcin ......" | 24781337 |
hsa-miR-21-3p | breast cancer | PGR | "Odds ratios ORs showed that miR-21 expression was ......" | 25337203 |
hsa-miR-21-3p | gastric cancer | RAB8A | "Mel 18 negatively regulates stem cell like propert ......" | 27542229 |
hsa-miR-21-3p | melanoma | RAB8A | "miR-21 over-expression in the melanoma cell lines ......" | 25587717 |
hsa-miR-21-3p | cervical and endocervical cancer | RASA1 | "Circulating MicroRNA 21 Is Involved in Lymph Node ......" | 27101583 |
hsa-miR-21-3p | colon cancer | RASA1 | "RKO cells were transfected with vectors overexpres ......" | 25663768 |
hsa-miR-21-3p | colorectal cancer | RHOB | "miR 21 targets the tumor suppressor RhoB and regul ......" | 21872591 |
hsa-miR-21-3p | glioblastoma | RHOB | "Here we demonstrate that intravenously-administere ......" | 25861727 |
hsa-miR-21-3p | gastric cancer | TIMM8A | "The aim of this study was to investigate whether m ......" | 23466500 |
hsa-miR-21-3p | lung squamous cell cancer | TIMM8A | "Recent studies have shown that plasma miR-21 is a ......" | 24906642 |
hsa-miR-21-3p | breast cancer | TP53INP2 | "Diagnostic capacity of miR-21 for breast cancer wa ......" | 25516467 |
hsa-miR-21-3p | colorectal cancer | TP53INP2 | "Using a random-effect model the pooled sensitivity ......" | 25292032 |
hsa-miR-21-3p | breast cancer | TPM1 | "These two miRNAs have previously been identified a ......" | 20952761 |
hsa-miR-21-3p | kidney renal cell cancer | TPM1 | "Furthermore miR-21 mimic or inhibitor significantl ......" | 23558936 |
hsa-miR-21-3p | colon cancer | VCL | "MV expression of miR-21 may be a stronger prognost ......" | 25569638 |
hsa-miR-21-3p | prostate cancer | VCL | "MicroRNA software predicted that miR21 targets VCL ......" | 27509989 |
hsa-miR-21-3p | liver cancer | VEGFA | "Finally the expression of the miRNA21 gene in the ......" | 25730004 |
hsa-miR-21-3p | pancreatic cancer | VEGFA | "Hypoxia induced aggressiveness of pancreatic cance ......" | 23272057 |
hsa-miR-21-3p | gastric cancer | VIP | "Literature database including PubMed Embase the Co ......" | 24023850 |
hsa-miR-21-3p | lung cancer | VIP | "PubMed EMBASE Web of Knowledge ISI the Cochrane Li ......" | 24865991 |
hsa-miR-21-3p | breast cancer | ZEB1 | "We also demonstrated that both deltaEF1 and TPA in ......" | 19308091 |
hsa-miR-21-3p | breast cancer | ZEB1 | "Strikingly treatment with a mirVana miR-21 inhibit ......" | 26098771 |
hsa-miR-21-3p | ovarian cancer | ABCB1 | "The expression levels of miR-21 and P-gp were upre ......" | 24137413 |
hsa-miR-21-3p | breast cancer | ABCG2 | "The levels of MDR1 BCRP MRP1 Bcl-2/Bax and miR-21 ......" | 26555418 |
hsa-miR-21-3p | lung squamous cell cancer | ADC | "The miR-21 relative levels were similar in SQCC an ......" | 21263248 |
hsa-miR-21-3p | melanoma | AIR | "The purpose of this review is to provide translati ......" | 26116372 |
hsa-miR-21-3p | colon cancer | AKT1 | "We present compelling evidence that TIAM1 a guanid ......" | 20826792 |
hsa-miR-21-3p | colorectal cancer | ALCAM | "Enhanced expression of CD44 CD166 and miR-21 with ......" | 27153478 |
hsa-miR-21-3p | breast cancer | ANKRD46 | "Knockdown of miR-21 significantly increased the ex ......" | 21219636 |
hsa-miR-21-3p | breast cancer | APAF1 | "Also increase in the transcript level of APAF-1 an ......" | 26877850 |
hsa-miR-21-3p | thyroid cancer | ATM | "MiR-21 is an oncomiR that is overexpressed in near ......" | 26289851 |
hsa-miR-21-3p | breast cancer | BAX | "The expression of Bax Bcl-2 and miR-21 in parental ......" | 26555418 |
hsa-miR-21-3p | B cell lymphoma | BCL2L11 | "Reporter-gene assay showed that miR-21 directly ta ......" | 25909227 |
hsa-miR-21-3p | ovarian cancer | BIRC3 | "Using Western blot analysis miR-21 knockdown enhan ......" | 24472409 |
hsa-miR-21-3p | breast cancer | BMP6 | "We initiated experiments to identify the relations ......" | 19308091 |
hsa-miR-21-3p | colorectal cancer | BRD2 | "The level of miR-21 in CRC tumour tissue was compa ......" | 22289545 |
hsa-miR-21-3p | gastric cancer | BTG2 | "miR 21 regulates N methyl N nitro N' nitrosoguanid ......" | 24821435 |
hsa-miR-21-3p | glioblastoma | C6 | "As a result antisense-ODN/R3V6 complex inhibited m ......" | 25572456 |
hsa-miR-21-3p | colorectal cancer | CAMKMT | "Additionally curcumin significantly inhibited miR- ......" | 20815812 |
hsa-miR-21-3p | cervical and endocervical cancer | CARD8 | "We measured the expression of mir-21 and mir-143 i ......" | 22194833 |
hsa-miR-21-3p | kidney renal cell cancer | CASC2 | "Downregulation of lncRNA CASC2 by microRNA 21 incr ......" | 27222255 |
hsa-miR-21-3p | lung cancer | CASP8 | "Importantly down-regulation of caspase-8 by miR-21 ......" | 26080425 |
hsa-miR-21-3p | breast cancer | CASP9 | "Also increase in the transcript level of APAF-1 an ......" | 26877850 |
hsa-miR-21-3p | gastric cancer | CAT | "Expression of miR-21 was negatively correlated wit ......" | 23888942 |
hsa-miR-21-3p | breast cancer | CCL27 | "MiR-21 levels do not vary among ILC IDC and ILC-ID ......" | 24781337 |
hsa-miR-21-3p | lung cancer | CDK1 | "The data demonstrated the following after miR-21 s ......" | 25323306 |
hsa-miR-21-3p | head and neck cancer | CDK5 | "We measured the expression of miR-21 CDK5 and EMT ......" | 26690371 |
hsa-miR-21-3p | prostate cancer | CDKN1C | "MicroRNA 21 inhibits p57Kip2 expression in prostat ......" | 25216674 |
hsa-miR-21-3p | breast cancer | CGA | "Enhanced miR-21 expression was associated with ser ......" | 26549725 |
hsa-miR-21-3p | head and neck cancer | CLU | "Clusterin is a gene specific target of microRNA 21 ......" | 24327270 |
hsa-miR-21-3p | esophageal cancer | CRP | "The expression levels of exosomal miR-21 were sign ......" | 23224754 |
hsa-miR-21-3p | kidney renal cell cancer | CRS | "A factor derived from the z-score resulting from t ......" | 24428907 |
hsa-miR-21-3p | breast cancer | CSF1 | "miR 21 is targeted by omega 3 polyunsaturated fatt ......" | 22678116 |
hsa-miR-21-3p | prostate cancer | CX3CL1 | "MicroRNA software predicted that miR21 targets VCL ......" | 27509989 |
hsa-miR-21-3p | head and neck cancer | CYCS | "In addition flow cytometry analysis of JHU-012 cel ......" | 18798260 |
hsa-miR-21-3p | breast cancer | DCN | "The anti metastatic activity of collagenase 2 in b ......" | 23851508 |
hsa-miR-21-3p | liver cancer | DCT | "At a cut-off dCT of 1.96 miR-21 discriminated betw ......" | 22066022 |
hsa-miR-21-3p | lung cancer | DDAH1 | "In vitro study showed QTsome/AM-21 induced upregul ......" | 26741162 |
hsa-miR-21-3p | B cell lymphoma | DDIT3 | "MicroRNA 21 regulates the sensitivity of diffuse l ......" | 23275230 |
hsa-miR-21-3p | breast cancer | DDT | "While the EDCs and estrogen similarly altered the ......" | 22403704 |
hsa-miR-21-3p | breast cancer | DDX5 | "We demonstrated that DDX5 regulated a subset of Mi ......" | 22086602 |
hsa-miR-21-3p | colorectal cancer | DICER1 | "Rather induction of mature miR-21 by constitutive ......" | 22553926 |
hsa-miR-21-3p | breast cancer | DNMT3A | "In contrast the miR-21 expression in MDA-MB-231 ce ......" | 26387181 |
hsa-miR-21-3p | breast cancer | DNMT3B | "In contrast the miR-21 expression in MDA-MB-231 ce ......" | 26387181 |
hsa-miR-21-3p | breast cancer | DST | "While the EDCs and estrogen similarly altered the ......" | 22403704 |
hsa-miR-21-3p | lung cancer | E2F1 | "Further mechanistic analysis revealed that miR-21 ......" | 25323306 |
hsa-miR-21-3p | lung squamous cell cancer | ENO2 | "Average serums miR21 CEA NSE and CYFRA21-1 levels ......" | 26880855 |
hsa-miR-21-3p | breast cancer | ESR2 | "ER alpha and ER beta agonists PPT and DPN inhibite ......" | 19264808 |
hsa-miR-21-3p | colorectal cancer | ETS1 | "We demonstrate in a cell-specific manner the occup ......" | 24149370 |
hsa-miR-21-3p | colorectal cancer | ETV4 | "The Ets factor Pea3 emerges from our studies as a ......" | 22553926 |
hsa-miR-21-3p | gastric cancer | F2 | "High levels of miR-21 in the serum were associated ......" | 24260069 |
hsa-miR-21-3p | breast cancer | FAS | "miR 21 targets Fas ligand mediated apoptosis in br ......" | 24710931 |
hsa-miR-21-3p | breast cancer | FLOT2 | "MicroRNA 21 Expression in Primary Breast Cancer Ti ......" | 26342497 |
hsa-miR-21-3p | colon cancer | FOS | "Also S100P treatment stimulates the enrichment of ......" | 26193421 |
hsa-miR-21-3p | B cell lymphoma | FOXO1 | "MicroRNA 21 plays an oncogenic role by targeting F ......" | 25909227 |
hsa-miR-21-3p | breast cancer | FOXO3 | "The regulation and function of miR 21 FOXO3a miR 3 ......" | 25647415 |
hsa-miR-21-3p | gastric cancer | FZD6 | "FZD6 targeted by miR 21 represses gastric cancer c ......" | 27347343 |
hsa-miR-21-3p | liver cancer | GAS5 | "Long noncoding RNA GAS5 suppresses the migration a ......" | 26404135 |
hsa-miR-21-3p | pancreatic cancer | GDF15 | "With multivariable logistic regression we establis ......" | 27713117 |
hsa-miR-21-3p | esophageal cancer | GIF | "In patients with more advanced T3 or T4 tumors miR ......" | 21475818 |
hsa-miR-21-3p | liver cancer | GNB2 | "Dehydroepiandrosterone Activation of G protein cou ......" | 25969534 |
hsa-miR-21-3p | liver cancer | GPER1 | "These results suggest that physiological concentra ......" | 25969534 |
hsa-miR-21-3p | glioblastoma | GSC | "In this study we aimed to explore whether miR-21 d ......" | 22528454 |
hsa-miR-21-3p | liver cancer | HBP1 | "MicroRNA 21 is a potential link between non alcoho ......" | 26282675 |
hsa-miR-21-3p | liver cancer | HEPN1 | "MicroRNA 21 promotes cell proliferation in human h ......" | 25687183 |
hsa-miR-21-3p | prostate cancer | HK3 | "miR-21 and miR-141 were quantified through real-ti ......" | 24288670 |
hsa-miR-21-3p | liver cancer | HMGB1 | "Damage-associated molecular patterns DAMP such as ......" | 25720799 |
hsa-miR-21-3p | glioblastoma | HNRNPK | "These phenotypes are dependent on two of the miR-2 ......" | 18829576 |
hsa-miR-21-3p | glioblastoma | HSPB3 | "MicroRNA 21 promotes glioblastoma tumorigenesis by ......" | 25059666 |
hsa-miR-21-3p | colon cancer | HT | "Targeting miR 21 enhances the sensitivity of human ......" | 24275137 |
hsa-miR-21-3p | colon cancer | IARS | "Both IRS and miR-21 expression were independently ......" | 19737943 |
hsa-miR-21-3p | pancreatic cancer | IDUA | "Along with higher expression of miR-21 which has b ......" | 22064652 |
hsa-miR-21-3p | melanoma | IFNA1 | "miR-21 is also up-regulated by a number of inflamm ......" | 21940630 |
hsa-miR-21-3p | glioblastoma | IGFBP3 | "MicroRNA 21 promotes glioblastoma tumorigenesis by ......" | 25059666 |
hsa-miR-21-3p | melanoma | IGKV3-7 | "Upregulation of miR-21 and miR-146a was also detec ......" | 25951497 |
hsa-miR-21-3p | lymphoma | IL4 | "Moreover miR-21 is overexpressed in activated B ce ......" | 22487708 |
hsa-miR-21-3p | breast cancer | KDR | "In vivo monitoring of angiogenesis inhibition via ......" | 23951172 |
hsa-miR-21-3p | prostate cancer | KLK11 | "The aim of our study was to monitor serum levels o ......" | 24288670 |
hsa-miR-21-3p | colon cancer | KRT20 | "Indeed we observed that downregulation of miR-21 i ......" | 23544170 |
hsa-miR-21-3p | cervical and endocervical cancer | LATS1 | "miR 21 modulates resistance of HR HPV positive cer ......" | 25769949 |
hsa-miR-21-3p | breast cancer | LMNA | "MiR-21 levels do not vary among ILC IDC and ILC-ID ......" | 24781337 |
hsa-miR-21-3p | breast cancer | LPA | "DNA microarray and real-time PCR analyses further ......" | 26098771 |
hsa-miR-21-3p | breast cancer | LPAR1 | "Strikingly treatment with a mirVana miR-21 inhibit ......" | 26098771 |
hsa-miR-21-3p | glioblastoma | LRRFIP1 | "MicroRNA 21 targets LRRFIP1 and contributes to VM ......" | 19559015 |
hsa-miR-21-3p | ovarian cancer | LSS | "In situ hybridization detected miR-21 only in OSC ......" | 24888238 |
hsa-miR-21-3p | liver cancer | MAP2K3 | "The 3'-untranslated region 3'-UTR of MAP2K3 combin ......" | 24112539 |
hsa-miR-21-3p | ovarian cancer | MAPK8 | "Upregulation of miR 21 in cisplatin resistant ovar ......" | 24865582 |
hsa-miR-21-3p | prostate cancer | MARCKS | "MicroRNA 21 directly targets MARCKS and promotes a ......" | 19302977 |
hsa-miR-21-3p | cervical and endocervical cancer | MEG3 | "Long noncoding RNA MEG3 is downregulated in cervic ......" | 26574780 |
hsa-miR-21-3p | melanoma | MMP13 | "To estimate changes in the trend of growth of prim ......" | 25868368 |
hsa-miR-21-3p | breast cancer | MMP8 | "We show herein that Mmp8 expression causes a decre ......" | 23851508 |
hsa-miR-21-3p | colorectal cancer | MORF4 | "Using a random-effect model the pooled sensitivity ......" | 25292032 |
hsa-miR-21-3p | lung cancer | MUC16 | "We assessed the differences in levels of miR-21 mi ......" | 24190459 |
hsa-miR-21-3p | colon cancer | MYC | "In contrast the levels of β-catenin TCF/LEF activ ......" | 22072622 |
hsa-miR-21-3p | head and neck cancer | NANOG | "Stem cell marker Nanog and Stat 3 signaling promot ......" | 21685938 |
hsa-miR-21-3p | ovarian cancer | NAV3 | "We identify NAV3 as a potential target of miR-21-3 ......" | 25579119 |
hsa-miR-21-3p | glioblastoma | NFKB1 | "We further identified and validated LRRFIP1 whose ......" | 19559015 |
hsa-miR-21-3p | glioblastoma | NHLRC1 | "MicroRNAs except microRNA-21 showed significantly ......" | 23420397 |
hsa-miR-21-3p | breast cancer | NHS | "For the detection of mir21 capture probes and/or c ......" | 22776181 |
hsa-miR-21-3p | esophageal cancer | NKS1 | "Cell growth cell apoptosis and cell invasion abili ......" | 23504349 |
hsa-miR-21-3p | colorectal cancer | NOTCH1 | "Correlation of over expressions of miR 21 and Notc ......" | 24780321 |
hsa-miR-21-3p | acute myeloid leukemia | NPM1 | "miR 21 is overexpressed in NPM1 mutant acute myelo ......" | 25543261 |
hsa-miR-21-3p | breast cancer | NPS | "We synthesized the antisense-miR-21 and antisense- ......" | 25652012 |
hsa-miR-21-3p | colorectal cancer | NR4A3 | "In addition we located miR-21 expression at the ce ......" | 23817679 |
hsa-miR-21-3p | breast cancer | NRGN | "Of the 40 samples from tissue and serum analyzed t ......" | 23936642 |
hsa-miR-21-3p | colon cancer | NTS | "Neurotensin stimulated differential expression of ......" | 21806946 |
hsa-miR-21-3p | cervical and endocervical cancer | NUP214 | "HPV16 E7 protein can up-regulate host miR-21 expre ......" | 26884851 |
hsa-miR-21-3p | liver cancer | OA5 | "miR 21 promotes migration and invasion by the miR ......" | 22322403 |
hsa-miR-21-3p | gastric cancer | OGG1 | "We found that human 8-oxoguanine DNA N-glycosylase ......" | 23888942 |
hsa-miR-21-3p | breast cancer | OMA1 | "Evaluation of TIMP3 protein levels a peptidase inv ......" | 20346171 |
hsa-miR-21-3p | lung squamous cell cancer | P2RX7 | "Samples with low P2X7 expression were found to exh ......" | 25436007 |
hsa-miR-21-3p | gastric cancer | PCGF2 | "Mel 18 negatively regulates stem cell like propert ......" | 27542229 |
hsa-miR-21-3p | pancreatic cancer | PCS | "Expression levels of miR-143 and miR-21 and correl ......" | 22836856 |
hsa-miR-21-3p | lung squamous cell cancer | PCSK9 | "Lentiviral vectors were used to infect PC9 or PC9R ......" | 24331411 |
hsa-miR-21-3p | breast cancer | PDCD10 | "Through dual-luciferase method it was verified tha ......" | 25566594 |
hsa-miR-21-3p | colon cancer | PDLIM5 | "Consistent with this overexpression of either miR- ......" | 20826792 |
hsa-miR-21-3p | lung cancer | PGRMC1 | "The data demonstrated the following after miR-21 s ......" | 25323306 |
hsa-miR-21-3p | breast cancer | PIK3R1 | "PIK3R1 targeting by miR 21 suppresses tumor cell m ......" | 26676464 |
hsa-miR-21-3p | breast cancer | PLAT | "We also demonstrated that both deltaEF1 and TPA in ......" | 19308091 |
hsa-miR-21-3p | lung cancer | PPARA | "In the final integrative analysis of lung cancer r ......" | 22244963 |
hsa-miR-21-3p | esophageal cancer | PPP2R2A | "In ZD esophagus and tongue oncogenic miR-31 and mi ......" | 22689922 |
hsa-miR-21-3p | kidney renal cell cancer | PRCC | "In this study we analyzed miR-21 in 121 cases of h ......" | 22580180 |
hsa-miR-21-3p | breast cancer | PRL | "Enhanced miR-21 expression was associated with ser ......" | 26549725 |
hsa-miR-21-3p | bladder cancer | PTCRA | "miR-21 over expression greater than 1.08 was relat ......" | 22999546 |
hsa-miR-21-3p | gastric cancer | PTGER4 | "EP2 or EP4 siRNA or antagonists impaired the nicot ......" | 21081469 |
hsa-miR-21-3p | breast cancer | PTGS1 | "Correlations between the dysregulation of miR-21 m ......" | 27420617 |
hsa-miR-21-3p | esophageal cancer | RAN | "MiR 203 suppresses tumor growth and invasion and d ......" | 24001611 |
hsa-miR-21-3p | chronic myeloid leukemia | RBP2 | "We identified miR-21 was directly downregulated by ......" | 25575817 |
hsa-miR-21-3p | lung cancer | RIPK1 | "Importantly down-regulation of caspase-8 by miR-21 ......" | 26080425 |
hsa-miR-21-3p | breast cancer | RPS6KA5 | "DNA damage-induced histone H3 phosphorylation via ......" | 22547075 |
hsa-miR-21-3p | esophageal cancer | S100A4 | "In addition co-culturing cancer cells with fibrobl ......" | 24039846 |
hsa-miR-21-3p | colon cancer | S100P | "We show that exogenous S100P up-regulates miR-21 l ......" | 26193421 |
hsa-miR-21-3p | kidney renal cell cancer | SATB1 | "SATB1 is Down regulated in Clear Cell Renal Cell C ......" | 27107063 |
hsa-miR-21-3p | colorectal cancer | SEC23A | "MicroRNA 21 promotes proliferation migration and i ......" | 27495250 |
hsa-miR-21-3p | gastric cancer | SERPINI1 | "MicroRNA 21 inhibits Serpini1 a gene with novel tu ......" | 22464652 |
hsa-miR-21-3p | glioblastoma | SFN | "Our results revealed that β-catenin and miR-21 we ......" | 25991372 |
hsa-miR-21-3p | prostate cancer | SI | "Short interfering si RNA against PDCD4 attenuated ......" | 23272133 |
hsa-miR-21-3p | liver cancer | SLC33A1 | "We report that 10 nm DHEA increases primary miR-21 ......" | 25969534 |
hsa-miR-21-3p | glioblastoma | SMAD2 | "Further we demonstrate that MPS1 mediates phosphor ......" | 25991676 |
hsa-miR-21-3p | glioblastoma | SMAD3 | "Further we demonstrate that MPS1 mediates phosphor ......" | 25991676 |
hsa-miR-21-3p | esophageal cancer | SMPD2 | "The exosome-derived Cy3-labeled miR-21 mimics coul ......" | 27035745 |
hsa-miR-21-3p | esophageal cancer | SMPD3 | "The exosome-derived Cy3-labeled miR-21 mimics coul ......" | 27035745 |
hsa-miR-21-3p | colorectal cancer | SNORD44 | "MiR-101 was hardly expressed in the tumor samples ......" | 23121918 |
hsa-miR-21-3p | head and neck cancer | SOAT1 | "Stem cell marker Nanog and Stat 3 signaling promot ......" | 21685938 |
hsa-miR-21-3p | colon cancer | SOCS1 | "NTR1 activation stimulates expression of miR-21 an ......" | 21806946 |
hsa-miR-21-3p | liver cancer | SOCS6 | "MiR 21 and miR 183 can simultaneously target SOCS6 ......" | 26400524 |
hsa-miR-21-3p | gastric cancer | SOD1 | "Expression of miR-21 was negatively correlated wit ......" | 23888942 |
hsa-miR-21-3p | glioblastoma | SOX2 | "Mir 21 Sox2 Axis Delineates Glioblastoma Subtypes ......" | 26558781 |
hsa-miR-21-3p | colorectal cancer | SOX9 | "The absence of miR-21 resulted in the reduced expr ......" | 25994220 |
hsa-miR-21-3p | glioblastoma | SPRY1 | "Functional studies showed that miR-21 over-express ......" | 24155920 |
hsa-miR-21-3p | colon cancer | SPRY2 | "Inhibition of microRNA-21 mir‑21 induced upregul ......" | 22322462 |
hsa-miR-21-3p | liver cancer | SSRP1 | "Damage-associated molecular patterns DAMP such as ......" | 25720799 |
hsa-miR-21-3p | liver cancer | SULF1 | "MicroRNA 21 suppresses PTEN and hSulf 1 expression ......" | 23684551 |
hsa-miR-21-3p | breast cancer | TAM | "We hypothesized that miR-21 might alter the sensit ......" | 26796263 |
hsa-miR-21-3p | liver cancer | TEK | "miR-21 correlated negatively with Tie-2 receptor i ......" | 24759835 |
hsa-miR-21-3p | thyroid cancer | TGFB1 | "Inhibition of TGFbeta receptor 1 TGFBR1 in these c ......" | 20498632 |
hsa-miR-21-3p | thyroid cancer | TGFBR1 | "Inhibition of TGFbeta receptor 1 TGFBR1 in these c ......" | 20498632 |
hsa-miR-21-3p | prostate cancer | TGFBR2 | "Androgen receptor and microRNA 21 axis downregulat ......" | 24037531 |
hsa-miR-21-3p | thyroid cancer | THRB | "Direct interaction with THRB was shown for miR-21 ......" | 21159845 |
hsa-miR-21-3p | colon cancer | TIAM1 | "miR 21 and miR 31 converge on TIAM1 to regulate mi ......" | 20826792 |
hsa-miR-21-3p | breast cancer | TIMP1 | "Genetic heterogeneity of breast cancer metastasis ......" | 23936642 |
hsa-miR-21-3p | lung cancer | TLR4 | "For in vivo relevance expression of TLR4 was corre ......" | 27286259 |
hsa-miR-21-3p | colorectal cancer | TP53INP1 | "miR-21 and miR-155 expression was assessed in tumo ......" | 21412018 |
hsa-miR-21-3p | retinoblastoma | TUBA1B | "MiR-21 acts as a ubiquitous oncogene in major clas ......" | 24607444 |
hsa-miR-21-3p | lung cancer | TWIST1 | "Further mechanistic analysis revealed that miR-21 ......" | 25323306 |
hsa-miR-21-3p | glioblastoma | TXK | "Finally we demonstrate for the first time that miR ......" | 23201752 |
hsa-miR-21-3p | bladder cancer | VEGFC | "The present study aimed to explore the expression ......" | 26622898 |
hsa-miR-21-3p | glioblastoma | VHL | "Herein we have demonstrated that miR-21 directly t ......" | 24012640 |
hsa-miR-21-3p | lymphoma | VMP1 | "miR-21 has been mapped at chromosome 17q23.2 where ......" | 24961346 |
hsa-miR-21-3p | ovarian cancer | WFDC2 | "Therefore HE4 and miR-21 may play an important rol ......" | 26733162 |
hsa-miR-21-3p | lung cancer | WNT1 | "Correlation among key molecules Wnt1 β-catenin Cy ......" | 26194834 |
hsa-miR-21-3p | liver cancer | XIAP | "Inhibition of miR-21 effectively attenuated anchor ......" | 25087183 |
hsa-miR-21-3p | liver cancer | ZBTB7A | "microRNA 21 mediated suppression of Sprouty1 by Po ......" | 23355454 |
hsa-miR-21-3p | prostate cancer | ZNF135 | "From men who presented the second profile miR-21 o ......" | 22642976 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-21-3p | REEP1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.571; TCGA BRCA -0.21; TCGA CESC -0.362; TCGA COAD -1.136; TCGA ESCA -0.665; TCGA HNSC -0.301; TCGA KIRC -0.152; TCGA KIRP -0.264; TCGA LGG -0.187; TCGA LUAD -0.562; TCGA LUSC -0.415; TCGA OV -0.252; TCGA PAAD -0.295; TCGA PRAD -0.211; TCGA SARC -0.781; TCGA THCA -0.271; TCGA STAD -1.013; TCGA UCEC -0.586 |
hsa-miR-21-3p | ZNF518A | 9 cancers: BLCA; CESC; KIRC; LIHC; LUSC; OV; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.17; TCGA CESC -0.159; TCGA KIRC -0.087; TCGA LIHC -0.088; TCGA LUSC -0.094; TCGA OV -0.13; TCGA SARC -0.223; TCGA THCA -0.182; TCGA UCEC -0.083 |
hsa-miR-21-3p | CGGBP1 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.052; TCGA CESC -0.058; TCGA COAD -0.068; TCGA HNSC -0.072; TCGA KIRC -0.153; TCGA KIRP -0.056; TCGA LIHC -0.077; TCGA LUSC -0.134; TCGA STAD -0.084; TCGA UCEC -0.102 |
hsa-miR-21-3p | B4GALT6 | 11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.121; TCGA BRCA -0.194; TCGA HNSC -0.346; TCGA KIRC -0.335; TCGA KIRP -0.186; TCGA LGG -0.107; TCGA LIHC -0.105; TCGA PAAD -0.217; TCGA PRAD -0.211; TCGA STAD -0.129; TCGA UCEC -0.269 |
hsa-miR-21-3p | ZYG11B | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.128; TCGA BRCA -0.07; TCGA CESC -0.126; TCGA ESCA -0.072; TCGA HNSC -0.172; TCGA KIRC -0.167; TCGA KIRP -0.122; TCGA LIHC -0.162; TCGA LUAD -0.072; TCGA LUSC -0.089; TCGA OV -0.061; TCGA STAD -0.216; TCGA UCEC -0.12 |
hsa-miR-21-3p | DYRK1A | 12 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.102; TCGA CESC -0.066; TCGA HNSC -0.057; TCGA KIRC -0.058; TCGA KIRP -0.088; TCGA LIHC -0.073; TCGA LUAD -0.063; TCGA LUSC -0.058; TCGA SARC -0.137; TCGA THCA -0.053; TCGA STAD -0.072; TCGA UCEC -0.064 |
hsa-miR-21-3p | NCAM1 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.691; TCGA BRCA -0.402; TCGA CESC -0.773; TCGA COAD -0.919; TCGA ESCA -1.19; TCGA HNSC -0.44; TCGA KIRP -0.44; TCGA LGG -0.146; TCGA LUAD -0.43; TCGA LUSC -0.594; TCGA OV -0.294; TCGA PAAD -0.726; TCGA PRAD -0.452; TCGA SARC -0.643; TCGA THCA -0.388; TCGA STAD -0.975; TCGA UCEC -0.512 |
hsa-miR-21-3p | RRAGB | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.218; TCGA BRCA -0.101; TCGA CESC -0.13; TCGA COAD -0.303; TCGA ESCA -0.199; TCGA HNSC -0.128; TCGA KIRC -0.188; TCGA KIRP -0.109; TCGA LGG -0.13; TCGA LIHC -0.128; TCGA LUAD -0.126; TCGA LUSC -0.103; TCGA OV -0.14; TCGA PAAD -0.13; TCGA PRAD -0.087; TCGA SARC -0.199; TCGA STAD -0.223; TCGA UCEC -0.224 |
hsa-miR-21-3p | ACAD11 | 11 cancers: BLCA; BRCA; CESC; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.117; TCGA BRCA -0.242; TCGA CESC -0.139; TCGA KIRP -0.151; TCGA LIHC -0.242; TCGA LUAD -0.069; TCGA LUSC -0.238; TCGA OV -0.057; TCGA SARC -0.188; TCGA THCA -0.125; TCGA UCEC -0.095 |
hsa-miR-21-3p | DISC1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.12; TCGA BRCA -0.066; TCGA CESC -0.377; TCGA COAD -0.167; TCGA ESCA -0.197; TCGA HNSC -0.309; TCGA LUSC -0.286; TCGA OV -0.077; TCGA STAD -0.078; TCGA UCEC -0.133 |
hsa-miR-21-3p | AKAP11 | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.128; TCGA BRCA -0.137; TCGA CESC -0.147; TCGA COAD -0.144; TCGA HNSC -0.07; TCGA KIRC -0.134; TCGA KIRP -0.121; TCGA LGG -0.117; TCGA LIHC -0.068; TCGA LUAD -0.097; TCGA LUSC -0.186; TCGA PAAD -0.093; TCGA SARC -0.079; TCGA STAD -0.14; TCGA UCEC -0.144 |
hsa-miR-21-3p | ZFHX3 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.337; TCGA CESC -0.156; TCGA COAD -0.374; TCGA HNSC -0.122; TCGA KIRC -0.074; TCGA KIRP -0.064; TCGA LUAD -0.083; TCGA OV -0.114; TCGA SARC -0.181; TCGA THCA -0.054; TCGA STAD -0.213; TCGA UCEC -0.08 |
hsa-miR-21-3p | ARHGEF7 | 9 cancers: BLCA; BRCA; CESC; LGG; LIHC; LUAD; LUSC; OV; THCA | MirTarget | TCGA BLCA -0.093; TCGA BRCA -0.124; TCGA CESC -0.083; TCGA LGG -0.083; TCGA LIHC -0.055; TCGA LUAD -0.055; TCGA LUSC -0.086; TCGA OV -0.06; TCGA THCA -0.075 |
hsa-miR-21-3p | COBL | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD | MirTarget | TCGA BLCA -0.404; TCGA BRCA -0.155; TCGA ESCA -0.499; TCGA HNSC -0.701; TCGA KIRC -0.472; TCGA LIHC -0.143; TCGA LUAD -0.225; TCGA LUSC -0.354; TCGA PAAD -0.153; TCGA STAD -0.177 |
hsa-miR-21-3p | KIAA0430 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.183; TCGA BRCA -0.15; TCGA CESC -0.13; TCGA COAD -0.179; TCGA ESCA -0.141; TCGA HNSC -0.135; TCGA KIRC -0.061; TCGA KIRP -0.084; TCGA LGG -0.098; TCGA LUAD -0.051; TCGA LUSC -0.156; TCGA OV -0.061; TCGA SARC -0.154; TCGA THCA -0.052; TCGA STAD -0.176; TCGA UCEC -0.161 |
hsa-miR-21-3p | MUM1L1 | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LGG; OV; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.229; TCGA CESC -0.421; TCGA COAD -0.937; TCGA HNSC -0.719; TCGA KIRC -0.256; TCGA LGG -0.347; TCGA OV -0.381; TCGA THCA -0.419; TCGA STAD -0.602; TCGA UCEC -0.442 |
hsa-miR-21-3p | SMAD7 | 10 cancers: BLCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; UCEC | MirTarget | TCGA BLCA -0.111; TCGA COAD -0.154; TCGA KIRC -0.111; TCGA KIRP -0.181; TCGA LGG -0.114; TCGA LIHC -0.101; TCGA LUAD -0.116; TCGA LUSC -0.245; TCGA THCA -0.055; TCGA UCEC -0.095 |
hsa-miR-21-3p | PPM1A | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.054; TCGA BRCA -0.094; TCGA CESC -0.056; TCGA HNSC -0.071; TCGA KIRC -0.25; TCGA KIRP -0.12; TCGA LGG -0.071; TCGA LIHC -0.148; TCGA LUAD -0.069; TCGA PAAD -0.122; TCGA SARC -0.107; TCGA STAD -0.2; TCGA UCEC -0.127 |
hsa-miR-21-3p | ATRNL1 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.399; TCGA BRCA -0.174; TCGA CESC -0.937; TCGA COAD -1.423; TCGA ESCA -0.616; TCGA HNSC -0.669; TCGA KIRC -0.705; TCGA KIRP -0.33; TCGA LGG -0.224; TCGA LUAD -0.507; TCGA OV -0.41; TCGA PAAD -0.762; TCGA PRAD -0.396; TCGA THCA -0.392; TCGA STAD -0.731; TCGA UCEC -0.449 |
hsa-miR-21-3p | SRCIN1 | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; OV; PAAD; SARC; UCEC | MirTarget | TCGA BLCA -0.436; TCGA CESC -0.242; TCGA COAD -0.243; TCGA HNSC -0.168; TCGA LGG -0.219; TCGA OV -0.198; TCGA PAAD -0.609; TCGA SARC -0.919; TCGA UCEC -0.172 |
hsa-miR-21-3p | TMEM47 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.423; TCGA BRCA -0.366; TCGA CESC -0.324; TCGA COAD -0.722; TCGA ESCA -0.563; TCGA HNSC -0.534; TCGA KIRC -0.092; TCGA LGG -0.122; TCGA LUAD -0.377; TCGA LUSC -0.434; TCGA PRAD -0.201; TCGA SARC -0.491; TCGA THCA -0.325; TCGA STAD -0.573; TCGA UCEC -0.343 |
hsa-miR-21-3p | TEF | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.127; TCGA BRCA -0.378; TCGA CESC -0.186; TCGA COAD -0.237; TCGA ESCA -0.306; TCGA HNSC -0.178; TCGA KIRC -0.404; TCGA KIRP -0.285; TCGA LGG -0.28; TCGA LIHC -0.291; TCGA LUAD -0.275; TCGA PAAD -0.231; TCGA PRAD -0.079; TCGA SARC -0.248; TCGA THCA -0.132; TCGA STAD -0.403; TCGA UCEC -0.272 |
hsa-miR-21-3p | DCUN1D4 | 10 cancers: BLCA; ESCA; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.113; TCGA ESCA -0.145; TCGA KIRP -0.052; TCGA LIHC -0.125; TCGA PAAD -0.056; TCGA PRAD -0.066; TCGA SARC -0.166; TCGA THCA -0.139; TCGA STAD -0.191; TCGA UCEC -0.128 |
hsa-miR-21-3p | MDM4 | 10 cancers: BLCA; CESC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.181; TCGA CESC -0.173; TCGA LIHC -0.095; TCGA LUAD -0.079; TCGA LUSC -0.142; TCGA OV -0.087; TCGA SARC -0.206; TCGA THCA -0.061; TCGA STAD -0.121; TCGA UCEC -0.069 |
hsa-miR-21-3p | PHF2 | 15 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.079; TCGA BRCA -0.112; TCGA CESC -0.152; TCGA COAD -0.164; TCGA KIRC -0.094; TCGA KIRP -0.09; TCGA LGG -0.054; TCGA LIHC -0.124; TCGA LUAD -0.12; TCGA LUSC -0.104; TCGA PAAD -0.161; TCGA SARC -0.155; TCGA THCA -0.065; TCGA STAD -0.158; TCGA UCEC -0.17 |
hsa-miR-21-3p | SHPRH | 12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.136; TCGA BRCA -0.183; TCGA CESC -0.279; TCGA KIRC -0.265; TCGA KIRP -0.224; TCGA LGG -0.073; TCGA LUAD -0.086; TCGA OV -0.146; TCGA SARC -0.267; TCGA THCA -0.117; TCGA STAD -0.116; TCGA UCEC -0.154 |
hsa-miR-21-3p | SORCS1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.829; TCGA BRCA -0.52; TCGA CESC -0.733; TCGA COAD -1.527; TCGA ESCA -1.314; TCGA HNSC -0.87; TCGA KIRC -0.806; TCGA KIRP -0.49; TCGA LUAD -0.549; TCGA LUSC -0.643; TCGA OV -0.329; TCGA PAAD -0.307; TCGA PRAD -0.239; TCGA STAD -1.247; TCGA UCEC -0.509 |
hsa-miR-21-3p | DYNC1I1 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.46; TCGA BRCA -0.232; TCGA CESC -0.653; TCGA COAD -1.159; TCGA HNSC -0.631; TCGA KIRP -0.585; TCGA LGG -0.274; TCGA LIHC -0.335; TCGA PAAD -0.591; TCGA PRAD -0.231; TCGA SARC -0.337; TCGA THCA -0.301; TCGA STAD -0.776 |
hsa-miR-21-3p | UBE4B | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; OV; THCA; STAD | MirTarget | TCGA BLCA -0.068; TCGA BRCA -0.058; TCGA CESC -0.109; TCGA ESCA -0.105; TCGA HNSC -0.098; TCGA KIRC -0.102; TCGA LIHC -0.067; TCGA OV -0.106; TCGA THCA -0.053; TCGA STAD -0.143 |
hsa-miR-21-3p | PCMTD2 | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.164; TCGA BRCA -0.111; TCGA CESC -0.232; TCGA COAD -0.137; TCGA HNSC -0.135; TCGA KIRC -0.163; TCGA KIRP -0.085; TCGA LIHC -0.174; TCGA LUAD -0.058; TCGA LUSC -0.187; TCGA OV -0.144; TCGA PAAD -0.187; TCGA SARC -0.166; TCGA THCA -0.082; TCGA UCEC -0.157 |
hsa-miR-21-3p | CNRIP1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.298; TCGA BRCA -0.294; TCGA CESC -0.379; TCGA COAD -0.435; TCGA ESCA -0.424; TCGA HNSC -0.323; TCGA KIRP -0.201; TCGA LGG -0.239; TCGA LUAD -0.304; TCGA LUSC -0.287; TCGA PRAD -0.231; TCGA STAD -0.406; TCGA UCEC -0.449 |
hsa-miR-21-3p | EPM2AIP1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.228; TCGA BRCA -0.105; TCGA CESC -0.13; TCGA COAD -0.388; TCGA ESCA -0.141; TCGA HNSC -0.162; TCGA KIRC -0.252; TCGA KIRP -0.086; TCGA LGG -0.073; TCGA LIHC -0.152; TCGA LUAD -0.113; TCGA LUSC -0.13; TCGA OV -0.139; TCGA PAAD -0.162; TCGA SARC -0.268; TCGA THCA -0.165; TCGA STAD -0.28; TCGA UCEC -0.234 |
hsa-miR-21-3p | RCBTB1 | 13 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.073; TCGA CESC -0.162; TCGA COAD -0.14; TCGA KIRC -0.217; TCGA KIRP -0.185; TCGA LGG -0.094; TCGA LIHC -0.182; TCGA LUAD -0.057; TCGA LUSC -0.109; TCGA OV -0.065; TCGA PAAD -0.185; TCGA THCA -0.169; TCGA UCEC -0.139 |
hsa-miR-21-3p | PHYHIPL | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.424; TCGA BRCA -0.389; TCGA CESC -0.298; TCGA COAD -0.965; TCGA ESCA -0.59; TCGA HNSC -0.544; TCGA KIRC -0.483; TCGA LGG -0.324; TCGA LIHC -0.245; TCGA LUAD -0.316; TCGA PAAD -0.453; TCGA PRAD -0.522; TCGA SARC -0.735; TCGA STAD -0.636 |
hsa-miR-21-3p | PCDHAC2 | 10 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.295; TCGA CESC -0.645; TCGA COAD -0.513; TCGA HNSC -0.622; TCGA LGG -0.084; TCGA LUAD -0.319; TCGA LUSC -0.491; TCGA PAAD -0.317; TCGA SARC -0.432; TCGA STAD -0.457 |
hsa-miR-21-3p | MAGEL2 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.306; TCGA CESC -0.704; TCGA COAD -0.602; TCGA ESCA -0.317; TCGA HNSC -0.479; TCGA KIRP -0.25; TCGA LGG -0.27; TCGA THCA -0.345; TCGA STAD -0.313; TCGA UCEC -0.402 |
hsa-miR-21-3p | CREBBP | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; OV; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.053; TCGA CESC -0.138; TCGA COAD -0.095; TCGA HNSC -0.064; TCGA LGG -0.064; TCGA LIHC -0.075; TCGA OV -0.083; TCGA SARC -0.162; TCGA STAD -0.07; TCGA UCEC -0.094 |
hsa-miR-21-3p | EPC2 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.127; TCGA BRCA -0.104; TCGA CESC -0.103; TCGA COAD -0.122; TCGA HNSC -0.076; TCGA KIRP -0.063; TCGA OV -0.093; TCGA PAAD -0.099; TCGA SARC -0.242; TCGA STAD -0.112; TCGA UCEC -0.097 |
hsa-miR-21-3p | MBNL3 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; OV | MirTarget | TCGA BLCA -0.255; TCGA BRCA -0.198; TCGA CESC -0.163; TCGA HNSC -0.197; TCGA KIRC -0.259; TCGA KIRP -0.186; TCGA LIHC -0.337; TCGA LUAD -0.187; TCGA OV -0.114 |
hsa-miR-21-3p | CAMK2A | 11 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.278; TCGA KIRC -0.742; TCGA KIRP -0.644; TCGA LGG -0.517; TCGA LIHC -0.429; TCGA LUAD -0.325; TCGA LUSC -0.333; TCGA PRAD -0.359; TCGA SARC -0.23; TCGA STAD -0.751; TCGA UCEC -0.618 |
hsa-miR-21-3p | YPEL5 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; STAD; UCEC | MirTarget | TCGA BLCA -0.08; TCGA BRCA -0.08; TCGA COAD -0.257; TCGA ESCA -0.131; TCGA KIRC -0.105; TCGA KIRP -0.14; TCGA LIHC -0.079; TCGA LUAD -0.113; TCGA STAD -0.276; TCGA UCEC -0.089 |
hsa-miR-21-3p | MON2 | 10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; PAAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.084; TCGA BRCA -0.1; TCGA CESC -0.061; TCGA KIRC -0.059; TCGA KIRP -0.104; TCGA LIHC -0.073; TCGA PAAD -0.102; TCGA SARC -0.097; TCGA THCA -0.064; TCGA UCEC -0.142 |
hsa-miR-21-3p | SEMA6A | 10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.486; TCGA BRCA -0.402; TCGA CESC -0.485; TCGA HNSC -0.4; TCGA LUAD -0.36; TCGA LUSC -0.466; TCGA OV -0.337; TCGA SARC -0.666; TCGA THCA -0.245; TCGA STAD -0.485 |
hsa-miR-21-3p | SDC2 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.166; TCGA CESC -0.508; TCGA COAD -0.441; TCGA ESCA -0.284; TCGA HNSC -0.36; TCGA KIRC -0.082; TCGA LIHC -0.229; TCGA LUAD -0.288; TCGA LUSC -0.3; TCGA PAAD -0.115; TCGA THCA -0.115; TCGA STAD -0.337; TCGA UCEC -0.259 |
hsa-miR-21-3p | GPRASP2 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.174; TCGA BRCA -0.353; TCGA CESC -0.251; TCGA COAD -0.41; TCGA ESCA -0.331; TCGA HNSC -0.334; TCGA KIRC -0.296; TCGA KIRP -0.289; TCGA LGG -0.095; TCGA LIHC -0.132; TCGA LUAD -0.217; TCGA LUSC -0.237; TCGA OV -0.158; TCGA PAAD -0.415; TCGA PRAD -0.067; TCGA SARC -0.366; TCGA THCA -0.109; TCGA UCEC -0.453 |
hsa-miR-21-3p | RPS6KA2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.273; TCGA BRCA -0.243; TCGA CESC -0.164; TCGA COAD -0.199; TCGA ESCA -0.168; TCGA HNSC -0.297; TCGA KIRC -0.131; TCGA KIRP -0.082; TCGA LUAD -0.148; TCGA LUSC -0.342; TCGA STAD -0.197; TCGA UCEC -0.227 |
hsa-miR-21-3p | KIAA1462 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.274; TCGA BRCA -0.11; TCGA CESC -0.359; TCGA COAD -0.467; TCGA HNSC -0.328; TCGA KIRP -0.319; TCGA LGG -0.11; TCGA LIHC -0.181; TCGA LUAD -0.21; TCGA LUSC -0.43; TCGA PRAD -0.222; TCGA STAD -0.11; TCGA UCEC -0.433 |
hsa-miR-21-3p | GFRA2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.257; TCGA BRCA -0.536; TCGA CESC -0.519; TCGA COAD -0.461; TCGA ESCA -0.662; TCGA HNSC -0.423; TCGA KIRP -0.406; TCGA LUAD -0.369; TCGA LUSC -0.487; TCGA PRAD -0.205; TCGA SARC -0.369; TCGA STAD -0.753; TCGA UCEC -0.471 |
hsa-miR-21-3p | PCDHA6 | 9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LUSC; PAAD; UCEC | MirTarget | TCGA BLCA -0.346; TCGA BRCA -0.274; TCGA CESC -0.828; TCGA COAD -0.762; TCGA KIRC -0.269; TCGA LGG -0.184; TCGA LUSC -0.532; TCGA PAAD -0.429; TCGA UCEC -0.196 |
hsa-miR-21-3p | GCOM1 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.697; TCGA BRCA -0.642; TCGA CESC -0.284; TCGA ESCA -0.586; TCGA HNSC -0.416; TCGA KIRC -0.851; TCGA KIRP -0.869; TCGA LUAD -0.498; TCGA LUSC -0.627; TCGA PRAD -0.303; TCGA SARC -0.444; TCGA STAD -0.195; TCGA UCEC -0.418 |
hsa-miR-21-3p | KIRREL3 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.434; TCGA BRCA -0.307; TCGA CESC -0.224; TCGA COAD -0.769; TCGA ESCA -0.521; TCGA HNSC -0.604; TCGA KIRC -0.178; TCGA KIRP -0.3; TCGA LGG -0.168; TCGA LUAD -0.228; TCGA LUSC -0.533; TCGA OV -0.441; TCGA STAD -0.723; TCGA UCEC -0.17 |
hsa-miR-21-3p | VPS13D | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.11; TCGA BRCA -0.141; TCGA CESC -0.087; TCGA ESCA -0.161; TCGA HNSC -0.137; TCGA KIRC -0.304; TCGA KIRP -0.148; TCGA LGG -0.072; TCGA LUAD -0.129; TCGA LUSC -0.128; TCGA SARC -0.05; TCGA STAD -0.141; TCGA UCEC -0.077 |
hsa-miR-21-3p | FAT3 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.82; TCGA BRCA -0.113; TCGA CESC -0.606; TCGA COAD -0.53; TCGA ESCA -0.783; TCGA HNSC -0.553; TCGA KIRP -0.254; TCGA LGG -0.145; TCGA LUAD -0.6; TCGA LUSC -0.701; TCGA PRAD -0.445; TCGA SARC -0.988; TCGA STAD -1.047; TCGA UCEC -0.328 |
hsa-miR-21-3p | ETV1 | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; STAD | MirTarget | TCGA BLCA -0.146; TCGA BRCA -0.076; TCGA CESC -0.36; TCGA COAD -0.237; TCGA HNSC -0.581; TCGA LGG -0.185; TCGA LUAD -0.303; TCGA LUSC -0.346; TCGA STAD -0.262 |
hsa-miR-21-3p | PRKD1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.514; TCGA BRCA -0.221; TCGA CESC -0.522; TCGA COAD -0.893; TCGA ESCA -0.479; TCGA HNSC -0.503; TCGA KIRC -0.369; TCGA KIRP -0.122; TCGA LUAD -0.34; TCGA LUSC -0.181; TCGA PAAD -0.152; TCGA SARC -0.214; TCGA THCA -0.056; TCGA STAD -0.418; TCGA UCEC -0.305 |
hsa-miR-21-3p | KCNMA1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.504; TCGA BRCA -0.265; TCGA CESC -0.541; TCGA COAD -1.409; TCGA ESCA -1.01; TCGA HNSC -0.277; TCGA LGG -0.066; TCGA PAAD -0.451; TCGA PRAD -0.219; TCGA SARC -0.313; TCGA STAD -1.077; TCGA UCEC -0.501 |
hsa-miR-21-3p | USP51 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.204; TCGA BRCA -0.157; TCGA CESC -0.677; TCGA COAD -0.612; TCGA ESCA -0.412; TCGA HNSC -0.415; TCGA KIRC -0.33; TCGA KIRP -0.476; TCGA LGG -0.105; TCGA LUAD -0.32; TCGA LUSC -0.166; TCGA OV -0.314; TCGA PAAD -0.334; TCGA PRAD -0.128; TCGA SARC -0.507; TCGA THCA -0.236; TCGA STAD -0.523; TCGA UCEC -0.317 |
hsa-miR-21-3p | ABI2 | 15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.092; TCGA BRCA -0.052; TCGA CESC -0.2; TCGA COAD -0.08; TCGA HNSC -0.061; TCGA KIRC -0.156; TCGA KIRP -0.102; TCGA LGG -0.103; TCGA LUAD -0.079; TCGA LUSC -0.153; TCGA OV -0.126; TCGA PAAD -0.098; TCGA SARC -0.241; TCGA STAD -0.177; TCGA UCEC -0.11 |
hsa-miR-21-3p | ARHGAP6 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.713; TCGA BRCA -0.353; TCGA CESC -0.628; TCGA COAD -0.591; TCGA ESCA -0.352; TCGA HNSC -0.577; TCGA KIRC -0.294; TCGA KIRP -0.255; TCGA LUAD -0.446; TCGA LUSC -0.582; TCGA PRAD -0.157; TCGA SARC -0.229; TCGA THCA -0.099; TCGA STAD -0.416; TCGA UCEC -0.573 |
hsa-miR-21-3p | PCGF5 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.061; TCGA BRCA -0.132; TCGA HNSC -0.059; TCGA KIRC -0.134; TCGA KIRP -0.19; TCGA LIHC -0.068; TCGA LUAD -0.099; TCGA PRAD -0.074; TCGA THCA -0.059; TCGA UCEC -0.059 |
hsa-miR-21-3p | NFAT5 | 10 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.142; TCGA BRCA -0.183; TCGA CESC -0.119; TCGA COAD -0.182; TCGA KIRC -0.213; TCGA LUAD -0.092; TCGA LUSC -0.111; TCGA SARC -0.129; TCGA STAD -0.104; TCGA UCEC -0.085 |
hsa-miR-21-3p | PCDH19 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.496; TCGA BRCA -0.396; TCGA CESC -0.996; TCGA COAD -0.725; TCGA ESCA -0.457; TCGA HNSC -0.778; TCGA KIRC -0.349; TCGA KIRP -0.345; TCGA LGG -0.181; TCGA SARC -0.326; TCGA STAD -0.606; TCGA UCEC -0.236 |
hsa-miR-21-3p | SSPN | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.248; TCGA BRCA -0.289; TCGA CESC -0.289; TCGA COAD -0.602; TCGA ESCA -0.236; TCGA HNSC -0.365; TCGA LGG -0.086; TCGA LUAD -0.14; TCGA PRAD -0.181; TCGA STAD -0.509; TCGA UCEC -0.323 |
hsa-miR-21-3p | SNRK | 11 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.119; TCGA BRCA -0.161; TCGA KIRC -0.127; TCGA KIRP -0.169; TCGA LIHC -0.089; TCGA LUAD -0.178; TCGA LUSC -0.205; TCGA SARC -0.14; TCGA THCA -0.09; TCGA STAD -0.156; TCGA UCEC -0.202 |
hsa-miR-21-3p | STAT5B | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.165; TCGA BRCA -0.265; TCGA CESC -0.124; TCGA COAD -0.077; TCGA ESCA -0.101; TCGA HNSC -0.109; TCGA LIHC -0.124; TCGA LUAD -0.107; TCGA LUSC -0.123; TCGA PAAD -0.135; TCGA PRAD -0.07; TCGA SARC -0.245; TCGA STAD -0.208; TCGA UCEC -0.191 |
hsa-miR-21-3p | USP44 | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.285; TCGA BRCA -0.496; TCGA CESC -0.391; TCGA ESCA -0.337; TCGA HNSC -0.453; TCGA KIRC -0.931; TCGA KIRP -0.295; TCGA LUAD -0.376; TCGA LUSC -0.381; TCGA OV -0.355; TCGA PRAD -0.291; TCGA SARC -0.272; TCGA THCA -0.344; TCGA STAD -0.556 |
hsa-miR-21-3p | PLGLB2 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUSC; PAAD; THCA | MirTarget | TCGA BLCA -0.224; TCGA BRCA -0.105; TCGA CESC -0.111; TCGA HNSC -0.11; TCGA KIRP -0.183; TCGA LGG -0.089; TCGA LUSC -0.23; TCGA PAAD -0.17; TCGA THCA -0.125 |
hsa-miR-21-3p | ZNF652 | 9 cancers: BLCA; CESC; HNSC; LIHC; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.174; TCGA CESC -0.142; TCGA HNSC -0.169; TCGA LIHC -0.121; TCGA PAAD -0.066; TCGA SARC -0.055; TCGA THCA -0.185; TCGA STAD -0.083; TCGA UCEC -0.051 |
hsa-miR-21-3p | CDADC1 | 14 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.054; TCGA BRCA -0.199; TCGA ESCA -0.115; TCGA KIRC -0.261; TCGA KIRP -0.254; TCGA LIHC -0.217; TCGA LUAD -0.129; TCGA LUSC -0.132; TCGA OV -0.066; TCGA PAAD -0.152; TCGA PRAD -0.071; TCGA THCA -0.259; TCGA STAD -0.182; TCGA UCEC -0.171 |
hsa-miR-21-3p | EPAS1 | 10 cancers: BLCA; BRCA; COAD; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.104; TCGA BRCA -0.323; TCGA COAD -0.134; TCGA KIRP -0.317; TCGA LUAD -0.337; TCGA LUSC -0.343; TCGA PRAD -0.095; TCGA THCA -0.184; TCGA STAD -0.082; TCGA UCEC -0.104 |
hsa-miR-21-3p | MPRIP | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.066; TCGA BRCA -0.147; TCGA CESC -0.075; TCGA ESCA -0.11; TCGA HNSC -0.102; TCGA KIRP -0.16; TCGA LIHC -0.054; TCGA LUAD -0.069; TCGA LUSC -0.133; TCGA SARC -0.109; TCGA STAD -0.109; TCGA UCEC -0.091 |
hsa-miR-21-3p | USP46 | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; THCA; UCEC | MirTarget | TCGA BLCA -0.065; TCGA CESC -0.137; TCGA ESCA -0.151; TCGA HNSC -0.119; TCGA KIRC -0.293; TCGA KIRP -0.271; TCGA LGG -0.17; TCGA THCA -0.115; TCGA UCEC -0.056 |
hsa-miR-21-3p | CAMLG | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.096; TCGA CESC -0.107; TCGA COAD -0.104; TCGA ESCA -0.115; TCGA KIRP -0.082; TCGA LGG -0.128; TCGA LIHC -0.104; TCGA LUAD -0.074; TCGA LUSC -0.086; TCGA PAAD -0.13; TCGA SARC -0.155; TCGA STAD -0.146; TCGA UCEC -0.143 |
hsa-miR-21-3p | PARD3B | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.433; TCGA BRCA -0.288; TCGA CESC -0.658; TCGA COAD -0.181; TCGA ESCA -0.487; TCGA HNSC -0.578; TCGA KIRC -0.536; TCGA KIRP -0.263; TCGA LGG -0.098; TCGA LIHC -0.321; TCGA LUAD -0.18; TCGA LUSC -0.35; TCGA OV -0.089; TCGA SARC -0.314; TCGA STAD -0.321; TCGA UCEC -0.164 |
hsa-miR-21-3p | RNF146 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.104; TCGA BRCA -0.1; TCGA CESC -0.131; TCGA COAD -0.153; TCGA ESCA -0.182; TCGA HNSC -0.115; TCGA KIRC -0.113; TCGA KIRP -0.051; TCGA LGG -0.08; TCGA LIHC -0.083; TCGA LUAD -0.117; TCGA LUSC -0.23; TCGA PAAD -0.093; TCGA PRAD -0.07; TCGA SARC -0.055; TCGA THCA -0.075; TCGA STAD -0.192; TCGA UCEC -0.151 |
hsa-miR-21-3p | PDIK1L | 9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.093; TCGA CESC -0.138; TCGA HNSC -0.127; TCGA KIRC -0.13; TCGA KIRP -0.114; TCGA LIHC -0.134; TCGA PAAD -0.105; TCGA THCA -0.155; TCGA UCEC -0.081 |
hsa-miR-21-3p | HIPK1 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.052; TCGA BRCA -0.072; TCGA CESC -0.151; TCGA HNSC -0.088; TCGA KIRC -0.084; TCGA KIRP -0.082; TCGA LUAD -0.063; TCGA LUSC -0.18; TCGA OV -0.066; TCGA SARC -0.07; TCGA THCA -0.086; TCGA STAD -0.056; TCGA UCEC -0.11 |
hsa-miR-21-3p | NAP1L5 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.306; TCGA BRCA -0.286; TCGA CESC -0.211; TCGA COAD -0.172; TCGA ESCA -0.337; TCGA HNSC -0.156; TCGA KIRC -0.375; TCGA KIRP -0.432; TCGA LGG -0.164; TCGA LUAD -0.191; TCGA LUSC -0.228; TCGA PAAD -0.401; TCGA PRAD -0.13; TCGA SARC -0.294; TCGA THCA -0.25; TCGA STAD -0.496; TCGA UCEC -0.323 |
hsa-miR-21-3p | SP4 | 13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.065; TCGA BRCA -0.105; TCGA CESC -0.247; TCGA COAD -0.242; TCGA KIRC -0.134; TCGA KIRP -0.243; TCGA LUSC -0.133; TCGA OV -0.216; TCGA PAAD -0.157; TCGA SARC -0.203; TCGA THCA -0.08; TCGA STAD -0.137; TCGA UCEC -0.196 |
hsa-miR-21-3p | GNAZ | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.545; TCGA BRCA -0.197; TCGA CESC -0.417; TCGA COAD -0.366; TCGA ESCA -0.625; TCGA HNSC -0.412; TCGA KIRP -0.118; TCGA LGG -0.129; TCGA LUAD -0.404; TCGA LUSC -0.294; TCGA OV -0.127; TCGA PAAD -0.606; TCGA PRAD -0.265; TCGA SARC -0.764; TCGA STAD -0.618; TCGA UCEC -0.349 |
hsa-miR-21-3p | SCAI | 14 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.131; TCGA BRCA -0.145; TCGA CESC -0.141; TCGA KIRC -0.217; TCGA KIRP -0.151; TCGA LGG -0.16; TCGA LIHC -0.211; TCGA LUAD -0.226; TCGA LUSC -0.307; TCGA OV -0.067; TCGA PAAD -0.19; TCGA SARC -0.196; TCGA STAD -0.136; TCGA UCEC -0.131 |
hsa-miR-21-3p | ZNF248 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.275; TCGA BRCA -0.104; TCGA CESC -0.233; TCGA COAD -0.093; TCGA ESCA -0.142; TCGA HNSC -0.162; TCGA LGG -0.153; TCGA LIHC -0.12; TCGA LUAD -0.062; TCGA LUSC -0.176; TCGA OV -0.17; TCGA PAAD -0.175; TCGA PRAD -0.08; TCGA SARC -0.262; TCGA THCA -0.127; TCGA STAD -0.28; TCGA UCEC -0.094 |
hsa-miR-21-3p | PPP1R1A | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.72; TCGA BRCA -0.861; TCGA CESC -0.895; TCGA COAD -0.853; TCGA ESCA -1.253; TCGA HNSC -1.094; TCGA KIRP -0.227; TCGA LGG -0.486; TCGA LIHC -0.29; TCGA LUSC -0.452; TCGA PAAD -0.932; TCGA PRAD -0.482; TCGA SARC -0.713; TCGA STAD -1.43 |
hsa-miR-21-3p | ST13 | 11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.086; TCGA BRCA -0.08; TCGA KIRC -0.066; TCGA KIRP -0.162; TCGA LGG -0.106; TCGA LIHC -0.081; TCGA PAAD -0.09; TCGA PRAD -0.055; TCGA SARC -0.082; TCGA STAD -0.089; TCGA UCEC -0.137 |
hsa-miR-21-3p | PCDHA3 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; UCEC | MirTarget | TCGA BLCA -0.445; TCGA BRCA -0.34; TCGA CESC -0.755; TCGA COAD -1.044; TCGA ESCA -0.633; TCGA KIRC -0.361; TCGA LGG -0.118; TCGA LUAD -0.341; TCGA LUSC -0.643; TCGA PAAD -0.422; TCGA UCEC -0.328 |
hsa-miR-21-3p | MMRN2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.453; TCGA BRCA -0.435; TCGA CESC -0.298; TCGA COAD -0.489; TCGA ESCA -0.325; TCGA HNSC -0.15; TCGA KIRP -0.441; TCGA LIHC -0.129; TCGA LUAD -0.316; TCGA LUSC -0.364; TCGA PRAD -0.112; TCGA THCA -0.211; TCGA STAD -0.22; TCGA UCEC -0.315 |
hsa-miR-21-3p | NEK9 | 14 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.144; TCGA BRCA -0.163; TCGA CESC -0.102; TCGA KIRC -0.112; TCGA KIRP -0.061; TCGA LIHC -0.115; TCGA LUAD -0.073; TCGA OV -0.083; TCGA PAAD -0.104; TCGA PRAD -0.06; TCGA SARC -0.118; TCGA THCA -0.101; TCGA STAD -0.177; TCGA UCEC -0.122 |
hsa-miR-21-3p | ZFX | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.056; TCGA BRCA -0.091; TCGA CESC -0.109; TCGA HNSC -0.069; TCGA KIRP -0.165; TCGA SARC -0.14; TCGA THCA -0.061; TCGA STAD -0.099; TCGA UCEC -0.093 |
hsa-miR-21-3p | ATP2B4 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.219; TCGA BRCA -0.118; TCGA CESC -0.098; TCGA COAD -0.498; TCGA ESCA -0.169; TCGA LUAD -0.105; TCGA OV -0.068; TCGA PRAD -0.196; TCGA SARC -0.363; TCGA STAD -0.55; TCGA UCEC -0.253 |
hsa-miR-21-3p | RORA | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.116; TCGA BRCA -0.174; TCGA CESC -0.209; TCGA COAD -0.403; TCGA ESCA -0.347; TCGA HNSC -0.304; TCGA LGG -0.084; TCGA LIHC -0.199; TCGA LUAD -0.305; TCGA LUSC -0.129; TCGA THCA -0.086; TCGA STAD -0.387; TCGA UCEC -0.324 |
hsa-miR-21-3p | TNRC6C | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.225; TCGA BRCA -0.079; TCGA CESC -0.289; TCGA COAD -0.1; TCGA ESCA -0.23; TCGA HNSC -0.265; TCGA KIRC -0.095; TCGA LGG -0.127; TCGA LUAD -0.105; TCGA LUSC -0.27; TCGA PAAD -0.163; TCGA SARC -0.264; TCGA THCA -0.116; TCGA STAD -0.219; TCGA UCEC -0.186 |
hsa-miR-21-3p | COBLL1 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; SARC | mirMAP | TCGA BLCA -0.194; TCGA BRCA -0.183; TCGA COAD -0.192; TCGA ESCA -0.25; TCGA KIRC -0.706; TCGA KIRP -0.29; TCGA LIHC -0.388; TCGA LUAD -0.197; TCGA SARC -0.232 |
hsa-miR-21-3p | TNRC6B | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.111; TCGA BRCA -0.106; TCGA CESC -0.134; TCGA HNSC -0.094; TCGA KIRC -0.087; TCGA LGG -0.086; TCGA LIHC -0.088; TCGA PAAD -0.061; TCGA SARC -0.106; TCGA STAD -0.108 |
hsa-miR-21-3p | EBF3 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.398; TCGA BRCA -0.617; TCGA CESC -0.471; TCGA COAD -0.618; TCGA ESCA -0.402; TCGA HNSC -0.448; TCGA KIRP -0.478; TCGA LIHC -0.43; TCGA LUAD -0.402; TCGA LUSC -0.484; TCGA THCA -0.261; TCGA STAD -0.387; TCGA UCEC -0.457 |
hsa-miR-21-3p | PPARGC1A | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.583; TCGA BRCA -0.472; TCGA CESC -0.557; TCGA ESCA -0.522; TCGA HNSC -0.943; TCGA KIRC -0.866; TCGA KIRP -0.201; TCGA LGG -0.114; TCGA LUAD -0.374; TCGA LUSC -0.305; TCGA PRAD -0.424; TCGA SARC -0.89; TCGA THCA -0.648; TCGA STAD -0.432; TCGA UCEC -0.254 |
hsa-miR-21-3p | SLC1A2 | 15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.308; TCGA CESC -0.559; TCGA COAD -0.292; TCGA ESCA -0.573; TCGA HNSC -0.604; TCGA KIRC -0.237; TCGA KIRP -0.376; TCGA LGG -0.349; TCGA LIHC -0.335; TCGA LUAD -0.399; TCGA LUSC -0.314; TCGA OV -0.239; TCGA THCA -0.39; TCGA STAD -0.378; TCGA UCEC -0.279 |
hsa-miR-21-3p | CPEB4 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.177; TCGA BRCA -0.102; TCGA CESC -0.172; TCGA COAD -0.108; TCGA ESCA -0.177; TCGA HNSC -0.177; TCGA KIRC -0.355; TCGA KIRP -0.319; TCGA LGG -0.063; TCGA LIHC -0.091; TCGA LUAD -0.154; TCGA LUSC -0.183; TCGA PAAD -0.17; TCGA SARC -0.204; TCGA THCA -0.139; TCGA STAD -0.164; TCGA UCEC -0.119 |
hsa-miR-21-3p | CHD5 | 12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.54; TCGA CESC -0.201; TCGA ESCA -0.837; TCGA KIRC -1.031; TCGA KIRP -0.846; TCGA LGG -0.329; TCGA LUSC -0.666; TCGA PAAD -0.734; TCGA PRAD -0.287; TCGA SARC -0.795; TCGA STAD -0.801; TCGA UCEC -0.269 |
hsa-miR-21-3p | MEF2D | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.09; TCGA BRCA -0.061; TCGA COAD -0.125; TCGA ESCA -0.097; TCGA HNSC -0.089; TCGA KIRP -0.08; TCGA LUSC -0.068; TCGA SARC -0.141; TCGA STAD -0.184; TCGA UCEC -0.104 |
hsa-miR-21-3p | CCND2 | 10 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.266; TCGA BRCA -0.127; TCGA ESCA -0.331; TCGA LUAD -0.213; TCGA LUSC -0.315; TCGA OV -0.372; TCGA PAAD -0.258; TCGA PRAD -0.204; TCGA STAD -0.307; TCGA UCEC -0.286 |
hsa-miR-21-3p | CLYBL | 13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.264; TCGA BRCA -0.208; TCGA ESCA -0.386; TCGA HNSC -0.393; TCGA KIRC -0.302; TCGA KIRP -0.109; TCGA LIHC -0.139; TCGA LUAD -0.129; TCGA PRAD -0.111; TCGA SARC -0.15; TCGA THCA -0.197; TCGA STAD -0.13; TCGA UCEC -0.085 |
hsa-miR-21-3p | AMOT | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; UCEC | mirMAP | TCGA BLCA -0.485; TCGA BRCA -0.107; TCGA CESC -0.742; TCGA ESCA -0.396; TCGA HNSC -1.001; TCGA KIRC -0.162; TCGA LGG -0.144; TCGA LUAD -0.218; TCGA LUSC -0.413; TCGA PAAD -0.154; TCGA SARC -0.369; TCGA UCEC -0.181 |
hsa-miR-21-3p | ZNF780B | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.239; TCGA BRCA -0.155; TCGA CESC -0.235; TCGA HNSC -0.144; TCGA KIRC -0.268; TCGA KIRP -0.16; TCGA LIHC -0.175; TCGA LUSC -0.179; TCGA OV -0.077; TCGA PAAD -0.247; TCGA SARC -0.184; TCGA THCA -0.143; TCGA STAD -0.143 |
hsa-miR-21-3p | NDUFA5 | 14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.148; TCGA COAD -0.099; TCGA ESCA -0.132; TCGA HNSC -0.1; TCGA KIRC -0.217; TCGA KIRP -0.076; TCGA LGG -0.104; TCGA LIHC -0.126; TCGA OV -0.055; TCGA PAAD -0.203; TCGA PRAD -0.096; TCGA THCA -0.217; TCGA STAD -0.095; TCGA UCEC -0.136 |
hsa-miR-21-3p | PGPEP1 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.355; TCGA BRCA -0.237; TCGA CESC -0.197; TCGA HNSC -0.345; TCGA KIRC -0.117; TCGA LIHC -0.118; TCGA LUAD -0.083; TCGA LUSC -0.213; TCGA PAAD -0.183; TCGA SARC -0.246; TCGA STAD -0.079 |
hsa-miR-21-3p | WASF3 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.278; TCGA BRCA -0.355; TCGA CESC -0.344; TCGA COAD -0.716; TCGA ESCA -0.466; TCGA HNSC -0.241; TCGA KIRC -0.479; TCGA KIRP -0.339; TCGA LGG -0.248; TCGA LUAD -0.473; TCGA LUSC -0.352; TCGA OV -0.189; TCGA PAAD -0.243; TCGA THCA -0.473; TCGA STAD -0.618; TCGA UCEC -0.415 |
hsa-miR-21-3p | DTNA | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.564; TCGA CESC -0.652; TCGA COAD -1.184; TCGA ESCA -0.812; TCGA HNSC -0.755; TCGA LUAD -0.225; TCGA LUSC -0.399; TCGA OV -0.234; TCGA PAAD -0.443; TCGA PRAD -0.248; TCGA SARC -0.437; TCGA THCA -0.09; TCGA STAD -0.944; TCGA UCEC -0.344 |
hsa-miR-21-3p | ENTPD1 | 10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.192; TCGA CESC -0.178; TCGA COAD -0.203; TCGA ESCA -0.118; TCGA LUAD -0.059; TCGA LUSC -0.147; TCGA PRAD -0.057; TCGA SARC -0.194; TCGA STAD -0.172; TCGA UCEC -0.154 |
hsa-miR-21-3p | FGF2 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.39; TCGA BRCA -0.713; TCGA COAD -0.526; TCGA ESCA -0.542; TCGA HNSC -0.325; TCGA KIRC -0.117; TCGA LIHC -0.24; TCGA LUAD -0.372; TCGA LUSC -0.28; TCGA PRAD -0.235; TCGA SARC -0.274; TCGA STAD -0.563; TCGA UCEC -0.487 |
hsa-miR-21-3p | NTRK3 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.796; TCGA BRCA -0.651; TCGA CESC -0.716; TCGA COAD -1.25; TCGA ESCA -1.158; TCGA HNSC -1.017; TCGA KIRC -0.438; TCGA KIRP -0.325; TCGA LGG -0.109; TCGA LUAD -0.603; TCGA LUSC -0.866; TCGA OV -0.28; TCGA PRAD -0.396; TCGA SARC -0.498; TCGA STAD -0.776; TCGA UCEC -0.705 |
hsa-miR-21-3p | SMAD4 | 16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.096; TCGA BRCA -0.142; TCGA CESC -0.113; TCGA ESCA -0.129; TCGA HNSC -0.133; TCGA KIRC -0.142; TCGA KIRP -0.075; TCGA LIHC -0.063; TCGA LUAD -0.097; TCGA LUSC -0.065; TCGA OV -0.051; TCGA PAAD -0.185; TCGA PRAD -0.07; TCGA SARC -0.184; TCGA STAD -0.142; TCGA UCEC -0.17 |
hsa-miR-21-3p | CPLX2 | 9 cancers: BLCA; CESC; COAD; ESCA; LGG; LUAD; OV; PAAD; STAD | mirMAP | TCGA BLCA -0.456; TCGA CESC -0.345; TCGA COAD -0.692; TCGA ESCA -1.079; TCGA LGG -0.672; TCGA LUAD -0.378; TCGA OV -0.494; TCGA PAAD -1.119; TCGA STAD -0.841 |
hsa-miR-21-3p | LRRC27 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.18; TCGA BRCA -0.057; TCGA CESC -0.177; TCGA ESCA -0.158; TCGA HNSC -0.205; TCGA KIRC -0.052; TCGA LGG -0.101; TCGA LUAD -0.144; TCGA LUSC -0.309; TCGA OV -0.11; TCGA PAAD -0.208; TCGA PRAD -0.065; TCGA THCA -0.135; TCGA STAD -0.087; TCGA UCEC -0.152 |
hsa-miR-21-3p | FAM168B | 13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; OV; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.063; TCGA BRCA -0.128; TCGA CESC -0.091; TCGA COAD -0.104; TCGA KIRC -0.157; TCGA KIRP -0.12; TCGA LGG -0.072; TCGA LIHC -0.08; TCGA OV -0.112; TCGA SARC -0.172; TCGA THCA -0.057; TCGA STAD -0.176; TCGA UCEC -0.071 |
hsa-miR-21-3p | JMY | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.218; TCGA BRCA -0.117; TCGA CESC -0.185; TCGA COAD -0.243; TCGA ESCA -0.242; TCGA HNSC -0.125; TCGA KIRC -0.308; TCGA KIRP -0.073; TCGA LGG -0.09; TCGA LIHC -0.115; TCGA LUAD -0.092; TCGA LUSC -0.086; TCGA PAAD -0.168; TCGA SARC -0.32; TCGA STAD -0.314; TCGA UCEC -0.075 |
hsa-miR-21-3p | DGKE | 11 cancers: BLCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.2; TCGA KIRC -0.21; TCGA KIRP -0.237; TCGA LGG -0.127; TCGA LUAD -0.079; TCGA PAAD -0.245; TCGA PRAD -0.093; TCGA SARC -0.195; TCGA THCA -0.129; TCGA STAD -0.202; TCGA UCEC -0.239 |
hsa-miR-21-3p | CACNA2D1 | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; STAD; UCEC | mirMAP | TCGA BLCA -0.23; TCGA BRCA -0.425; TCGA CESC -0.513; TCGA COAD -1.033; TCGA HNSC -0.607; TCGA KIRP -0.487; TCGA LGG -0.263; TCGA STAD -0.59; TCGA UCEC -0.435 |
hsa-miR-21-3p | N6AMT1 | 17 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.127; TCGA BRCA -0.059; TCGA CESC -0.085; TCGA ESCA -0.171; TCGA HNSC -0.112; TCGA KIRC -0.113; TCGA KIRP -0.05; TCGA LGG -0.105; TCGA LIHC -0.099; TCGA LUAD -0.071; TCGA LUSC -0.14; TCGA OV -0.133; TCGA PAAD -0.125; TCGA SARC -0.111; TCGA THCA -0.101; TCGA STAD -0.063; TCGA UCEC -0.112 |
hsa-miR-21-3p | PRKAA2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; OV; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.425; TCGA BRCA -0.258; TCGA COAD -1.039; TCGA ESCA -0.916; TCGA HNSC -1.009; TCGA KIRC -0.305; TCGA KIRP -0.237; TCGA OV -0.192; TCGA SARC -1.026; TCGA THCA -0.187; TCGA STAD -1.215 |
hsa-miR-21-3p | ADCY1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.167; TCGA BRCA -0.16; TCGA CESC -0.203; TCGA COAD -0.322; TCGA ESCA -0.432; TCGA HNSC -0.18; TCGA KIRC -0.365; TCGA KIRP -0.883; TCGA LUAD -0.16; TCGA OV -0.311; TCGA PAAD -0.665; TCGA THCA -0.505; TCGA STAD -0.135; TCGA UCEC -0.569 |
hsa-miR-21-3p | KIF5C | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.57; TCGA BRCA -0.176; TCGA CESC -0.34; TCGA COAD -0.4; TCGA ESCA -0.444; TCGA HNSC -0.268; TCGA KIRC -0.144; TCGA KIRP -0.566; TCGA LGG -0.155; TCGA LUSC -0.404; TCGA OV -0.151; TCGA PAAD -0.641; TCGA SARC -0.474; TCGA THCA -0.351; TCGA STAD -0.467 |
hsa-miR-21-3p | SPRY3 | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.092; TCGA BRCA -0.102; TCGA CESC -0.352; TCGA COAD -0.174; TCGA HNSC -0.205; TCGA KIRC -0.092; TCGA KIRP -0.14; TCGA LGG -0.067; TCGA LUSC -0.238; TCGA PRAD -0.186; TCGA SARC -0.235; TCGA THCA -0.084; TCGA STAD -0.075; TCGA UCEC -0.14 |
hsa-miR-21-3p | MECP2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.068; TCGA BRCA -0.13; TCGA CESC -0.111; TCGA COAD -0.098; TCGA ESCA -0.105; TCGA HNSC -0.092; TCGA KIRC -0.139; TCGA KIRP -0.116; TCGA LUAD -0.051; TCGA LUSC -0.094; TCGA PAAD -0.101; TCGA SARC -0.115; TCGA THCA -0.071; TCGA STAD -0.189; TCGA UCEC -0.136 |
hsa-miR-21-3p | LONRF2 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -1.247; TCGA BRCA -0.365; TCGA CESC -0.835; TCGA COAD -1.758; TCGA ESCA -1.152; TCGA HNSC -1.11; TCGA KIRC -0.749; TCGA KIRP -0.718; TCGA LGG -0.142; TCGA LUSC -0.52; TCGA OV -0.182; TCGA PAAD -0.455; TCGA SARC -1.548; TCGA STAD -1.03; TCGA UCEC -0.54 |
hsa-miR-21-3p | SGCD | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.423; TCGA BRCA -0.125; TCGA CESC -0.708; TCGA COAD -0.881; TCGA ESCA -0.599; TCGA HNSC -0.602; TCGA KIRP -0.173; TCGA LGG -0.147; TCGA LUAD -0.271; TCGA LUSC -0.292; TCGA PRAD -0.273; TCGA SARC -0.253; TCGA STAD -0.547; TCGA UCEC -0.588 |
hsa-miR-21-3p | PDE3A | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.259; TCGA BRCA -0.267; TCGA CESC -0.647; TCGA COAD -0.39; TCGA ESCA -0.371; TCGA HNSC -0.423; TCGA KIRP -0.606; TCGA LUSC -0.229; TCGA OV -0.169; TCGA SARC -0.56; TCGA STAD -0.661; TCGA UCEC -0.269 |
hsa-miR-21-3p | ADCY6 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC | mirMAP | TCGA BLCA -0.152; TCGA BRCA -0.224; TCGA CESC -0.162; TCGA ESCA -0.204; TCGA HNSC -0.3; TCGA KIRC -0.184; TCGA KIRP -0.072; TCGA LIHC -0.065; TCGA LUAD -0.072; TCGA LUSC -0.254; TCGA PAAD -0.08; TCGA SARC -0.211 |
hsa-miR-21-3p | ZHX3 | 13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD | mirMAP | TCGA BLCA -0.075; TCGA BRCA -0.212; TCGA CESC -0.122; TCGA ESCA -0.233; TCGA KIRC -0.344; TCGA KIRP -0.192; TCGA LGG -0.054; TCGA LIHC -0.102; TCGA LUAD -0.085; TCGA LUSC -0.099; TCGA PAAD -0.193; TCGA THCA -0.168; TCGA STAD -0.294 |
hsa-miR-21-3p | KBTBD11 | 10 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.262; TCGA BRCA -0.276; TCGA HNSC -0.421; TCGA LGG -0.252; TCGA LUAD -0.308; TCGA LUSC -0.28; TCGA PAAD -0.154; TCGA PRAD -0.149; TCGA THCA -0.21; TCGA UCEC -0.225 |
hsa-miR-21-3p | DPY19L3 | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; OV; THCA; UCEC | mirMAP | TCGA BLCA -0.155; TCGA CESC -0.316; TCGA COAD -0.179; TCGA HNSC -0.179; TCGA KIRC -0.113; TCGA KIRP -0.151; TCGA LUSC -0.157; TCGA OV -0.073; TCGA THCA -0.093; TCGA UCEC -0.099 |
hsa-miR-21-3p | PLCXD3 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.464; TCGA BRCA -0.909; TCGA CESC -0.936; TCGA COAD -1.169; TCGA ESCA -1.361; TCGA KIRC -0.624; TCGA KIRP -0.636; TCGA LGG -0.137; TCGA LUAD -0.571; TCGA LUSC -0.475; TCGA OV -0.321; TCGA PAAD -0.404; TCGA SARC -0.456; TCGA STAD -1.172; TCGA UCEC -0.488 |
hsa-miR-21-3p | SV2B | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.217; TCGA BRCA -0.433; TCGA CESC -0.559; TCGA COAD -1.026; TCGA ESCA -0.851; TCGA HNSC -0.776; TCGA KIRC -0.233; TCGA LGG -0.431; TCGA LUAD -0.345; TCGA PRAD -0.415; TCGA STAD -0.461; TCGA UCEC -0.396 |
hsa-miR-21-3p | TEAD1 | 9 cancers: BLCA; BRCA; COAD; KIRC; LGG; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.148; TCGA BRCA -0.203; TCGA COAD -0.185; TCGA KIRC -0.089; TCGA LGG -0.054; TCGA PRAD -0.106; TCGA SARC -0.105; TCGA STAD -0.371; TCGA UCEC -0.118 |
hsa-miR-21-3p | ELMO1 | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; THCA; STAD | MirTarget | TCGA BRCA -0.107; TCGA CESC -0.276; TCGA COAD -0.418; TCGA ESCA -0.216; TCGA HNSC -0.222; TCGA LGG -0.136; TCGA LUAD -0.3; TCGA LUSC -0.224; TCGA PAAD -0.275; TCGA THCA -0.596; TCGA STAD -0.149 |
hsa-miR-21-3p | STX17 | 10 cancers: BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.051; TCGA KIRC -0.11; TCGA KIRP -0.052; TCGA LIHC -0.079; TCGA LUAD -0.053; TCGA LUSC -0.062; TCGA SARC -0.138; TCGA THCA -0.066; TCGA STAD -0.113; TCGA UCEC -0.066 |
hsa-miR-21-3p | CTDSPL | 9 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.173; TCGA ESCA -0.141; TCGA HNSC -0.063; TCGA KIRC -0.426; TCGA KIRP -0.168; TCGA LUAD -0.234; TCGA SARC -0.089; TCGA STAD -0.063; TCGA UCEC -0.109 |
hsa-miR-21-3p | PDP2 | 9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; OV; UCEC | MirTarget | TCGA BRCA -0.179; TCGA CESC -0.128; TCGA KIRC -0.523; TCGA KIRP -0.32; TCGA LGG -0.12; TCGA LIHC -0.168; TCGA LUAD -0.084; TCGA OV -0.121; TCGA UCEC -0.077 |
hsa-miR-21-3p | MLC1 | 9 cancers: BRCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; UCEC | MirTarget | TCGA BRCA -0.199; TCGA COAD -0.588; TCGA HNSC -0.3; TCGA LGG -0.173; TCGA LUAD -0.403; TCGA LUSC -0.576; TCGA OV -0.316; TCGA PRAD -0.509; TCGA UCEC -0.224 |
hsa-miR-21-3p | WDR37 | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; THCA | MirTarget | TCGA BRCA -0.106; TCGA CESC -0.072; TCGA ESCA -0.139; TCGA KIRC -0.092; TCGA KIRP -0.096; TCGA LGG -0.093; TCGA LIHC -0.069; TCGA LUAD -0.077; TCGA OV -0.107; TCGA PAAD -0.092; TCGA THCA -0.083 |
hsa-miR-21-3p | TBC1D4 | 9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; OV; THCA; UCEC | MirTarget | TCGA BRCA -0.261; TCGA CESC -0.114; TCGA HNSC -0.202; TCGA KIRC -0.496; TCGA KIRP -0.187; TCGA LUAD -0.162; TCGA OV -0.077; TCGA THCA -0.31; TCGA UCEC -0.259 |
hsa-miR-21-3p | CREBL2 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.205; TCGA CESC -0.114; TCGA COAD -0.121; TCGA ESCA -0.099; TCGA HNSC -0.111; TCGA KIRC -0.055; TCGA KIRP -0.101; TCGA LUAD -0.147; TCGA LUSC -0.13; TCGA PAAD -0.18; TCGA PRAD -0.067; TCGA THCA -0.09; TCGA STAD -0.147; TCGA UCEC -0.152 |
hsa-miR-21-3p | PDPR | 10 cancers: BRCA; CESC; COAD; KIRC; LUAD; OV; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.128; TCGA CESC -0.244; TCGA COAD -0.129; TCGA KIRC -0.129; TCGA LUAD -0.068; TCGA OV -0.132; TCGA SARC -0.161; TCGA THCA -0.129; TCGA STAD -0.12; TCGA UCEC -0.116 |
hsa-miR-21-3p | PITPNM2 | 9 cancers: BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.083; TCGA ESCA -0.146; TCGA LIHC -0.184; TCGA LUAD -0.105; TCGA LUSC -0.118; TCGA PAAD -0.135; TCGA SARC -0.101; TCGA STAD -0.222; TCGA UCEC -0.083 |
hsa-miR-21-3p | ESR1 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.318; TCGA CESC -0.481; TCGA COAD -0.603; TCGA ESCA -0.363; TCGA HNSC -0.208; TCGA KIRC -0.195; TCGA KIRP -0.157; TCGA LIHC -0.314; TCGA LUSC -0.244; TCGA SARC -0.22; TCGA STAD -0.372; TCGA UCEC -0.411 |
hsa-miR-21-3p | STX1B | 9 cancers: BRCA; CESC; ESCA; LGG; LIHC; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.291; TCGA CESC -0.179; TCGA ESCA -0.288; TCGA LGG -0.363; TCGA LIHC -0.159; TCGA LUSC -0.304; TCGA PRAD -0.092; TCGA STAD -0.249; TCGA UCEC -0.161 |
hsa-miR-21-3p | IL17RD | 10 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; OV; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.375; TCGA CESC -0.261; TCGA COAD -0.632; TCGA HNSC -0.335; TCGA KIRC -0.43; TCGA LGG -0.064; TCGA OV -0.263; TCGA SARC -0.489; TCGA STAD -0.505; TCGA UCEC -0.288 |
hsa-miR-21-3p | PYGO1 | 9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; OV; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.212; TCGA CESC -0.377; TCGA HNSC -0.573; TCGA KIRC -0.338; TCGA KIRP -0.413; TCGA OV -0.25; TCGA THCA -0.108; TCGA STAD -0.56; TCGA UCEC -0.375 |
hsa-miR-21-3p | LYNX1 | 12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD | mirMAP | TCGA BRCA -0.287; TCGA COAD -0.723; TCGA ESCA -0.734; TCGA HNSC -0.202; TCGA KIRC -0.404; TCGA KIRP -0.309; TCGA LGG -0.175; TCGA LIHC -0.267; TCGA LUAD -0.179; TCGA PRAD -0.132; TCGA SARC -0.799; TCGA STAD -0.764 |
hsa-miR-21-3p | BACE1 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.095; TCGA CESC -0.106; TCGA COAD -0.291; TCGA ESCA -0.123; TCGA HNSC -0.065; TCGA KIRC -0.05; TCGA KIRP -0.13; TCGA LIHC -0.163; TCGA LUAD -0.106; TCGA PAAD -0.229; TCGA STAD -0.24; TCGA UCEC -0.149 |
hsa-miR-21-3p | ZNF772 | 13 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; OV; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.151; TCGA CESC -0.367; TCGA COAD -0.626; TCGA HNSC -0.197; TCGA KIRC -0.377; TCGA KIRP -0.204; TCGA LIHC -0.26; TCGA OV -0.166; TCGA PAAD -0.166; TCGA SARC -0.114; TCGA THCA -0.141; TCGA STAD -0.274; TCGA UCEC -0.234 |
hsa-miR-21-3p | C17orf51 | 9 cancers: BRCA; KIRC; LGG; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.147; TCGA KIRC -0.135; TCGA LGG -0.091; TCGA OV -0.128; TCGA PAAD -0.265; TCGA PRAD -0.105; TCGA THCA -0.079; TCGA STAD -0.242; TCGA UCEC -0.17 |
hsa-miR-21-3p | SCAMP1 | 9 cancers: CESC; COAD; KIRC; KIRP; LGG; PAAD; SARC; STAD; UCEC | MirTarget | TCGA CESC -0.111; TCGA COAD -0.119; TCGA KIRC -0.094; TCGA KIRP -0.12; TCGA LGG -0.092; TCGA PAAD -0.212; TCGA SARC -0.157; TCGA STAD -0.118; TCGA UCEC -0.135 |
hsa-miR-21-3p | IPCEF1 | 9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; THCA; UCEC | MirTarget | TCGA CESC -0.258; TCGA COAD -0.219; TCGA HNSC -0.308; TCGA KIRC -0.25; TCGA KIRP -0.246; TCGA LGG -0.156; TCGA LUSC -0.308; TCGA THCA -0.491; TCGA UCEC -0.129 |
Enriched cancer pathways of putative targets