microRNA information: hsa-miR-21-5p

SectionIDlink
Mature name: hsa-miR-21-5pmiRbase
Accession: MIMAT0000076miRbase
Precursor name: hsa-mir-21 miRbase
Precursor accession: MI0000077miRbase
Symbol: MIR21HGNC
RefSeq ID: NR_029493GenBank
Sequence: UAGCUUAUCAGACUGAUGUUGA



Reported expression in cancers: hsa-miR-21-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-21-5p

B cell lymphomaupregulation"Clinical significance and detection of microRNA 21 ......"24400911
hsa-miR-21-5p

B cell lymphomaupregulation"Expression and clinical significance of miR 21 in ......"24763002qPCR
hsa-miR-21-5p

bladder cancerupregulation"To investigate a potential alteration in the expre ......"24078506qPCR
hsa-miR-21-5p

breast cancerupregulation"MicroRNA miR 21 overexpression in human breast can ......"18812439Microarray; qPCR
hsa-miR-21-5p

breast cancerupregulation"Clinical significance of miR 21 expression in brea ......"19212625qPCR
hsa-miR-21-5p

breast cancerupregulation"The microRNA-21 gene miR-21 has been reported to b ......"19308091
hsa-miR-21-5p

breast cancerupregulation"A key oncomir in carcinogenesis is miR-21 which is ......"21219636Microarray
hsa-miR-21-5p

breast cancerupregulation"Forty-nine primary triple-negative breast cancer c ......"21270527qPCR
hsa-miR-21-5p

breast cancerupregulation"High expression of miR 21 in tumor stroma correlat ......"21917003in situ hybridization
hsa-miR-21-5p

breast cancerupregulation"To compare the carcinogenic process in tumors with ......"24810926qPCR
hsa-miR-21-5p

breast cancerupregulation"MicroRNA expression profiles have been used for th ......"24930006
hsa-miR-21-5p

breast cancerupregulation"Differential expression of miR 139 miR 486 and miR ......"25027758qPCR; Microarray
hsa-miR-21-5p

breast cancerupregulation"Stem-loop real-time RT-PCR was used to detect the ......"25047098qPCR; in situ hybridization
hsa-miR-21-5p

breast cancerupregulation"Among these we identified miRNAs previously associ ......"25277099
hsa-miR-21-5p

breast cancerupregulation"Stromal expression of miR 21 identifies high risk ......"25440114
hsa-miR-21-5p

breast cancerupregulation"Serum microRNA 21 as a potential diagnostic biomar ......"25516467
hsa-miR-21-5p

breast cancerupregulation"Upregulation of miR-21 microRNA-21 and downregulat ......"25647415
hsa-miR-21-5p

breast cancerupregulation"Circulating miR-21 is upregulated in breast cancer ......"25669446
hsa-miR-21-5p

breast cancerupregulation"Prediction of poor prognosis in breast cancer pati ......"25706383
hsa-miR-21-5p

breast cancerupregulation"In this study we reported that miR-21 was highly e ......"25735723
hsa-miR-21-5p

breast cancerupregulation"MicroRNA-21 miR-21 on chromosome 17q21.3 is one of ......"26342497
hsa-miR-21-5p

breast cancerupregulation"High expression levels of miR 21 and miR 210 predi ......"26349663
hsa-miR-21-5p

breast cancerupregulation"Diagnostic prognostic and predictive value of Micr ......"26396924Reverse transcription PCR
hsa-miR-21-5p

breast cancerupregulation"Advances in Research on miR 21 and Breast Cancer. ......"26486006
hsa-miR-21-5p

breast cancerupregulation"A key oncomir in carcinogenesis is miR-21 which is ......"26549725qPCR
hsa-miR-21-5p

breast cancerupregulation"The function of MiR 21 expression differences and ......"27113307qPCR
hsa-miR-21-5p

breast cancerupregulation"Serum microRNA 21 expression as a prognostic and t ......"27696295qPCR
hsa-miR-21-5p

cervical and endocervical cancerupregulation"Increased exosomal microRNA 21 and microRNA 146a l ......"24406730qPCR
hsa-miR-21-5p

cervical and endocervical cancerupregulation"Although multiple miRNAs are found involved in rad ......"25769949
hsa-miR-21-5p

cervical and endocervical cancerupregulation"Vote-counting analysis showed that up-regulation w ......"25920605
hsa-miR-21-5p

cervical and endocervical cancerupregulation"This study aimed to characterize the miR-21 and ev ......"26261606
hsa-miR-21-5p

cervical and endocervical cancerupregulation"However the underlying mechanism of miR-21 upregul ......"27220494
hsa-miR-21-5p

colon cancerdownregulation"Downregulation of TGFβR2 could be attributed to d ......"22072622
hsa-miR-21-5p

colon cancerdownregulation"Microarray analyses of miRNAs in exosome-enriched ......"24705249Microarray; qPCR
hsa-miR-21-5p

colorectal cancerupregulation"Altered expression of miR 21 miR 31 miR 143 and mi ......"18196926qPCR
hsa-miR-21-5p

colorectal cancerupregulation"Locked nucleic acid in situ hybridization analysis ......"19509156in situ hybridization
hsa-miR-21-5p

colorectal cancerupregulation"Clinicopathological significance of microRNA 21 an ......"19921579qPCR
hsa-miR-21-5p

colorectal cancerupregulation"High levels of microRNA 21 in the stroma of colore ......"21069438in situ hybridization
hsa-miR-21-5p

colorectal cancerupregulation"Expression of target miRs in micro-dissected paraf ......"22120473qPCR
hsa-miR-21-5p

colorectal cancerupregulation"Expression of miR 21 miR 31 miR 96 and miR 135b is ......"22844381qPCR
hsa-miR-21-5p

colorectal cancerupregulation"In this study we show that the expression of miR-2 ......"23174819
hsa-miR-21-5p

colorectal cancerupregulation"Serum miR 21 as a diagnostic and prognostic biomar ......"23704278
hsa-miR-21-5p

colorectal cancerupregulation"Prognostic role of microRNA 21 in colorectal cance ......"24265822
hsa-miR-21-5p

colorectal cancerupregulation"Clinical significance of microRNA 21 as a biomarke ......"25421755Microarray
hsa-miR-21-5p

colorectal cancerupregulation"Diagnostic value of circulating miR 21 for colorec ......"25524942
hsa-miR-21-5p

colorectal cancerupregulation"Stromal expression of miR 21 in T3 4a colorectal c ......"25609245in situ hybridization
hsa-miR-21-5p

colorectal cancerupregulation"Novel evidence for an oncogenic role of microRNA 2 ......"25994220
hsa-miR-21-5p

colorectal cancerupregulation"Investigation of MicroRNA 21 Expression Levels in ......"27432735qPCR
hsa-miR-21-5p

colorectal cancerupregulation"MicroRNA-21 miR-21 is up-regulated in many cancers ......"27495250
hsa-miR-21-5p

endometrial cancerupregulation"MiR-21 has been identified as one of the most comm ......"27655698
hsa-miR-21-5p

esophageal cancerupregulation"MicroRNA 21 regulates the proliferation and invasi ......"19276261in situ hybridization
hsa-miR-21-5p

esophageal cancerupregulation"Clinical impact of serum exosomal microRNA 21 as a ......"23224754qPCR
hsa-miR-21-5p

esophageal cancerupregulation"By Agilent microarray six deregulated miRNAs from ......"23560033Microarray; qPCR
hsa-miR-21-5p

esophageal cancerupregulation"We measured the serum levels of miR-21 miR-145 miR ......"23838916qPCR
hsa-miR-21-5p

esophageal cancerupregulation"miR-21 a putative tumor oncomiR is a frequently ov ......"24221338
hsa-miR-21-5p

esophageal cancerupregulation"We found that there was an overexpression of miR-2 ......"24756761
hsa-miR-21-5p

esophageal cancerupregulation"Plasma levels of miR-16 miR-21 miR-22 miR-126 miR- ......"26221263qPCR
hsa-miR-21-5p

esophageal cancerupregulation"Importantly the high ESCC marked-ZD esophagus had ......"26918602
hsa-miR-21-5p

esophageal cancerupregulation"The present study explored the function of exosome ......"27035745
hsa-miR-21-5p

gastric cancerupregulation"miR 21 microRNA expression in human gastric carcin ......"18507035qPCR
hsa-miR-21-5p

gastric cancerupregulation"The most highly expressed miRNAs in gastric cancer ......"19175831
hsa-miR-21-5p

gastric cancerupregulation"We found that miR-16 and miR-21 were upregulated u ......"21081469
hsa-miR-21-5p

gastric cancerupregulation"In the analysis by real-time PCR-based miRNA array ......"22407237qPCR; Microarray
hsa-miR-21-5p

gastric cancerupregulation"One prominent oncogenic microRNA miR-21 was previo ......"22464652
hsa-miR-21-5p

gastric cancerupregulation"miR 21 Is a Promising Novel Biomarker for Lymph No ......"22792096
hsa-miR-21-5p

gastric cancerupregulation"Prognostic impact of circulating miR 21 in the pla ......"23267156
hsa-miR-21-5p

gastric cancerupregulation"microRNA-21 miR-21 has been implicated in many can ......"23466500
hsa-miR-21-5p

gastric cancerupregulation"Elevated expression of mature miR 21 and miR 155 i ......"23554630
hsa-miR-21-5p

gastric cancerupregulation"We identified five miRNAs that were most consisten ......"24040025qPCR
hsa-miR-21-5p

gastric cancerupregulation"MicroRNA microarray was applied to assess the miRN ......"24054006Microarray
hsa-miR-21-5p

gastric cancerupregulation"Overexpression of miR-21 significantly suppressed ......"24154840
hsa-miR-21-5p

gastric cancerupregulation"MiR-21 is the most consistently reported miRNA wit ......"24337687
hsa-miR-21-5p

gastric cancerupregulation"In the group of consistently reported microRNAs mi ......"24902858
hsa-miR-21-5p

gastric cancerupregulation"Expression Analysis of mir 21 and mir 221 in Cance ......"26209976qPCR
hsa-miR-21-5p

gastric cancerupregulation"MiR 21 5p as a predictor of recurrence in young ga ......"26824898qPCR; Microarray
hsa-miR-21-5p

gastric cancerupregulation"Moreover over-expression of miR-21 significantly d ......"27040946
hsa-miR-21-5p

gastric cancerupregulation"Significance of microRNA 21 in gastric cancer. Rec ......"27179559
hsa-miR-21-5p

glioblastomaupregulation"MiR-21 up-regulation has been reported for the maj ......"18829576
hsa-miR-21-5p

glioblastomaupregulation"In this study we examined the expression levels of ......"20353279qPCR
hsa-miR-21-5p

glioblastomaupregulation"Here we demonstrate for the first time that platel ......"22922228
hsa-miR-21-5p

glioblastomaupregulation"Single-stranded antisense miR-21 inhibitor anti-mi ......"24969623
hsa-miR-21-5p

glioblastomaupregulation"The expression of miRNA-21 was detected by quantit ......"25394756qPCR
hsa-miR-21-5p

head and neck cancerupregulation"Notable was the high expression of miR-21 and miR- ......"17475218Northern blot
hsa-miR-21-5p

head and neck cancerupregulation"In this present study the expression profiles of t ......"22811001qPCR
hsa-miR-21-5p

head and neck cancerupregulation"Our findings showed that significant elevated expr ......"25677760
hsa-miR-21-5p

head and neck cancerupregulation"To explore circulating miRNAs as cancer therapy bi ......"25950115qPCR; Microarray
hsa-miR-21-5p

kidney renal cell cancerupregulation"We selected 28 clear-cell type human renal cell ca ......"20035975qPCR
hsa-miR-21-5p

kidney renal cell cancerupregulation"Up regulation of microRNA 21 correlates with lower ......"22347428qPCR
hsa-miR-21-5p

kidney renal cell cancerupregulation"The clinical utility of miR 21 as a diagnostic and ......"22580180qPCR
hsa-miR-21-5p

kidney renal cell cancerupregulation"MiR-21 expression was significantly upregulated in ......"24902663
hsa-miR-21-5p

kidney renal cell cancerupregulation"To this end we selected four miRNAs miR-21-5p miR- ......"26670229
hsa-miR-21-5p

liver cancerupregulation"We evaluated the expression of miRNA in human hepa ......"17681183Microarray
hsa-miR-21-5p

liver cancerupregulation"For example up-regulation of mir-221 and mir-21 co ......"19120703
hsa-miR-21-5p

liver cancerupregulation"Serum microRNA 21 as marker for necroinflammation ......"22066022
hsa-miR-21-5p

liver cancerupregulation"In the present study we identified the role of mic ......"22322403
hsa-miR-21-5p

liver cancerupregulation"The microarray results were validated by quantitat ......"22977465qPCR; Microarray
hsa-miR-21-5p

liver cancerupregulation"We determined the expression levels of the most fr ......"23229173qPCR
hsa-miR-21-5p

liver cancerupregulation"We observed that oncogenic miR-21 was upregulated ......"25087183
hsa-miR-21-5p

liver cancerupregulation"It has been reported that miR-21 is upregulated in ......"25687183
hsa-miR-21-5p

liver cancerupregulation"Anti miR 21 Suppresses Hepatocellular Carcinoma Gr ......"25758165
hsa-miR-21-5p

liver cancerupregulation"Significance of serum microRNA 21 in diagnosis of ......"25973032
hsa-miR-21-5p

liver cancerupregulation"Increased expression of miR 21 predicts poor progn ......"26261620qPCR
hsa-miR-21-5p

liver cancerupregulation"MicroRNAs miRNAs are reported as a group of small ......"26302751qPCR
hsa-miR-21-5p

liver cancerupregulation"Both miR-21 and miR-183 are upregulated in hepatoc ......"26400524qPCR
hsa-miR-21-5p

lung cancerupregulation"High expression of serum miR 21 and tumor miR 200c ......"21516486Microarray; Reverse transcription PCR; qPCR
hsa-miR-21-5p

lung cancerupregulation"In the panel of consistently reported up-regulated ......"22672859
hsa-miR-21-5p

lung cancerupregulation"Evaluation of dynamic change of serum miR 21 and m ......"22782668Reverse transcription PCR; qPCR
hsa-miR-21-5p

lung cancerupregulation"Detection of lung cancer with blood microRNA 21 ex ......"22866162Reverse transcription PCR; qPCR
hsa-miR-21-5p

lung cancerupregulation"However for each cell subtype we identified miRNAs ......"25344866
hsa-miR-21-5p

lung cancerupregulation"MicroRNA-21 miR-21 is an oncomiR that is frequentl ......"26741162
hsa-miR-21-5p

lung cancerupregulation"Two miRNAs miR-21 and miR-155 were found to be sig ......"26867772
hsa-miR-21-5p

lung squamous cell cancerupregulation"Prognostic value of mature microRNA 21 and microRN ......"18719201qPCR
hsa-miR-21-5p

lung squamous cell cancerupregulation"In our previous study we have shown that expressio ......"22956424qPCR
hsa-miR-21-5p

lung squamous cell cancerupregulation"We further validated our results by RT-qPCR for di ......"23756108qPCR
hsa-miR-21-5p

lung squamous cell cancerupregulation"Expression of microRNA 21 in non small cell lung c ......"24452750Northern blot
hsa-miR-21-5p

lung squamous cell cancerupregulation"Here we analyzed expression of miR-15a/16 miR-21 m ......"25384507
hsa-miR-21-5p

lung squamous cell cancerupregulation"Serum miR 152 miR 148a miR 148b and miR 21 as nove ......"25501703qPCR
hsa-miR-21-5p

lung squamous cell cancerupregulation"MicroRNA 21 regulates non small cell lung cancer c ......"26309536qPCR
hsa-miR-21-5p

lung squamous cell cancerupregulation"Up Regulation of miR 21 Expression Predicate Advan ......"26453197qPCR
hsa-miR-21-5p

lymphomaupregulation"Relevance of miR 21 in HIV and non HIV related lym ......"24961346
hsa-miR-21-5p

lymphomaupregulation"Overexpression of microRNA 21 in peripheral blood ......"26439034
hsa-miR-21-5p

melanomaupregulation"Overexpression of microRNA-21 miR-21 has been obse ......"22716245
hsa-miR-21-5p

melanomaupregulation"Arsenic exposed Keratinocytes Exhibit Differential ......"27054085qPCR
hsa-miR-21-5p

ovarian cancerupregulation"We analyzed the miRNA expression profiles of prima ......"23554878qPCR
hsa-miR-21-5p

ovarian cancerupregulation"Real-time quantitative PCR was used to determine t ......"25744846qPCR
hsa-miR-21-5p

ovarian cancerupregulation"Human epididymis protein 4 expression positively c ......"26733162Microarray
hsa-miR-21-5p

pancreatic cancerupregulation"Whereas the expression of miR-21 a frequently up-r ......"22261338
hsa-miR-21-5p

pancreatic cancerupregulation"Chromatin immunoprecipitation assays were used to ......"23726431
hsa-miR-21-5p

pancreatic cancerupregulation"Four miRNAs miR-17-5p miR-21 miR-155 and miR-196a ......"24007214
hsa-miR-21-5p

pancreatic cancerupregulation"Stromal microRNA 21 levels predict response to 5 f ......"25132574in situ hybridization
hsa-miR-21-5p

pancreatic cancerupregulation"Circulating miR 483 3p and miR 21 is highly expres ......"25384963qPCR
hsa-miR-21-5p

pancreatic cancerupregulation"We identified hsa-miR-21 hsa-miR-23a hsa-miR-23b a ......"26121640
hsa-miR-21-5p

prostate cancerupregulation"The effect of normalization was tested with miR-21 ......"22788411
hsa-miR-21-5p

prostate cancerupregulation"Association of microRNA 21 expression with clinico ......"27040772qPCR; in situ hybridization
hsa-miR-21-5p

prostate cancerupregulation"PBMC were extracted to examine the relative expres ......"27434290
hsa-miR-21-5p

prostate cancerupregulation"miR 15/miR 16 loss miR 21 upregulation or deregula ......"27652312
hsa-miR-21-5p

retinoblastomadownregulation"Seed targeting anti miR 21 inhibiting malignant pr ......"24607444
hsa-miR-21-5p

sarcomaderegulation"MicroRNA expression was profiled in samples of nor ......"21693658Microarray; RNA-Seq
hsa-miR-21-5p

thyroid cancerdownregulation"Antisense miR 21 enhances differentiation/apoptosi ......"26289851



Reported cancer pathway affected by hsa-miR-21-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-21-5p

B cell lymphomaApoptosis pathway"OncomiR addiction in an in vivo model of microRNA ......"20693987
hsa-miR-21-5p

B cell lymphomaPI3K/Akt signaling pathway"MicroRNA 21 regulates the sensitivity of diffuse l ......"23275230Luciferase
hsa-miR-21-5p

B cell lymphomaApoptosis pathway"Inhibition of miR 21 induces biological and behavi ......"23548551Western blot; Luciferase
hsa-miR-21-5p

B cell lymphomaApoptosis pathway"MicroRNA-21 miR-21 is considered to play a key rol ......"25543482Western blot; Luciferase
hsa-miR-21-5p

bladder cancerApoptosis pathway"microRNA 21 modulates cell proliferation and sensi ......"21468550Western blot; Flow cytometry
hsa-miR-21-5p

bladder cancercell cycle pathway"microRNA 21 Regulates Cell Proliferation and Migra ......"26230405
hsa-miR-21-5p

breast cancerApoptosis pathway"Programmed cell death 4 PDCD4 is an important func ......"17991735
hsa-miR-21-5p

breast cancerApoptosis pathway"Hyaluronan CD44 interaction with protein kinase Ce ......"19633292
hsa-miR-21-5p

breast cancercell cycle pathway"33' Diindolylmethane negatively regulates Cdc25A a ......"20724916Western blot
hsa-miR-21-5p

breast cancercell cycle pathway"Up regulation of miR 21 mediates resistance to tra ......"21471222
hsa-miR-21-5p

breast cancerApoptosis pathway"MicroRNA 21 modulates chemosensitivity of breast c ......"21820606MTT assay; Western blot; Flow cytometry; Luciferase
hsa-miR-21-5p

breast cancerEpithelial mesenchymal transition pathway"MiR 21 regulates epithelial mesenchymal transition ......"22435731
hsa-miR-21-5p

breast cancerApoptosis pathway"DNA damage induces NF κB dependent microRNA 21 up ......"22547075
hsa-miR-21-5p

breast cancercell cycle pathway; Apoptosis pathway"Cell viability was analyzed by MTT assay; After MC ......"22832383MTT assay; Flow cytometry; Western blot
hsa-miR-21-5p

breast cancercell cycle pathway"Radiation resistance due to high expression of miR ......"23216894
hsa-miR-21-5p

breast cancerApoptosis pathway"In vivo monitoring of angiogenesis inhibition via ......"23951172Western blot
hsa-miR-21-5p

breast cancerApoptosis pathway"miR 21 targets Fas ligand mediated apoptosis in br ......"24710931Western blot; Luciferase; Flow cytometry
hsa-miR-21-5p

breast cancerApoptosis pathway"High expression of miR 21 in triple negative breas ......"24930006
hsa-miR-21-5p

breast cancerPI3K/Akt signaling pathway"The regulation and function of miR 21 FOXO3a miR 3 ......"25647415
hsa-miR-21-5p

breast cancercell cycle pathway; Apoptosis pathway"MicroRNA-21 miR-21 inhibition is a promising biolo ......"26169933Western blot
hsa-miR-21-5p

breast cancercell cycle pathway; Apoptosis pathway"To investigate the effects of miR-21 on paclitaxel ......"26555418Western blot; Flow cytometry; MTT assay
hsa-miR-21-5p

breast cancerPI3K/Akt signaling pathway"PIK3R1 targeting by miR 21 suppresses tumor cell m ......"26676464Luciferase
hsa-miR-21-5p

breast cancerApoptosis pathway"Kallistatin inhibited oncogenic miR-21 synthesis a ......"26790955
hsa-miR-21-5p

breast cancerApoptosis pathway"Silencing of MicroRNA 21 confers the sensitivity t ......"26796263
hsa-miR-21-5p

breast cancerApoptosis pathway"Deregulation of miR 21 and miR 155 and their putat ......"26877850
hsa-miR-21-5p

breast cancercell cycle pathway"The effect of ZA on cell viability was measured by ......"26905520MTT assay; Flow cytometry; Western blot
hsa-miR-21-5p

breast cancerApoptosis pathway"Silibinin Induced Apoptosis and Downregulation of ......"27066095
hsa-miR-21-5p

cervical and endocervical cancerApoptosis pathway"Long noncoding RNA MEG3 is downregulated in cervic ......"26574780
hsa-miR-21-5p

cervical and endocervical cancerApoptosis pathway"Relevance of miR 21 in regulation of tumor suppres ......"26975392Luciferase
hsa-miR-21-5p

cervical and endocervical cancermTOR signaling pathway"MiR 21 modulates radiosensitivity of cervical canc ......"27220494
hsa-miR-21-5p

colon cancercell cycle pathway; Apoptosis pathway"microRNA 21 negatively regulates Cdc25A and cell c ......"19826040
hsa-miR-21-5p

colon cancercell cycle pathway; Apoptosis pathway"Targeting miR 21 enhances the sensitivity of human ......"24275137Colony formation
hsa-miR-21-5p

colon cancerRas signaling pathway; Apoptosis pathway"To determine how the oncogene miR-21 regulates the ......"25663768Western blot; Luciferase; Flow cytometry; Transwell assay
hsa-miR-21-5p

colon cancerApoptosis pathway"Drug resistance of colon cancer cells to 5 fluorou ......"26418978MTT assay
hsa-miR-21-5p

colorectal cancerApoptosis pathway"miR 21 targets the tumor suppressor RhoB and regul ......"21872591Luciferase
hsa-miR-21-5p

colorectal cancercell cycle pathway; Apoptosis pathway"Clinical correlations of miR 21 expression in colo ......"22476768
hsa-miR-21-5p

colorectal cancerRas signaling pathway"Control of MicroRNA 21 expression in colorectal ca ......"22553926
hsa-miR-21-5p

colorectal cancerPI3K/Akt signaling pathway; cell cycle pathway; Apoptosis pathway"MiR 21 regulates biological behavior through the P ......"23174819Luciferase
hsa-miR-21-5p

colorectal cancerApoptosis pathway"Novel evidence for an oncogenic role of microRNA 2 ......"25994220
hsa-miR-21-5p

esophageal cancerApoptosis pathway"MiR 21 down regulation suppresses cell growth inva ......"23504349Western blot; Luciferase
hsa-miR-21-5p

esophageal cancerApoptosis pathway"MiR 203 suppresses tumor growth and invasion and d ......"24001611
hsa-miR-21-5p

esophageal cancerPI3K/Akt signaling pathway; Apoptosis pathway"A novel chemotherapeutic arene rutheniumII drug Ra ......"24324076MTT assay
hsa-miR-21-5p

esophageal cancerEpithelial mesenchymal transition pathway"Nicotine upregulates microRNA 21 and promotes TGF ......"24756761
hsa-miR-21-5p

esophageal cancerApoptosis pathway"Characterization and effects of miR 21 expression ......"26345812Flow cytometry; Western blot
hsa-miR-21-5p

esophageal cancerPI3K/Akt signaling pathway; Apoptosis pathway; cell cycle pathway"MicroRNA 21 promotes cell proliferation migration ......"27188433Western blot; Flow cytometry; Transwell assay
hsa-miR-21-5p

gastric cancerApoptosis pathway"miR 21 plays a pivotal role in gastric cancer path ......"18794849
hsa-miR-21-5p

gastric cancercell cycle pathway"MicroRNA 21 inhibits Serpini1 a gene with novel tu ......"22464652Western blot; Flow cytometry; Luciferase
hsa-miR-21-5p

gastric cancerApoptosis pathway"miR 21 confers cisplatin resistance in gastric can ......"23466500
hsa-miR-21-5p

gastric cancerApoptosis pathway"Correlations between the expression levels of miR- ......"24154840Western blot
hsa-miR-21-5p

gastric cancerApoptosis pathway"Celastrol induces apoptosis of gastric cancer cell ......"24434352Western blot; Luciferase
hsa-miR-21-5p

gastric cancerApoptosis pathway"MicroRNA 21 stimulates gastric cancer growth and i ......"24659669Western blot
hsa-miR-21-5p

gastric cancercell cycle pathway; mTOR signaling pathway"Celastrol induces cell cycle arrest by MicroRNA 21 ......"26500453Flow cytometry; Western blot
hsa-miR-21-5p

gastric cancerApoptosis pathway"miR 21 inhibits the effects of cyclooxygenase 2 in ......"26604791Western blot; Wound Healing Assay
hsa-miR-21-5p

gastric cancerApoptosis pathway"The present study aimed to investigate the role of ......"27040946
hsa-miR-21-5p

gastric cancerApoptosis pathway; cell cycle pathway"Significance of microRNA 21 in gastric cancer; Rec ......"27179559
hsa-miR-21-5p

gastric cancerEpithelial mesenchymal transition pathway; PI3K/Akt signaling pathway"MicroRNA 21 promotes TGF β1 induced epithelial me ......"27611950Western blot
hsa-miR-21-5p

glioblastomaApoptosis pathway"MicroRNA 21 is an antiapoptotic factor in human gl ......"16024602
hsa-miR-21-5p

glioblastomaApoptosis pathway; cell cycle pathway"MicroRNA 21 targets a network of key tumor suppres ......"18829576
hsa-miR-21-5p

glioblastomaApoptosis pathway"MicroRNA 21 down regulates the expression of tumor ......"19013014Luciferase
hsa-miR-21-5p

glioblastomacell cycle pathway; Apoptosis pathway"Downregulation of miR 21 inhibits EGFR pathway and ......"20048743
hsa-miR-21-5p

glioblastomaApoptosis pathway; cell cycle pathway"MicroRNA 21 inhibitor sensitizes human glioblastom ......"20113523MTT assay; Flow cytometry; Western blot
hsa-miR-21-5p

glioblastomaApoptosis pathway"MiR 21 protected human glioblastoma U87MG cells fr ......"20633539
hsa-miR-21-5p

glioblastomaApoptosis pathway"A miR 21 inhibitor enhances apoptosis and reduces ......"21618027
hsa-miR-21-5p

glioblastomaApoptosis pathway"Downregulation of Pdcd4 by mir 21 facilitates glio ......"21636706Colony formation
hsa-miR-21-5p

glioblastomaApoptosis pathway"Cell survival apoptosis and molecular targets were ......"22353043
hsa-miR-21-5p

glioblastomaApoptosis pathway"MicroRNA 21 inhibitor sensitizes human glioblastom ......"22528454
hsa-miR-21-5p

glioblastomacell cycle pathway; Apoptosis pathway"MiR 21 modulates hTERT through a STAT3 dependent m ......"22709411MTT assay; Luciferase
hsa-miR-21-5p

glioblastomaEpithelial mesenchymal transition pathway; Apoptosis pathway"NPV LDE 225 Erismodegib inhibits epithelial mesenc ......"23482671Luciferase; Western blot
hsa-miR-21-5p

glioblastomacell cycle pathway; Apoptosis pathway"MiR 21 mediates the radiation resistance of gliobl ......"23904372Flow cytometry; Western blot
hsa-miR-21-5p

glioblastomaPI3K/Akt signaling pathway"It is largely unknown whether the blockade of miR- ......"24012640
hsa-miR-21-5p

glioblastomaApoptosis pathway"MiR 21 up regulation mediates glioblastoma cancer ......"25394756Flow cytometry; Western blot; Luciferase; RNAi
hsa-miR-21-5p

glioblastomaApoptosis pathway"Delivery of anti microRNA 21 antisense oligodeoxyn ......"25572456Luciferase
hsa-miR-21-5p

glioblastomaApoptosis pathway"Sulforaphane enhances temozolomide induced apoptos ......"25991372
hsa-miR-21-5p

glioblastomacell cycle pathway; Apoptosis pathway"Downregulation of microRNA-21 miR-21 especially in ......"26142886
hsa-miR-21-5p

glioblastomacell cycle pathway"Nanoparticle Delivered Antisense MicroRNA 21 Enhan ......"26559642
hsa-miR-21-5p

glioblastomaApoptosis pathway"Anti cancer effect of R3V6 peptide mediated delive ......"27355932
hsa-miR-21-5p

glioblastomacell cycle pathway"MicroRNA-21 miR-21 and microRNA-10b miR-10b are on ......"27508339
hsa-miR-21-5p

head and neck cancerApoptosis pathway"An initial screening of 4 primary HNSCC 4 normal m ......"18798260Flow cytometry
hsa-miR-21-5p

head and neck cancercell cycle pathway"A global miRNA profiling was done on 51 formalin-f ......"20145181Flow cytometry
hsa-miR-21-5p

head and neck cancerEpithelial mesenchymal transition pathway"miR-21 miR-31 miR-504 and miR-10b are important on ......"23340306
hsa-miR-21-5p

kidney renal cell cancerApoptosis pathway"miR 21 modulates cell apoptosis by targeting multi ......"21820586Western blot; Luciferase
hsa-miR-21-5p

kidney renal cell cancercell cycle pathway; Apoptosis pathway"MicroRNA 21 is overexpressed in renal cell carcino ......"23558936Flow cytometry; MTT assay; Western blot
hsa-miR-21-5p

liver cancercell cycle pathway"For example up-regulation of mir-221 and mir-21 co ......"19120703
hsa-miR-21-5p

liver cancerPI3K/Akt signaling pathway; cell cycle pathway; Apoptosis pathway"MicroRNA 21 acts as an oncomir through multiple ta ......"20447717
hsa-miR-21-5p

liver cancercell cycle pathway; Apoptosis pathway"miRNAs are small non-coding RNAs which target comp ......"24496037
hsa-miR-21-5p

liver cancercell cycle pathway"MicroRNA 21 promotes cell proliferation in human h ......"25687183Western blot; Luciferase
hsa-miR-21-5p

liver cancerRas signaling pathway"Effects of VEGF/VEGFR/K ras signaling pathways on ......"25730004
hsa-miR-21-5p

liver cancerApoptosis pathway"Furthermore miR-21 was increased by BA in D/C-trea ......"26222667
hsa-miR-21-5p

liver cancercell cycle pathway"MicroRNA 21 is a potential link between non alcoho ......"26282675Colony formation
hsa-miR-21-5p

liver cancerApoptosis pathway"MiR 21 and miR 183 can simultaneously target SOCS6 ......"26400524Western blot; Luciferase
hsa-miR-21-5p

liver cancerApoptosis pathway"Degradation of miR 21 induces apoptosis and inhibi ......"26427512
hsa-miR-21-5p

lung cancerApoptosis pathway"MiR 21 is an EGFR regulated anti apoptotic factor ......"19597153
hsa-miR-21-5p

lung cancerApoptosis pathway"Modulation of K Ras dependent lung tumorigenesis b ......"20832755
hsa-miR-21-5p

lung cancerApoptosis pathway"Glossy ganoderma spore oil promotes apoptosis of h ......"21842656Flow cytometry
hsa-miR-21-5p

lung cancerWnt signaling pathway; cell cycle pathway; Apoptosis pathway; PPAR signaling pathway; MAPK signaling pathway"A systematic analysis of predicted miR 21 targets ......"22244963
hsa-miR-21-5p

lung cancercell cycle pathway"miR 21 induces cell cycle at S phase and modulates ......"22806311Luciferase; Western blot; Flow cytometry; MTT assay
hsa-miR-21-5p

lung cancercell cycle pathway; Apoptosis pathway; PI3K/Akt signaling pathway"Effect of microRNA 21 on multidrug resistance reve ......"25323306
hsa-miR-21-5p

lung cancercell cycle pathway; Apoptosis pathway"The effect and mechanism of microRNA 21 on cis dic ......"27266356Flow cytometry; Western blot
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway"Overexpression of miR 21 promotes proliferation an ......"22335905Western blot; Luciferase; Flow cytometry
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway"MiR 21 suppresses the anticancer activities of cur ......"24293118MTT assay; Western blot
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway"MiR 21 overexpression is associated with acquired ......"24331411RNAi; Western blot
hsa-miR-21-5p

lung squamous cell cancercell cycle pathway"Expression of microRNA 21 in non small cell lung c ......"24452750
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway; PI3K/Akt signaling pathway"Silencing miR 21 sensitizes non small cell lung ca ......"24804226Western blot; Flow cytometry; MTT assay
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway"Downregulation of microRNA 21 expression restrains ......"25477028Western blot
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway"MicroRNA 21 regulates non small cell lung cancer c ......"26309536Western blot; Flow cytometry; MTT assay
hsa-miR-21-5p

lung squamous cell cancerApoptosis pathway"Triptolide reduces proliferation and enhances apop ......"26847601
hsa-miR-21-5p

lymphomaApoptosis pathway"A subset of these miRNAs was associated with outco ......"23725219
hsa-miR-21-5p

lymphomaApoptosis pathway"Aberrant expression of oncogenic miRNAs including ......"24479800
hsa-miR-21-5p

lymphomaApoptosis pathway; cell cycle pathway"Relevance of miR 21 in HIV and non HIV related lym ......"24961346
hsa-miR-21-5p

melanomaApoptosis pathway"MicroRNA miR 21 regulates the metastatic behavior ......"21940630
hsa-miR-21-5p

melanomaApoptosis pathway"The status of microRNA 21 expression and its clini ......"22130252
hsa-miR-21-5p

melanomaApoptosis pathway"microRNA 21 is upregulated in malignant melanoma a ......"22716245
hsa-miR-21-5p

melanomaApoptosis pathway"Increased miR-21 expression has been observed duri ......"26116372
hsa-miR-21-5p

ovarian cancerApoptosis pathway"The inhibition of miR 21 promotes apoptosis and ch ......"24472409Western blot
hsa-miR-21-5p

ovarian cancerApoptosis pathway"Icariin regulates the proliferation and apoptosis ......"25845681MTT assay; Flow cytometry; Western blot
hsa-miR-21-5p

pancreatic cancercell cycle pathway; Apoptosis pathway"Cell cycle distribution and apoptosis were examine ......"19112422Flow cytometry
hsa-miR-21-5p

pancreatic cancercell cycle pathway; Apoptosis pathway"Antisense inhibition of microRNA 21 or 221 arrests ......"19730150
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"MicroRNA 21 in pancreatic cancer: correlation with ......"20460539
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"Bcl 2 upregulation induced by miR 21 via a direct ......"21376256Luciferase
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"The serum miR 21 level serves as a predictor for t ......"23177026
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"Resveratrol induces apoptosis of pancreatic cancer ......"23359184MTT assay; Western blot
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"Targeting miR 21 for the therapy of pancreatic can ......"23481326
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"Chemosensitivity induced by down regulation of mic ......"23564788
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"Hypoxia induces the overexpression of microRNA 21 ......"23726431Flow cytometry
hsa-miR-21-5p

pancreatic cancerApoptosis pathway"MiR 21 upregulation induced by promoter zone histo ......"24460329
hsa-miR-21-5p

pancreatic cancerPI3K/Akt signaling pathway"The purpose of this study was to investigate the i ......"25846727MTT assay; Western blot; Luciferase
hsa-miR-21-5p

prostate cancerApoptosis pathway"MicroRNA 21 directly targets MARCKS and promotes a ......"19302977
hsa-miR-21-5p

prostate cancerApoptosis pathway"Interestingly NVP-LDE-225 induced PDCD4 and apopto ......"23567619
hsa-miR-21-5p

retinoblastomacell cycle pathway"Seed targeting anti miR 21 inhibiting malignant pr ......"24607444Flow cytometry; Colony formation
hsa-miR-21-5p

sarcomaNA"Aberrant expression of microRNAs miRNAs including ......"19906824
hsa-miR-21-5p

thyroid cancerApoptosis pathway; cell cycle pathway"Antisense miR 21 enhances differentiation/apoptosi ......"26289851Flow cytometry



Reported cancer prognosis affected by hsa-miR-21-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-21-5p

B cell lymphomamalignant trasformation"Using microarray analysis on prototypic cell lines ......"17487835
hsa-miR-21-5p

B cell lymphomapoor survival"We therefore investigated whether microRNAs also h ......"18318758
hsa-miR-21-5p

B cell lymphomapoor survival"Finally eight miRNAs were found to correlate with ......"18537969
hsa-miR-21-5p

B cell lymphomamalignant trasformation"OncomiR addiction in an in vivo model of microRNA ......"20693987
hsa-miR-21-5p

B cell lymphomaworse prognosis; staging; poor survival"Clinical significance and detection of microRNA 21 ......"24400911
hsa-miR-21-5p

B cell lymphomastaging; worse prognosis"Expression and clinical significance of miR 21 in ......"24763002
hsa-miR-21-5p

B cell lymphomapoor survival"Differential expression of miR 155 and miR 21 in t ......"25265435
hsa-miR-21-5p

B cell lymphomamalignant trasformation"In this review we discuss miRNAs with essential fu ......"25541152
hsa-miR-21-5p

B cell lymphomatumorigenesis"MicroRNA-21 miR-21 is considered to play a key rol ......"25543482Western blot; Luciferase
hsa-miR-21-5p

B cell lymphomaprogression; poor survival"MicroRNA 21 plays an oncogenic role by targeting F ......"25909227
hsa-miR-21-5p

acute myeloid leukemiametastasis; tumorigenesis; recurrence; differentiation"miR 21 is overexpressed in NPM1 mutant acute myelo ......"25543261
hsa-miR-21-5p

bladder cancertumorigenesis; drug resistance"microRNA 21 modulates cell proliferation and sensi ......"21468550Western blot; Flow cytometry
hsa-miR-21-5p

bladder cancerpoor survival; recurrence"High miR-21 expression correlated with worse overa ......"22704449
hsa-miR-21-5p

bladder cancerpoor survival"miR-21 and miR-205 were over expressed in high gra ......"22999546
hsa-miR-21-5p

bladder cancerpoor survival"We identified an eight-miRNA signature including t ......"25991007
hsa-miR-21-5p

bladder cancerdrug resistance"microRNA 21 Regulates Cell Proliferation and Migra ......"26230405
hsa-miR-21-5p

bladder cancerstaging; metastasis; worse prognosis; progression"Expression and clinical significance of microRNA 2 ......"26622898
hsa-miR-21-5p

breast cancermalignant trasformation"To obtain insight into miRNA deregulation in breas ......"18089790
hsa-miR-21-5p

breast cancermalignant trasformation"Real-time quantitative PCR RQ-PCR is a sensitive a ......"18718003
hsa-miR-21-5p

breast cancerstaging; metastasis; worse prognosis; poor survival; progression"MicroRNA miR 21 overexpression in human breast can ......"18812439
hsa-miR-21-5p

breast cancerstaging; poor survival; metastasis; progression; worse prognosis"High miR 21 expression in breast cancer associated ......"18932017
hsa-miR-21-5p

breast cancermalignant trasformation; staging"Clinical significance of miR 21 expression in brea ......"19212625
hsa-miR-21-5p

breast cancertumorigenesis"Identification of miR 21 targets in breast cancer ......"19253296Luciferase
hsa-miR-21-5p

breast cancerprogression; metastasis"BMP 6 inhibits microRNA 21 expression in breast ca ......"19308091Luciferase
hsa-miR-21-5p

breast cancerdrug resistance"Hyaluronan CD44 interaction with protein kinase Ce ......"19633292
hsa-miR-21-5p

breast cancerdrug resistance"Downregulation of miR 21 enhances chemotherapeutic ......"20082533
hsa-miR-21-5p

breast cancertumorigenesis; metastasis"MicroRNA 21 regulates breast cancer invasion partl ......"20346171Western blot; Luciferase
hsa-miR-21-5p

breast cancerstaging; metastasis"Direct serum assay for microRNA 21 concentrations ......"21036945
hsa-miR-21-5p

breast cancerstaging; poor survival; metastasis"For example miR-21 is overexpressed in both male a ......"21059829
hsa-miR-21-5p

breast cancermotility"Induction of miR 21 by retinoic acid in estrogen r ......"21131358
hsa-miR-21-5p

breast cancertumorigenesis; malignant trasformation; progression"Knockdown of miR 21 in human breast cancer cell li ......"21219636Western blot; Luciferase
hsa-miR-21-5p

breast cancerpoor survival"Forty-nine primary triple-negative breast cancer c ......"21270527
hsa-miR-21-5p

breast cancerrecurrence; poor survival; worse prognosis"MicroRNA microarray analysis was performed to comp ......"21271219
hsa-miR-21-5p

breast cancerworse prognosis; progression; metastasis"miR 21 Expression in Pregnancy Associated Breast C ......"21326627
hsa-miR-21-5p

breast cancerdrug resistance"Up regulation of miR 21 mediates resistance to tra ......"21471222
hsa-miR-21-5p

breast cancerdrug resistance"MicroRNA 21 modulates chemosensitivity of breast c ......"21820606MTT assay; Western blot; Flow cytometry; Luciferase
hsa-miR-21-5p

breast cancerworse prognosis"High expression of miR 21 in tumor stroma correlat ......"21917003
hsa-miR-21-5p

breast cancermalignant trasformation"Through immunohistochemistry analyses of tissue mi ......"22086602
hsa-miR-21-5p

breast cancermalignant trasformation"The relative concentrations of four circulating mi ......"22350790
hsa-miR-21-5p

breast cancerdrug resistance"Expression levels of miR-210 miR-21 miR-29a and mi ......"22370716
hsa-miR-21-5p

breast cancermetastasis; cell migration"MiR 21 regulates epithelial mesenchymal transition ......"22435731
hsa-miR-21-5p

breast cancermetastasis"Real Time RT-PCR was performed to identify the miR ......"22524830
hsa-miR-21-5p

breast cancermetastasis; drug resistance"DNA damage induces NF κB dependent microRNA 21 up ......"22547075
hsa-miR-21-5p

breast cancermetastasis"miR 21 is targeted by omega 3 polyunsaturated fatt ......"22678116
hsa-miR-21-5p

breast cancertumor size"Circulating microRNA 92a and microRNA 21 as novel ......"23052693
hsa-miR-21-5p

breast cancerdrug resistance; progression; metastasis; poor survival"Radiation resistance due to high expression of miR ......"23216894
hsa-miR-21-5p

breast cancerstaging; poor survival; tumor size; metastasis"MicroRNA 21 as an indicator of aggressive phenotyp ......"23485999
hsa-miR-21-5p

breast cancerprogression; drug resistance"Here we find that nucleolin NCL a major nucleolar ......"23610125
hsa-miR-21-5p

breast cancermetastasis"The anti metastatic activity of collagenase 2 in b ......"23851508
hsa-miR-21-5p

breast cancermetastasis; tumorigenesis"Genetic heterogeneity of breast cancer metastasis ......"23936642Western blot
hsa-miR-21-5p

breast cancermetastasis"In vivo monitoring of angiogenesis inhibition via ......"23951172Western blot
hsa-miR-21-5p

breast cancermalignant trasformation"Here we identified 33 miRNAs with similar deregula ......"24104550
hsa-miR-21-5p

breast cancerworse prognosis"MicroRNA 21 in breast cancer: diagnostic and progn ......"24248894
hsa-miR-21-5p

breast cancertumorigenesis; staging"Clinical significance of serum miR 21 in breast ca ......"24385703
hsa-miR-21-5p

breast cancermetastasis; malignant trasformation"The overexpression of miR-21 miR-10b and miR-19a i ......"24416156
hsa-miR-21-5p

breast cancermetastasis"The difference in miR 21 expression levels between ......"24488617
hsa-miR-21-5p

breast cancerdrug resistance; progression; poor survival"Hyaluronan CD44 interaction promotes c Jun signali ......"24606718
hsa-miR-21-5p

breast cancertumor size; drug resistance"Higher miR 21 expression in invasive breast carcin ......"24781337
hsa-miR-21-5p

breast cancerworse prognosis"High expression of miR 21 in triple negative breas ......"24930006
hsa-miR-21-5p

breast cancertumor size"The aim of the present study was to assess the eff ......"25009660
hsa-miR-21-5p

breast cancermetastasis"Differential expression of miR 139 miR 486 and miR ......"25027758
hsa-miR-21-5p

breast cancermetastasis; tumor size"Stem-loop real-time RT-PCR was used to detect the ......"25047098
hsa-miR-21-5p

breast cancerpoor survival"Changes in serum levels of miR 21 miR 210 and miR ......"25086636
hsa-miR-21-5p

breast cancerdrug resistance"miR 21 Expression in Cancer Cells may Not Predict ......"25177545
hsa-miR-21-5p

breast cancermetastasis; motility; worse prognosis"Among these we identified miRNAs previously associ ......"25277099
hsa-miR-21-5p

breast cancerpoor survival; metastasis"Prognostic and clinicopathological significance of ......"25337203
hsa-miR-21-5p

breast cancermetastasis"The objective of the present study is to evaluate ......"25369070
hsa-miR-21-5p

breast cancerrecurrence; poor survival"Stromal expression of miR 21 identifies high risk ......"25440114
hsa-miR-21-5p

breast cancerworse prognosis; poor survival"Prediction of poor prognosis in breast cancer pati ......"25706383
hsa-miR-21-5p

breast cancermetastasis; worse prognosis; poor survival; recurrence"Quantitative measurement of serum microRNA 21 expr ......"25729725
hsa-miR-21-5p

breast cancerdrug resistance"Formulation of Anti miR 21 and 4 Hydroxytamoxifen ......"25880495MTT assay
hsa-miR-21-5p

breast cancerstaging; metastasis"Pilot Study of Serum MicroRNA 21 as a Diagnostic a ......"26063582
hsa-miR-21-5p

breast cancercell migration"DNA microarray and real-time PCR analyses further ......"26098771
hsa-miR-21-5p

breast cancerdrug resistance"New miRNA-based drugs are also promising therapy f ......"26199650
hsa-miR-21-5p

breast cancermetastasis"Stat3 regulates ErbB 2 expression and co opts ErbB ......"26212010
hsa-miR-21-5p

breast cancerstaging"MicroRNA 21 Expression in Primary Breast Cancer Ti ......"26342497Fluorescent in situ hybridization
hsa-miR-21-5p

breast cancerpoor survival"High expression levels of miR 21 and miR 210 predi ......"26349663
hsa-miR-21-5p

breast cancermetastasis; progression"In particular miR-21 an oncogenic miRNA is a major ......"26387848
hsa-miR-21-5p

breast cancerstaging"Diagnostic prognostic and predictive value of Micr ......"26396924
hsa-miR-21-5p

breast cancermalignant trasformation; worse prognosis"In order to obtain insight into miRNA de-regulatio ......"26408705
hsa-miR-21-5p

breast cancerdrug resistance"MicroRNA 21 links epithelial to mesenchymal transi ......"26452030
hsa-miR-21-5p

breast cancerstaging"Advances in Research on miR 21 and Breast Cancer; ......"26486006
hsa-miR-21-5p

breast cancertumorigenesis; drug resistance"A key oncomir in carcinogenesis is miR-21 which is ......"26549725Colony formation; Western blot
hsa-miR-21-5p

breast cancerdrug resistance"To investigate the effects of miR-21 on paclitaxel ......"26555418Western blot; Flow cytometry; MTT assay
hsa-miR-21-5p

breast cancerdrug resistance"Prior studies suggest that miRNAs are important to ......"26666820
hsa-miR-21-5p

breast cancercell migration; worse prognosis"PIK3R1 targeting by miR 21 suppresses tumor cell m ......"26676464Luciferase
hsa-miR-21-5p

breast cancermetastasis; motility"Moreover miR-21 a well-documented oncogenic miRNA ......"26769851
hsa-miR-21-5p

breast cancerprogression"Kallistatin inhibited oncogenic miR-21 synthesis a ......"26790955
hsa-miR-21-5p

breast cancerprogression; metastasis; worse prognosis"miR 21 Might be Involved in Breast Cancer Promotio ......"26891730
hsa-miR-21-5p

breast cancermetastasis"The function of MiR 21 expression differences and ......"27113307
hsa-miR-21-5p

breast cancermetastasis"We evaluated the expression levels of miR-21 miR-1 ......"27197674
hsa-miR-21-5p

breast cancerstaging"We report for the first time an extremely high pre ......"27404381
hsa-miR-21-5p

breast cancerrecurrence"We identified seven miRNAs that were differentiall ......"27409424
hsa-miR-21-5p

breast cancermetastasis"The connection of miR 21 and miR 155 with regulati ......"27420617
hsa-miR-21-5p

breast cancerprogression"We identified eight microRNAs miR-10a miR-10b miR- ......"27433802
hsa-miR-21-5p

breast cancerpoor survival"In this multicenter study a 10-miRNA classifier in ......"27566954
hsa-miR-21-5p

breast cancerstaging"We employed qRT-PCR to determine expression level ......"27596294
hsa-miR-21-5p

breast cancerprogression; poor survival; metastasis; worse prognosis"Prognostic value of circulating microRNA 21 for br ......"27684463
hsa-miR-21-5p

breast cancerworse prognosis; drug resistance"Serum microRNA 21 expression as a prognostic and t ......"27696295
hsa-miR-21-5p

cervical and endocervical cancerdrug resistance"miR 21 modulates resistance of HR HPV positive cer ......"25769949Luciferase; Colony formation
hsa-miR-21-5p

cervical and endocervical cancermalignant trasformation; progression"Overexpression of miR 21 promotes the proliferatio ......"25963606
hsa-miR-21-5p

cervical and endocervical cancermetastasis; progression; worse prognosis"This study aimed to characterize the miR-21 and ev ......"26261606
hsa-miR-21-5p

cervical and endocervical cancerstaging; metastasis; tumor size"Long noncoding RNA MEG3 is downregulated in cervic ......"26574780
hsa-miR-21-5p

cervical and endocervical cancermetastasis"Regulator role of HPV E7 protein on miR 21 express ......"26884851Western blot
hsa-miR-21-5p

cervical and endocervical cancerdrug resistance; poor survival"Relevance of miR 21 in regulation of tumor suppres ......"26975392Luciferase
hsa-miR-21-5p

cervical and endocervical cancermetastasis; cell migration"Circulating MicroRNA 21 Is Involved in Lymph Node ......"27101583
hsa-miR-21-5p

colon cancerstaging; poor survival"MicroRNA microarray expression profiling of tumors ......"18230780
hsa-miR-21-5p

colon cancerstaging; worse prognosis"This study examines the potential clinical utility ......"19737943
hsa-miR-21-5p

colon cancerprogression; tumorigenesis"microRNA 21 negatively regulates Cdc25A and cell c ......"19826040
hsa-miR-21-5p

colon cancermetastasis"This short review will focus on our recent finding ......"19836969
hsa-miR-21-5p

colon cancermotility; metastasis"miR 21 and miR 31 converge on TIAM1 to regulate mi ......"20826792Transwell assay
hsa-miR-21-5p

colon cancerstaging; poor survival; drug resistance"Deregulated expression of sprouty2 and microRNA 21 ......"21099344
hsa-miR-21-5p

colon cancertumorigenesis; staging"We performed microarray analysis of mRNA expressio ......"21806946Colony formation
hsa-miR-21-5p

colon cancertumorigenesis"MicroRNA 21 mediated regulation of Sprouty2 protei ......"22322462
hsa-miR-21-5p

colon cancerdrug resistance"The expressions of microRNAs were profiled with a ......"22382630RNA Immunoprecipitation; RNA immunoprecipitation
hsa-miR-21-5p

colon cancermetastasis"miR 21 miR 17 and miR 19a induced by phosphatase o ......"22677902RNAi
hsa-miR-21-5p

colon cancerstaging; poor survival; recurrence"The prognostic importance of miR 21 in stage II co ......"23011541
hsa-miR-21-5p

colon cancertumorigenesis"In particular miR-21 is an oncogenic miRNA that ha ......"23207927
hsa-miR-21-5p

colon cancerdifferentiation"Down regulation of miR 21 Induces Differentiation ......"23544170
hsa-miR-21-5p

colon cancerstaging"To present proof-of-principle application for empl ......"23741026
hsa-miR-21-5p

colon cancermetastasis"Difluorinated curcumin CDF restores PTEN expressio ......"23894315
hsa-miR-21-5p

colon cancerpoor survival; drug resistance; worse prognosis; staging"High miR 21 expression from FFPE tissues is associ ......"24122631
hsa-miR-21-5p

colon cancerstaging"Using miRNA microarrays we analysed 40 paired stag ......"24239208
hsa-miR-21-5p

colon cancerdrug resistance"Targeting miR 21 enhances the sensitivity of human ......"24275137Colony formation
hsa-miR-21-5p

colon cancerstaging"Microarray analyses of miRNAs in exosome-enriched ......"24705249
hsa-miR-21-5p

colon cancerrecurrence"RNA microarray and TaqMan Array analysis were perf ......"24921248
hsa-miR-21-5p

colon cancerstaging"The aim of the present study was to analyse the pr ......"25051407
hsa-miR-21-5p

colon cancerpoor survival"Differential MIR 21 expression in plasma from mese ......"25569638
hsa-miR-21-5p

colon cancermalignant trasformation"To determine how the oncogene miR-21 regulates the ......"25663768Western blot; Luciferase; Flow cytometry; Transwell assay
hsa-miR-21-5p

colon cancerprogression; differentiation; drug resistance"miR 21 and miR 145 cooperation in regulation of co ......"25928322Western blot
hsa-miR-21-5p

colon cancerworse prognosis"Antisense oligonucleotides against microRNA 21 red ......"26236156Colony formation; Cell migration assay; Western blot
hsa-miR-21-5p

colon cancerdrug resistance"Drug resistance of colon cancer cells to 5 fluorou ......"26418978MTT assay
hsa-miR-21-5p

colon cancerstaging"The aim of this study was to examine the expressio ......"26465597
hsa-miR-21-5p

colon cancerrecurrence"Serum expression levels of miR 17 miR 21 and miR 9 ......"26781797
hsa-miR-21-5p

colon cancerstaging"Six miRNAs previously identified as prognostic mar ......"27247088
hsa-miR-21-5p

colorectal cancermetastasis"MicroRNA 21 miR 21 post transcriptionally downregu ......"17968323Luciferase
hsa-miR-21-5p

colorectal cancermetastasis; staging"Altered expression of miR 21 miR 31 miR 143 and mi ......"18196926
hsa-miR-21-5p

colorectal cancerstaging; tumorigenesis; malignant trasformation"Locked nucleic acid in situ hybridization analysis ......"19509156
hsa-miR-21-5p

colorectal cancerstaging; progression"Clinicopathological significance of microRNA 21 an ......"19921579
hsa-miR-21-5p

colorectal cancermetastasis"Relevance of miR 21 and miR 143 expression in tiss ......"20620599
hsa-miR-21-5p

colorectal cancermetastasis; progression"Curcumin regulates miR 21 expression and inhibits ......"20815812
hsa-miR-21-5p

colorectal cancerstaging; poor survival"High levels of microRNA 21 in the stroma of colore ......"21069438
hsa-miR-21-5p

colorectal cancerstaging; metastasis; poor survival; worse prognosis"Clinicopathological and prognostic value of microR ......"21412018
hsa-miR-21-5p

colorectal cancerprogression; recurrence"MicroRNA 21 and PDCD4 expression in colorectal can ......"21546206
hsa-miR-21-5p

colorectal cancerstaging"Detection of miR 92a and miR 21 in stool samples a ......"21930727
hsa-miR-21-5p

colorectal cancerprogression"miR 21 functionally interacts with the 3'UTR of ch ......"22099878Luciferase
hsa-miR-21-5p

colorectal cancermetastasis; progression; staging"Expression of target miRs in micro-dissected paraf ......"22120473
hsa-miR-21-5p

colorectal cancerstaging"Prognostic significance of PDCD4 expression and as ......"22267128
hsa-miR-21-5p

colorectal cancerdrug resistance; staging; differentiation"The expression of microRNA-21 miR-21 was determine ......"22289545
hsa-miR-21-5p

colorectal cancerstaging; poor survival; cell migration"Clinical correlations of miR 21 expression in colo ......"22476768
hsa-miR-21-5p

colorectal cancerstaging; metastasis; progression"Expression of miR 21 miR 31 miR 96 and miR 135b is ......"22844381
hsa-miR-21-5p

colorectal cancerstaging; metastasis; differentiation; progression"MiR 21 regulates biological behavior through the P ......"23174819Luciferase
hsa-miR-21-5p

colorectal cancerworse prognosis; staging"Serum miR 21 and miR 92a as biomarkers in the diag ......"23625654
hsa-miR-21-5p

colorectal cancerstaging"Genome-wide microarray analysis of miRNA expressio ......"23673725
hsa-miR-21-5p

colorectal cancermetastasis; poor survival; tumor size; worse prognosis"Serum miR 21 as a diagnostic and prognostic biomar ......"23704278
hsa-miR-21-5p

colorectal cancerstaging; worse prognosis"TaqMan quantitative real-time PCR was used to quan ......"23719259
hsa-miR-21-5p

colorectal cancerstaging; poor survival"The prognostic significance of APC gene mutation a ......"23773491
hsa-miR-21-5p

colorectal cancerprogression; staging; malignant trasformation; differentiation"Pleiotropic actions of miR 21 highlight the critic ......"23788041
hsa-miR-21-5p

colorectal cancerpoor survival; recurrence; worse prognosis"Prognostic implications of serum microRNA 21 in co ......"23970420
hsa-miR-21-5p

colorectal cancermetastasis"Epigenetic regulation of miR 21 in colorectal canc ......"24149370
hsa-miR-21-5p

colorectal cancerstaging; poor survival; worse prognosis"Prognostic role of microRNA 21 in colorectal cance ......"24265822
hsa-miR-21-5p

colorectal cancermetastasis; staging"Differential expression of serum miR 126 miR 141 a ......"24653631
hsa-miR-21-5p

colorectal cancerstaging"Correlation of over expressions of miR 21 and Notc ......"24780321Western blot
hsa-miR-21-5p

colorectal cancerworse prognosis; poor survival"MicroRNA 21 promotes tumour malignancy via increas ......"24832083
hsa-miR-21-5p

colorectal cancerstaging"Elevated level of microRNA 21 in the serum of pati ......"25178939
hsa-miR-21-5p

colorectal cancerworse prognosis; poor survival"Diagnostic and prognostic value of microRNA 21 in ......"25178983
hsa-miR-21-5p

colorectal cancerprogression; staging"Inflammation and MiR 21 pathways functionally inte ......"25310697
hsa-miR-21-5p

colorectal cancerstaging; progression; metastasis; poor survival; worse prognosis"Clinical significance of microRNA 21 as a biomarke ......"25421755
hsa-miR-21-5p

colorectal cancerprogression; staging; metastasis; poor survival; recurrence"Stromal expression of miR 21 in T3 4a colorectal c ......"25609245
hsa-miR-21-5p

colorectal cancermetastasis"Emerging role of microRNA 21 in colorectal cancer; ......"25769454
hsa-miR-21-5p

colorectal cancermalignant trasformation; staging; poor survival"Notably deregulation of the key oncogene miR-21 wa ......"25788261
hsa-miR-21-5p

colorectal cancerimmune resistance"MicroRNA MIR21 and T Cells in Colorectal Cancer; E ......"26419959
hsa-miR-21-5p

colorectal cancerpoor survival; drug resistance; progression"MicroRNA MIR21 miR 21 and PTGS2 Expression in Colo ......"26957558
hsa-miR-21-5p

colorectal cancerstaging; worse prognosis"Serological under expression of microRNA 21 microR ......"27142899
hsa-miR-21-5p

colorectal cancerpoor survival; recurrence; worse prognosis"Tissue microRNA 21 expression predicted recurrence ......"27226723
hsa-miR-21-5p

colorectal cancerstaging; metastasis; worse prognosis"Stromal Expression of MicroRNA 21 in Advanced Colo ......"27240857
hsa-miR-21-5p

colorectal cancerstaging"Plasma Expression Levels of Circulating miR 21 are ......"27349026
hsa-miR-21-5p

colorectal cancerstaging; metastasis"Investigation of MicroRNA 21 Expression Levels in ......"27432735
hsa-miR-21-5p

colorectal cancermetastasis"Investigating intra tumor heterogeneity and expres ......"27565378
hsa-miR-21-5p

endometrial cancerstaging"Highly increased maspin expression corresponds wit ......"21330826
hsa-miR-21-5p

esophageal cancermetastasis"MicroRNA 21 regulates the proliferation and invasi ......"19276261Luciferase
hsa-miR-21-5p

esophageal cancermetastasis; staging"The expression of miR-21 miR-106a miR-148a miR-205 ......"20628822
hsa-miR-21-5p

esophageal cancerpoor survival"Using 98 formalin-fixed paraffin-embedded samples ......"21248297
hsa-miR-21-5p

esophageal cancerstaging"MicroRNA 21 induces cell proliferation and invasio ......"21475818
hsa-miR-21-5p

esophageal cancerrecurrence"We selected three oncogenic miRNAs miR-21 miR-184 ......"21673684
hsa-miR-21-5p

esophageal cancerpoor survival; worse prognosis"Prognostic impact of circulating miR 21 and miR 37 ......"22519435
hsa-miR-21-5p

esophageal cancermetastasis; staging; differentiation; worse prognosis"Serum miR 21 expression in human esophageal squamo ......"22799367
hsa-miR-21-5p

esophageal cancerdrug resistance"Inhibition of microRNA 21 increases radiosensitivi ......"22958183Western blot
hsa-miR-21-5p

esophageal cancerstaging; metastasis; poor survival; recurrence; worse prognosis; drug resistance"There are several microRNAs that have been consist ......"23092342
hsa-miR-21-5p

esophageal cancerpoor survival"The expression levels of miR-21 p = 0.027 miR-181b ......"23175214
hsa-miR-21-5p

esophageal cancerstaging; metastasis; progression"Clinical impact of serum exosomal microRNA 21 as a ......"23224754
hsa-miR-21-5p

esophageal cancerstaging; metastasis; differentiation"To identify whether saliva supernatant miR-21 can ......"23464420
hsa-miR-21-5p

esophageal cancermalignant trasformation"MiR 21 down regulation suppresses cell growth inva ......"23504349Western blot; Luciferase
hsa-miR-21-5p

esophageal cancermetastasis; differentiation"Among these miRNAs that displayed unique miRNA exp ......"23516093
hsa-miR-21-5p

esophageal cancerprogression; worse prognosis; poor survival"We measured the serum levels of miR-21 miR-145 miR ......"23838916
hsa-miR-21-5p

esophageal cancermalignant trasformation; cell migration"Expression tissue distribution and function of miR ......"24039846
hsa-miR-21-5p

esophageal cancerprogression; staging; metastasis"Down regulation of PTEN expression modulated by dy ......"24221338Western blot
hsa-miR-21-5p

esophageal cancerworse prognosis; poor survival"The expression of miR 21 and miR 375 predict progn ......"24680681
hsa-miR-21-5p

esophageal cancerstaging"Diagnostic values of salivary versus and plasma mi ......"24968850
hsa-miR-21-5p

esophageal cancerrecurrence"Pooled hazard ratios of miR-21 and miR-375 for OS ......"25097879
hsa-miR-21-5p

esophageal cancermalignant trasformation"MicroRNA 21 promotes cell growth and migration by ......"25400316Luciferase
hsa-miR-21-5p

esophageal cancerworse prognosis"Association of miR 21 with esophageal cancer progn ......"26125864
hsa-miR-21-5p

esophageal cancerprogression; poor survival"Plasma levels of miR-16 miR-21 miR-22 miR-126 miR- ......"26221263
hsa-miR-21-5p

esophageal cancerstaging; metastasis"Characterization and effects of miR 21 expression ......"26345812Flow cytometry; Western blot
hsa-miR-21-5p

esophageal cancerpoor survival"Evaluation of miR 21 and miR 375 as prognostic bio ......"26481465
hsa-miR-21-5p

esophageal cancercell migration; progression; metastasis; recurrence; worse prognosis"Exosome shuttling microRNA 21 promotes cell migrat ......"27035745
hsa-miR-21-5p

esophageal cancerdrug resistance; cell migration"MicroRNA 21 promotes cell proliferation migration ......"27188433Western blot; Flow cytometry; Transwell assay
hsa-miR-21-5p

esophageal cancerrecurrence; worse prognosis"Differential expression of miR 21 and miR 75 in es ......"27508050
hsa-miR-21-5p

esophageal cancerdrug resistance"Circulating miR 21 as an independent predictive bi ......"27508093
hsa-miR-21-5p

gastric cancertumorigenesis; worse prognosis"miR 21 microRNA expression in human gastric carcin ......"18507035
hsa-miR-21-5p

gastric cancerprogression"miR 21 plays a pivotal role in gastric cancer path ......"18794849
hsa-miR-21-5p

gastric cancerpoor survival"Several microarray studies have reported microRNA ......"19951901
hsa-miR-21-5p

gastric cancermetastasis"Differential expression of miRNAs was studied usin ......"20726036
hsa-miR-21-5p

gastric cancerpoor survival; staging; drug resistance"Prognostic significance of miR 181b and miR 21 in ......"21876743
hsa-miR-21-5p

gastric cancerprogression; metastasis; differentiation; cell migration"microRNA 21 promotes tumor proliferation and invas ......"22267008Wound Healing Assay; Western blot; Luciferase
hsa-miR-21-5p

gastric cancerdifferentiation"CSC characteristics were checked using spheroid fo ......"22374783Colony formation
hsa-miR-21-5p

gastric cancertumorigenesis; staging; metastasis; tumor size"MicroRNA 21 is a new marker of circulating tumor c ......"22430134
hsa-miR-21-5p

gastric cancermetastasis; poor survival; staging"miR 21 Is a Promising Novel Biomarker for Lymph No ......"22792096
hsa-miR-21-5p

gastric cancermetastasis; tumorigenesis; staging"Plasma microRNAs miR 223 miR 21 and miR 218 as nov ......"22860003
hsa-miR-21-5p

gastric cancerpoor survival"Prognostic impact of circulating miR 21 in the pla ......"23267156
hsa-miR-21-5p

gastric cancerdrug resistance; poor survival"miR 21 confers cisplatin resistance in gastric can ......"23466500
hsa-miR-21-5p

gastric cancermetastasis; staging"In a pilot study serum levels of miR-21 miR-27a mi ......"23806809
hsa-miR-21-5p

gastric cancertumorigenesis; staging; metastasis; differentiation"Oxidative stress upregulates PDCD4 expression in p ......"23888942
hsa-miR-21-5p

gastric cancerdrug resistance"Correlations between the expression levels of miR- ......"24154840Western blot
hsa-miR-21-5p

gastric cancerworse prognosis; tumor size; poor survival; staging"Serum microRNA 21 levels are related to tumor size ......"24260069
hsa-miR-21-5p

gastric cancerworse prognosis; metastasis; differentiation"Plasma post operative miR 21 expression in the pro ......"24460332
hsa-miR-21-5p

gastric cancerprogression"MicroRNA 21 stimulates gastric cancer growth and i ......"24659669Western blot
hsa-miR-21-5p

gastric cancertumorigenesis; progression; malignant trasformation"miR 21 regulates N methyl N nitro N' nitrosoguanid ......"24821435
hsa-miR-21-5p

gastric cancerprogression; staging; metastasis"Stromal miR 21 is more important than miR 21 of tu ......"25041158
hsa-miR-21-5p

gastric cancerpoor survival; staging; metastasis; differentiation"Prognostic role of microRNA 21 in gastric cancer: ......"25230738
hsa-miR-21-5p

gastric cancerstaging"Circulating MicroRNA 21 Is a Potential Diagnostic ......"26063956
hsa-miR-21-5p

gastric cancerrecurrence"Expression of exosomal miRNAs was evaluated with A ......"26208314
hsa-miR-21-5p

gastric cancerpoor survival; worse prognosis"Hsa miR 21 and Hsa miR 29 in Tissue as Potential D ......"26509997
hsa-miR-21-5p

gastric cancerstaging; drug resistance"Two stage cyclic enzymatic amplification method fo ......"26720919
hsa-miR-21-5p

gastric cancerrecurrence"MiR 21 5p as a predictor of recurrence in young ga ......"26824898
hsa-miR-21-5p

gastric cancerdrug resistance"The present study aimed to investigate the role of ......"27040946
hsa-miR-21-5p

gastric cancerprogression"Significance of microRNA 21 in gastric cancer; Rec ......"27179559
hsa-miR-21-5p

gastric cancerdrug resistance"Mel 18 negatively regulates stem cell like propert ......"27542229
hsa-miR-21-5p

gastric cancercell migration"MicroRNA 21 promotes TGF β1 induced epithelial me ......"27611950Western blot
hsa-miR-21-5p

glioblastomamalignant trasformation"MicroRNA 21 is an antiapoptotic factor in human gl ......"16024602
hsa-miR-21-5p

glioblastomadrug resistance"MicroRNA 21 targets LRRFIP1 and contributes to VM ......"19559015
hsa-miR-21-5p

glioblastomaprogression; malignant trasformation"Downregulation of miR 21 inhibits EGFR pathway and ......"20048743
hsa-miR-21-5p

glioblastomadrug resistance"MiR 21 protected human glioblastoma U87MG cells fr ......"20633539
hsa-miR-21-5p

glioblastomadrug resistance"A miR 21 inhibitor enhances apoptosis and reduces ......"21618027
hsa-miR-21-5p

glioblastomatumorigenesis"Downregulation of Pdcd4 by mir 21 facilitates glio ......"21636706Colony formation
hsa-miR-21-5p

glioblastomaprogression; poor survival"MiR 195 miR 196b miR 181c miR 21 expression levels ......"21895872
hsa-miR-21-5p

glioblastomapoor survival"Cell survival apoptosis and molecular targets were ......"22353043
hsa-miR-21-5p

glioblastomametastasis"We determined CSF levels of several cancer-associa ......"22492962
hsa-miR-21-5p

glioblastomarecurrence"MicroRNA 21 inhibitor sensitizes human glioblastom ......"22528454
hsa-miR-21-5p

glioblastomatumorigenesis"MiR 21 modulates hTERT through a STAT3 dependent m ......"22709411MTT assay; Luciferase
hsa-miR-21-5p

glioblastomadrug resistance"MicroRNA 21 inhibition enhances in vitro chemosens ......"22753745
hsa-miR-21-5p

glioblastomarecurrence"Plasma MicroRNA 21 concentration may be a useful b ......"22891879
hsa-miR-21-5p

glioblastomaprogression"Here we demonstrate for the first time that platel ......"22922228
hsa-miR-21-5p

glioblastomadrug resistance"Silencing of miR 21 by locked nucleic acid lipid n ......"23732394
hsa-miR-21-5p

glioblastomadrug resistance"MiR 21 mediates the radiation resistance of gliobl ......"23904372Flow cytometry; Western blot
hsa-miR-21-5p

glioblastomaprogression"It is largely unknown whether the blockade of miR- ......"24012640
hsa-miR-21-5p

glioblastomadifferentiation"Using this in vitro system a microarray-based high ......"24155920
hsa-miR-21-5p

glioblastomatumorigenesis; poor survival"MicroRNA 21 promotes glioblastoma tumorigenesis by ......"25059666
hsa-miR-21-5p

glioblastomatumor size"Delivery of anti microRNA 21 antisense oligodeoxyn ......"25572456Luciferase
hsa-miR-21-5p

glioblastomadrug resistance; poor survival"Modulation of miR 21 signaling by MPS1 in human gl ......"25991676
hsa-miR-21-5p

glioblastomadrug resistance"Downregulation of microRNA-21 miR-21 especially in ......"26142886
hsa-miR-21-5p

glioblastomaworse prognosis; staging"Mir 21 Sox2 Axis Delineates Glioblastoma Subtypes ......"26558781
hsa-miR-21-5p

head and neck cancerpoor survival"In this study miRNA expression profiles of head an ......"19179615
hsa-miR-21-5p

head and neck cancerstaging; poor survival"Here we used quantitative real-time polymerase cha ......"19901002
hsa-miR-21-5p

head and neck cancerstaging; differentiation; tumor size"Three hypoxia-related microRNAs hsa-miR-210 hsa-mi ......"20187102
hsa-miR-21-5p

head and neck cancerdrug resistance; progression; poor survival"Stem cell marker Nanog and Stat 3 signaling promot ......"21685938
hsa-miR-21-5p

head and neck cancerworse prognosis"In this present study the expression profiles of t ......"22811001
hsa-miR-21-5p

head and neck cancerpoor survival; worse prognosis"Our findings showed that significant elevated expr ......"25677760
hsa-miR-21-5p

head and neck cancerprogression; metastasis"Abnormal activation of STAT3 and miR-21 plays a vi ......"26690371
hsa-miR-21-5p

kidney renal cell cancerpoor survival"miR 21 modulates cell apoptosis by targeting multi ......"21820586Western blot; Luciferase
hsa-miR-21-5p

kidney renal cell cancerpoor survival; staging"Up regulation of microRNA 21 correlates with lower ......"22347428Western blot
hsa-miR-21-5p

kidney renal cell cancerstaging; poor survival"The clinical utility of miR 21 as a diagnostic and ......"22580180
hsa-miR-21-5p

kidney renal cell cancerprogression"MicroRNA 21 is overexpressed in renal cell carcino ......"23558936Flow cytometry; MTT assay; Western blot
hsa-miR-21-5p

kidney renal cell cancerpoor survival; worse prognosis"Combination of expression levels of miR 21 and miR ......"24428907
hsa-miR-21-5p

kidney renal cell cancermetastasis"MicroRNA 21 miR 21 post transcriptionally downregu ......"24902663Western blot; Luciferase; Colony formation
hsa-miR-21-5p

kidney renal cell cancerpoor survival"Impact of miR 21 miR 126 and miR 221 as prognostic ......"25279769
hsa-miR-21-5p

kidney renal cell cancerpoor survival"Using vote-counting strategy and robust rank aggre ......"25974855
hsa-miR-21-5p

kidney renal cell cancerworse prognosis; poor survival"We found that elevated expression of miR-21 miR-12 ......"26416448
hsa-miR-21-5p

kidney renal cell cancertumorigenesis"To this end we selected four miRNAs miR-21-5p miR- ......"26670229
hsa-miR-21-5p

kidney renal cell cancerworse prognosis; progression; poor survival"SATB1 is Down regulated in Clear Cell Renal Cell C ......"27107063
hsa-miR-21-5p

liver cancercell migration"MicroRNA 21 regulates expression of the PTEN tumor ......"17681183
hsa-miR-21-5p

liver cancermalignant trasformation"Our study identified and validated miR-224 overexp ......"18433021
hsa-miR-21-5p

liver cancermalignant trasformation"Elevated expression of the miR 17 92 polycistron a ......"18688024
hsa-miR-21-5p

liver cancerprogression"For example up-regulation of mir-221 and mir-21 co ......"19120703
hsa-miR-21-5p

liver cancertumorigenesis"MicroRNA 21 acts as an oncomir through multiple ta ......"20447717
hsa-miR-21-5p

liver cancerdrug resistance; poor survival"MicroRNA 21 induces resistance to the anti tumour ......"20978511
hsa-miR-21-5p

liver cancerrecurrence"Sequencing and bioinformatics based analyses of th ......"21283620
hsa-miR-21-5p

liver cancermetastasis; tumorigenesis; recurrence"We examined expression patterns of 4 microRNAs mic ......"21458843
hsa-miR-21-5p

liver cancermalignant trasformation; staging"Serum microRNA 21 as marker for necroinflammation ......"22066022
hsa-miR-21-5p

liver cancerstaging; worse prognosis"Expression of microRNAs miR 21 miR 31 miR 122 miR ......"22213236
hsa-miR-21-5p

liver cancercell migration"miR 21 promotes migration and invasion by the miR ......"22322403
hsa-miR-21-5p

liver cancerprogression"MicroRNA 21 suppresses PTEN and hSulf 1 expression ......"23684551
hsa-miR-21-5p

liver cancercell migration"MicroRNA 21 regulates the migration and invasion o ......"23708209
hsa-miR-21-5p

liver cancertumorigenesis"MicroRNA 21 promotes hepatocellular carcinoma HepG ......"24112539Luciferase; MTT assay
hsa-miR-21-5p

liver cancercell migration"miRNAs are small non-coding RNAs which target comp ......"24496037
hsa-miR-21-5p

liver cancertumor size; recurrence"Expression of serum miR 16 let 7f and miR 21 in pa ......"24697119
hsa-miR-21-5p

liver cancerstaging"Expression of serum exosomal microRNA 21 in human ......"24963487
hsa-miR-21-5p

liver cancertumorigenesis"Hepatitis B virus X protein promotes hepatocellula ......"25087183Colony formation
hsa-miR-21-5p

liver cancerworse prognosis; poor survival"miR 21 expression predicts prognosis in hepatocell ......"25150373
hsa-miR-21-5p

liver cancerpoor survival"Eleven miRNAs miR- miR-19a miR-101-3p miR-199a-5p ......"25275448
hsa-miR-21-5p

liver cancerdrug resistance"Indole 3 carbinol inhibits tumorigenicity of hepat ......"25447674
hsa-miR-21-5p

liver cancerpoor survival; recurrence"Here we investigated the correlation between micro ......"25544773
hsa-miR-21-5p

liver cancerprogression; tumorigenesis"MicroRNA 21 promotes cell proliferation in human h ......"25687183Western blot; Luciferase
hsa-miR-21-5p

liver cancerprogression; metastasis"High Mobility Group Box 1 Promotes Hepatocellular ......"25720799
hsa-miR-21-5p

liver cancerworse prognosis"Effects of VEGF/VEGFR/K ras signaling pathways on ......"25730004
hsa-miR-21-5p

liver cancercell migration"Anti miR 21 Suppresses Hepatocellular Carcinoma Gr ......"25758165
hsa-miR-21-5p

liver cancerdrug resistance"Dehydroepiandrosterone Activation of G protein cou ......"25969534
hsa-miR-21-5p

liver cancerstaging; worse prognosis"Significance of serum microRNA 21 in diagnosis of ......"25973032
hsa-miR-21-5p

liver cancerstaging"Potential Role of Circulating microRNA 21 for Hepa ......"26114756
hsa-miR-21-5p

liver cancerprogression"MiR 21 promoted proliferation and migration in hep ......"26210448
hsa-miR-21-5p

liver cancerpoor survival"Moreover we further validated the confirmed miRNAs ......"26231037
hsa-miR-21-5p

liver cancerworse prognosis; staging; differentiation; poor survival; progression"Increased expression of miR 21 predicts poor progn ......"26261620
hsa-miR-21-5p

liver cancertumorigenesis; progression"MicroRNA 21 is a potential link between non alcoho ......"26282675Colony formation
hsa-miR-21-5p

liver cancermalignant trasformation; progression"MicroRNAs miRNAs are reported as a group of small ......"26302751RNAi
hsa-miR-21-5p

liver cancerdrug resistance"MiR 21 mediates sorafenib resistance of hepatocell ......"26311740
hsa-miR-21-5p

liver cancerpoor survival; cell migration"Long noncoding RNA GAS5 suppresses the migration a ......"26404135
hsa-miR-21-5p

liver cancermalignant trasformation"Using gene expression microarrays and high-through ......"26646011
hsa-miR-21-5p

lung cancertumorigenesis"MiR 21 is an EGFR regulated anti apoptotic factor ......"19597153
hsa-miR-21-5p

lung cancertumorigenesis; poor survival"Modulation of K Ras dependent lung tumorigenesis b ......"20832755
hsa-miR-21-5p

lung cancerpoor survival; staging; progression; tumorigenesis"The expression of miR-21 miR-17 and miR-155 was me ......"21350005
hsa-miR-21-5p

lung cancerworse prognosis; staging; metastasis; poor survival"High expression of serum miR 21 and tumor miR 200c ......"21516486
hsa-miR-21-5p

lung cancermalignant trasformation"In the training set miR-21 and miR-210 display hig ......"21864403
hsa-miR-21-5p

lung cancermalignant trasformation; progression"A systematic analysis of predicted miR 21 targets ......"22244963
hsa-miR-21-5p

lung cancerstaging; poor survival; recurrence"Evaluation of dynamic change of serum miR 21 and m ......"22782668
hsa-miR-21-5p

lung cancerdifferentiation"The rBM 3-D culture-specific miRNA profile was hig ......"23036707
hsa-miR-21-5p

lung cancermalignant trasformation"Using quantitative reverse transcriptase PCR analy ......"23462458
hsa-miR-21-5p

lung cancerdrug resistance; tumorigenesis"Effect of microRNA 21 on multidrug resistance reve ......"25323306
hsa-miR-21-5p

lung cancerworse prognosis"However for each cell subtype we identified miRNAs ......"25344866
hsa-miR-21-5p

lung cancermetastasis; differentiation"Inhibition of NADPH oxidase protects against metas ......"25563770
hsa-miR-21-5p

lung cancerdrug resistance"Abnormal Expression of miR 21 and miR 95 in Cancer ......"25831148
hsa-miR-21-5p

lung cancerdrug resistance"This resistance is associated with the increase in ......"26080425
hsa-miR-21-5p

lung cancerstaging"Genome-wide screening of DNA methylation and pyros ......"26134223
hsa-miR-21-5p

lung cancerpoor survival"MicroRNA-21 miR-21 is an oncomiR that is frequentl ......"26741162
hsa-miR-21-5p

lung cancerpoor survival"Tissues were microdissected to obtain >90% tumor o ......"27081085
hsa-miR-21-5p

lung cancerworse prognosis"In this study the miRNAs were detected in normal a ......"27247934
hsa-miR-21-5p

lung cancerdrug resistance"The effect and mechanism of microRNA 21 on cis dic ......"27266356Flow cytometry; Western blot
hsa-miR-21-5p

lung squamous cell cancerpoor survival"Prognostic value of mature microRNA 21 and microRN ......"18719201
hsa-miR-21-5p

lung squamous cell cancerprogression; staging; metastasis"MicroRNA 21 miR 21 represses tumor suppressor PTEN ......"20223231Western blot; Luciferase
hsa-miR-21-5p

lung squamous cell cancerworse prognosis; staging; poor survival"Deregulated expression of miR 21 miR 143 and miR 1 ......"20363096
hsa-miR-21-5p

lung squamous cell cancerworse prognosis; poor survival"MiR 21 overexpression in human primary squamous ce ......"20508945
hsa-miR-21-5p

lung squamous cell cancerstaging; recurrence"In an exploratory study we determined whether expr ......"20975375
hsa-miR-21-5p

lung squamous cell cancerpoor survival"Expression of miR-21 miR-29b miR-34a/b/c miR-155 a ......"20978195
hsa-miR-21-5p

lung squamous cell cancerstaging; metastasis"Identification of plasma microRNA 21 as a biomarke ......"21627863
hsa-miR-21-5p

lung squamous cell cancerworse prognosis; staging; metastasis; poor survival"The aim of this study was to investigate miR-21 ex ......"21721011
hsa-miR-21-5p

lung squamous cell cancerdrug resistance; poor survival"Increased miR-21 expression significantly increase ......"22237007
hsa-miR-21-5p

lung squamous cell cancermetastasis"The miRs were quantified by microarray hybridizati ......"22295063
hsa-miR-21-5p

lung squamous cell cancerpoor survival"Prognostic role of microRNA 21 in non small cell l ......"22901216
hsa-miR-21-5p

lung squamous cell cancermetastasis; drug resistance; staging"MicroRNA 21 miR 21 expression promotes growth meta