microRNA information: hsa-miR-210-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-210-3p | miRbase |
Accession: | MIMAT0000267 | miRbase |
Precursor name: | hsa-mir-210 | miRbase |
Precursor accession: | MI0000286 | miRbase |
Symbol: | MIR210 | HGNC |
RefSeq ID: | NR_029623 | GenBank |
Sequence: | CUGUGCGUGUGACAGCGGCUGA |
Reported expression in cancers: hsa-miR-210-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-210-3p | acute myeloid leukemia | upregulation | "Overexpression of miR 210 is Associated with Poor ......" | 26549593 | qPCR |
hsa-miR-210-3p | bladder cancer | upregulation | "Serum miR 210 Contributes to Tumor Detection Stage ......" | 26252880 | |
hsa-miR-210-3p | breast cancer | upregulation | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | qPCR |
hsa-miR-210-3p | breast cancer | upregulation | "High expression of miR 210 predicts poor survival ......" | 22842193 | |
hsa-miR-210-3p | breast cancer | upregulation | "High expression levels of miR 21 and miR 210 predi ......" | 26349663 | |
hsa-miR-210-3p | colon cancer | upregulation | "We were able to show that low oxygen concentration ......" | 27589845 | |
hsa-miR-210-3p | colon cancer | upregulation | "MiR-210 is frequently up-regulated in colorectal c ......" | 27611932 | |
hsa-miR-210-3p | colorectal cancer | upregulation | "Hypoxia inducible MiR 210 is an independent progno ......" | 24632577 | |
hsa-miR-210-3p | endometrial cancer | deregulation | "In endometrial cancer cells expression levels of m ......" | 26535032 | |
hsa-miR-210-3p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
hsa-miR-210-3p | gastric cancer | upregulation | "We performed miRNA microarray and quantitative rev ......" | 23385731 | Reverse transcription PCR; Microarray; qPCR |
hsa-miR-210-3p | gastric cancer | upregulation | "A total of 33 miRNAs were identified through the i ......" | 26059512 | Reverse transcription PCR; qPCR |
hsa-miR-210-3p | glioblastoma | deregulation | "Hypoxic signature of microRNAs in glioblastoma: in ......" | 25129238 | RNA-Seq |
hsa-miR-210-3p | kidney renal cell cancer | upregulation | "We selected 28 clear-cell type human renal cell ca ......" | 20035975 | qPCR |
hsa-miR-210-3p | kidney renal cell cancer | upregulation | "Seven candidate microRNAs were selected for verifi ......" | 21984948 | qPCR; Microarray |
hsa-miR-210-3p | kidney renal cell cancer | upregulation | "MiR 210 expression in tumor tissue and in vitro ef ......" | 23150176 | |
hsa-miR-210-3p | kidney renal cell cancer | upregulation | "Serum miR 210 as a potential biomarker of early cl ......" | 24212760 | Microarray; qPCR |
hsa-miR-210-3p | kidney renal cell cancer | upregulation | "To this end we selected four miRNAs miR-21-5p miR- ......" | 26670229 | |
hsa-miR-210-3p | liver cancer | upregulation | "MicroRNA 210 promotes cancer angiogenesis by targe ......" | 27666683 | |
hsa-miR-210-3p | lung cancer | upregulation | "In the panel of consistently reported up-regulated ......" | 22672859 | |
hsa-miR-210-3p | lung squamous cell cancer | upregulation | "Prognostic significance of serum microRNA 210 leve ......" | 24065453 | Reverse transcription PCR; qPCR |
hsa-miR-210-3p | lung squamous cell cancer | upregulation | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
hsa-miR-210-3p | lymphoma | deregulation | "In addition we derived an 11-miRNA signature 4 upr ......" | 23801630 | |
hsa-miR-210-3p | melanoma | deregulation | "We determined the expression level of 16 potential ......" | 19830692 | qPCR |
hsa-miR-210-3p | ovarian cancer | upregulation | "Hypoxia induced miR 210 in epithelial ovarian canc ......" | 24715221 | |
hsa-miR-210-3p | pancreatic cancer | upregulation | "PSCs-induced miR-210 upregulation was inhibited by ......" | 23831622 | |
hsa-miR-210-3p | prostate cancer | downregulation | "Among them 10 paired HGPIN and PCa were prepared t ......" | 27017949 | qPCR; Microarray |
hsa-miR-210-3p | sarcoma | upregulation | "MicroRNA-210 miR-210 plays important roles in the ......" | 23430441 | |
hsa-miR-210-3p | sarcoma | upregulation | "Hypoxic conditions were verified and miRNA express ......" | 24927770 | Microarray; qPCR |
Reported cancer pathway affected by hsa-miR-210-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-210-3p | bladder cancer | Apoptosis pathway | "Synthetic miRNA mowers targeting miR 183 96 182 cl ......" | 23284967 | Luciferase; Flow cytometry; MTT assay |
hsa-miR-210-3p | bladder cancer | Apoptosis pathway | "Bladder cancer cell lines were exposed to normoxic ......" | 26196183 | Flow cytometry |
hsa-miR-210-3p | breast cancer | cell cycle pathway; VEGF signaling pathway | "Supervised analysis in the initial subset and subs ......" | 18755890 | |
hsa-miR-210-3p | breast cancer | cell cycle pathway | "MicroRNA 210 interacts with FBXO31 to regulate can ......" | 27601917 | Luciferase |
hsa-miR-210-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "These include hsa-miR-138 hsa-miR-210 and hsa-miR- ......" | 23012319 | |
hsa-miR-210-3p | colon cancer | Epithelial mesenchymal transition pathway | "Exosomes secreted from human colon cancer cells in ......" | 27611932 | |
hsa-miR-210-3p | colorectal cancer | Apoptosis pathway; cell cycle pathway | "MicroRNA 210 induces apoptosis in colorectal cance ......" | 27293381 | |
hsa-miR-210-3p | esophageal cancer | cell cycle pathway | "MiR 210 expression reverses radioresistance of ste ......" | 25493243 | Flow cytometry; Western blot |
hsa-miR-210-3p | kidney renal cell cancer | Apoptosis pathway | "Genome wide microRNA expression analysis of clear ......" | 22745662 | |
hsa-miR-210-3p | kidney renal cell cancer | cell cycle pathway; Apoptosis pathway | "MiR 210 expression in tumor tissue and in vitro ef ......" | 23150176 | Cell migration assay |
hsa-miR-210-3p | ovarian cancer | cell cycle pathway | "miR 210 links hypoxia with cell cycle regulation a ......" | 18059191 | |
hsa-miR-210-3p | ovarian cancer | Apoptosis pathway | "Hypoxia induced miR 210 in epithelial ovarian canc ......" | 24715221 | |
hsa-miR-210-3p | ovarian cancer | Epithelial mesenchymal transition pathway | "miR 210 a modulator of hypoxia induced epithelial ......" | 25932166 | |
hsa-miR-210-3p | sarcoma | Apoptosis pathway | "Prognostic evaluation of microRNA 210 expression i ......" | 23430441 | |
hsa-miR-210-3p | sarcoma | Apoptosis pathway | "Downregulation of microRNA 210 inhibits osteosarco ......" | 26044868 | Colony formation |
Reported cancer prognosis affected by hsa-miR-210-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-210-3p | acute myeloid leukemia | worse prognosis; poor survival | "Overexpression of miR 210 is Associated with Poor ......" | 26549593 | |
hsa-miR-210-3p | bladder cancer | staging | "Serum miR 210 Contributes to Tumor Detection Stage ......" | 26252880 | |
hsa-miR-210-3p | breast cancer | poor survival | "hsa miR 210 Is induced by hypoxia and is an indepe ......" | 18316553 | |
hsa-miR-210-3p | breast cancer | progression | "Supervised analysis in the initial subset and subs ......" | 18755890 | |
hsa-miR-210-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
hsa-miR-210-3p | breast cancer | differentiation; progression | "Global microRNA expression profiling identifies Mi ......" | 21738599 | |
hsa-miR-210-3p | breast cancer | worse prognosis; progression | "Breast cancer signatures for invasiveness and prog ......" | 22315424 | |
hsa-miR-210-3p | breast cancer | worse prognosis; poor survival | "High expression of microRNA 210 is an independent ......" | 22323552 | |
hsa-miR-210-3p | breast cancer | drug resistance; metastasis | "Plasma microRNA 210 levels correlate with sensitiv ......" | 22370716 | |
hsa-miR-210-3p | breast cancer | poor survival; staging | "High expression of miR 210 predicts poor survival ......" | 22842193 | |
hsa-miR-210-3p | breast cancer | staging; metastasis | "None of the investigated single miRNAs or miRNA cl ......" | 24196612 | |
hsa-miR-210-3p | breast cancer | metastasis; poor survival; recurrence | "microRNA 210 as a prognostic factor in patients wi ......" | 24595085 | |
hsa-miR-210-3p | breast cancer | poor survival; motility | "Module-2 miRs miR-125a; miR-193; miR-210 increase ......" | 25961594 | |
hsa-miR-210-3p | breast cancer | poor survival | "High expression levels of miR 21 and miR 210 predi ......" | 26349663 | |
hsa-miR-210-3p | breast cancer | drug resistance | "The few available studies investigating microRNA i ......" | 26473850 | |
hsa-miR-210-3p | breast cancer | metastasis | "These included miR-141 miR-144 miR-193b miR-200a m ......" | 26785733 | |
hsa-miR-210-3p | breast cancer | metastasis | "We evaluated the expression levels of miR-21 miR-1 ......" | 27197674 | |
hsa-miR-210-3p | breast cancer | staging | "We report for the first time an extremely high pre ......" | 27404381 | |
hsa-miR-210-3p | breast cancer | progression | "MicroRNA 210 interacts with FBXO31 to regulate can ......" | 27601917 | Luciferase |
hsa-miR-210-3p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
hsa-miR-210-3p | cervical and endocervical cancer | progression | "These include hsa-miR-138 hsa-miR-210 and hsa-miR- ......" | 23012319 | |
hsa-miR-210-3p | colon cancer | poor survival | "In the human colon cancer cell lines SW480 and SW6 ......" | 25385144 | Flow cytometry; Western blot |
hsa-miR-210-3p | colon cancer | drug resistance | "Exosomes secreted from human colon cancer cells in ......" | 27611932 | |
hsa-miR-210-3p | colorectal cancer | metastasis; staging; worse prognosis; tumor size | "Hypoxia inducible MiR 210 is an independent progno ......" | 24632577 | |
hsa-miR-210-3p | colorectal cancer | poor survival; worse prognosis | "Circulating miR 210 as a diagnostic and prognostic ......" | 26898324 | |
hsa-miR-210-3p | endometrial cancer | metastasis; tumorigenesis | "In endometrial cancer cells expression levels of m ......" | 26535032 | |
hsa-miR-210-3p | esophageal cancer | differentiation; poor survival | "The role of microRNA 210 in esophageal squamous ce ......" | 23023426 | |
hsa-miR-210-3p | esophageal cancer | drug resistance; staging; recurrence; poor survival | "MiR 210 expression reverses radioresistance of ste ......" | 25493243 | Flow cytometry; Western blot |
hsa-miR-210-3p | gastric cancer | staging | "We performed miRNA microarray and quantitative rev ......" | 23385731 | |
hsa-miR-210-3p | gastric cancer | staging | "A total of 33 miRNAs were identified through the i ......" | 26059512 | |
hsa-miR-210-3p | gastric cancer | poor survival | "PRL 3 promotes gastric cancer migration and invasi ......" | 26548949 | |
hsa-miR-210-3p | glioblastoma | poor survival; recurrence | "Moreover miR-326 miR-130a miR-155 miR-210 and 4 mi ......" | 23302469 | |
hsa-miR-210-3p | glioblastoma | poor survival; drug resistance | "Hypoxic signature of microRNAs in glioblastoma: in ......" | 25129238 | |
hsa-miR-210-3p | glioblastoma | drug resistance | "MicroRNA 210 and Endoplasmic Reticulum Chaperones ......" | 25663939 | |
hsa-miR-210-3p | head and neck cancer | worse prognosis; staging; differentiation; tumor size; poor survival; recurrence | "hsa mir 210 is a marker of tumor hypoxia and a pro ......" | 20187102 | |
hsa-miR-210-3p | head and neck cancer | poor survival | "Our findings showed that significant elevated expr ......" | 25677760 | |
hsa-miR-210-3p | kidney renal cell cancer | tumorigenesis | "With the advent of second-generation sequencing th ......" | 21253009 | |
hsa-miR-210-3p | kidney renal cell cancer | cell migration | "MiR 210 expression in tumor tissue and in vitro ef ......" | 23150176 | Cell migration assay |
hsa-miR-210-3p | kidney renal cell cancer | metastasis; malignant trasformation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
hsa-miR-210-3p | kidney renal cell cancer | progression; metastasis; tumor size; staging | "Serum miR 210 as a potential biomarker of early cl ......" | 24212760 | |
hsa-miR-210-3p | kidney renal cell cancer | staging; metastasis; poor survival; tumor size; worse prognosis | "miR 210 is a prognostic marker in clear cell renal ......" | 25555365 | |
hsa-miR-210-3p | kidney renal cell cancer | poor survival | "Using vote-counting strategy and robust rank aggre ......" | 25974855 | |
hsa-miR-210-3p | kidney renal cell cancer | poor survival; recurrence | "In the survival analyses the expression levels of ......" | 25981392 | |
hsa-miR-210-3p | kidney renal cell cancer | worse prognosis | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
hsa-miR-210-3p | kidney renal cell cancer | tumorigenesis | "To this end we selected four miRNAs miR-21-5p miR- ......" | 26670229 | |
hsa-miR-210-3p | liver cancer | metastasis | "Hypoxia inducible microRNA 210 augments the metast ......" | 22144109 | |
hsa-miR-210-3p | liver cancer | worse prognosis; drug resistance; staging; differentiation; tumor size; poor survival; progression | "Serum microRNA 210 as a predictive biomarker for t ......" | 24935355 | |
hsa-miR-210-3p | liver cancer | progression; staging; worse prognosis; poor survival | "MicroRNA 210 promotes cancer angiogenesis by targe ......" | 27666683 | |
hsa-miR-210-3p | lung cancer | staging; poor survival | "miR 210 is overexpressed in late stages of lung ca ......" | 20885442 | |
hsa-miR-210-3p | lung cancer | malignant trasformation | "In the training set miR-21 and miR-210 display hig ......" | 21864403 | |
hsa-miR-210-3p | lung cancer | drug resistance | "Green tea polyphenol EGCG suppresses lung cancer c ......" | 21965273 | |
hsa-miR-210-3p | lung cancer | progression | "We succeeded in establishing the MTA1 knockdown NS ......" | 22576802 | RNAi |
hsa-miR-210-3p | lung cancer | drug resistance | "MiR 210 promotes a hypoxic phenotype and increases ......" | 23492775 | |
hsa-miR-210-3p | lung cancer | poor survival; staging; metastasis; worse prognosis | "Objective The aim of this study was to investigate ......" | 25733977 | |
hsa-miR-210-3p | lung cancer | staging | "Some representative cases from each group were pro ......" | 26170125 | |
hsa-miR-210-3p | lung squamous cell cancer | staging | "This study contained three phases: 1 marker discov ......" | 20526284 | |
hsa-miR-210-3p | lung squamous cell cancer | staging; recurrence | "In an exploratory study we determined whether expr ......" | 20975375 | |
hsa-miR-210-3p | lung squamous cell cancer | metastasis | "The miRs were quantified by microarray hybridizati ......" | 22295063 | |
hsa-miR-210-3p | lung squamous cell cancer | worse prognosis; staging; metastasis; progression; drug resistance | "Prognostic significance of serum microRNA 210 leve ......" | 24065453 | |
hsa-miR-210-3p | lung squamous cell cancer | drug resistance; staging; poor survival | "Positive prognostic impact of miR 210 in non small ......" | 24305009 | |
hsa-miR-210-3p | lung squamous cell cancer | tumor size; staging | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
hsa-miR-210-3p | lung squamous cell cancer | staging | "Diagnostic Value of Serum miR 182 miR 183 miR 210 ......" | 27093275 | |
hsa-miR-210-3p | lung squamous cell cancer | staging | "We investigated the stage-specific nsclc detection ......" | 27122989 | |
hsa-miR-210-3p | lymphoma | worse prognosis | "Expressions of miR 21 miR 155 and miR 210 in plasm ......" | 22541087 | |
hsa-miR-210-3p | melanoma | poor survival; recurrence | "We determined the expression level of 16 potential ......" | 19830692 | |
hsa-miR-210-3p | melanoma | metastasis; recurrence | "A direct plasma assay of circulating microRNA 210 ......" | 25749524 | |
hsa-miR-210-3p | ovarian cancer | drug resistance | "miR 210 links hypoxia with cell cycle regulation a ......" | 18059191 | |
hsa-miR-210-3p | ovarian cancer | motility; cell migration | "In this study the silencing of VHL in 3AO and SKOV ......" | 24549370 | |
hsa-miR-210-3p | ovarian cancer | drug resistance | "Hypoxia induced miR 210 in epithelial ovarian canc ......" | 24715221 | |
hsa-miR-210-3p | ovarian cancer | progression; metastasis | "miR 210 a modulator of hypoxia induced epithelial ......" | 25932166 | |
hsa-miR-210-3p | pancreatic cancer | poor survival | "We measured the levels of miR-155 miR-203 miR-210 ......" | 19551852 | |
hsa-miR-210-3p | pancreatic cancer | cell migration | "Here we show for the first time that hypoxia leads ......" | 23272057 | |
hsa-miR-210-3p | pancreatic cancer | metastasis; worse prognosis | "This study performed profiling of microRNAs miRNAs ......" | 25258651 | |
hsa-miR-210-3p | pancreatic cancer | progression | "Serum samples were collected for the measurement o ......" | 26998056 | |
hsa-miR-210-3p | prostate cancer | poor survival | "miR 210 as a marker of chronic hypoxia but not a t ......" | 21704399 | |
hsa-miR-210-3p | prostate cancer | drug resistance | "Of 365 miRNAs profiled we identified five serum mi ......" | 23935962 | |
hsa-miR-210-3p | prostate cancer | progression | "Senescent stroma promotes prostate cancer progress ......" | 25091736 | |
hsa-miR-210-3p | sarcoma | poor survival; worse prognosis | "Expression of microRNA 210 associates with poor su ......" | 21455991 | |
hsa-miR-210-3p | sarcoma | worse prognosis; metastasis; tumor size; drug resistance; progression; poor survival | "Prognostic evaluation of microRNA 210 expression i ......" | 23430441 |
Reported gene related to hsa-miR-210-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-210-3p | breast cancer | HIF1A | "Recent studies have identified miR-210 as one of a ......" | 22323552 |
hsa-miR-210-3p | glioblastoma | HIF1A | "HIF-1A over-expression and silencing studies show ......" | 25129238 |
hsa-miR-210-3p | kidney renal cell cancer | HIF1A | "Moreover we showed downregulation of HIF1a protein ......" | 23150176 |
hsa-miR-210-3p | lung cancer | HIF1A | "Activation and elevation of PI3K AKT HIF-1A and mi ......" | 25263437 |
hsa-miR-210-3p | pancreatic cancer | HIF1A | "Expression of miR-210 and hypoxia-inducible factor ......" | 22672828 |
hsa-miR-210-3p | breast cancer | SETD2 | "Recent studies have identified miR-210 as one of a ......" | 22323552 |
hsa-miR-210-3p | lung cancer | SETD2 | "miR 210 is overexpressed in late stages of lung ca ......" | 20885442 |
hsa-miR-210-3p | lung cancer | SETD2 | "We have recently shown that HIF-1 induction of miR ......" | 23492775 |
hsa-miR-210-3p | breast cancer | VHL | "Using small interfering RNAs and RCC4 cells transf ......" | 18316553 |
hsa-miR-210-3p | kidney renal cell cancer | VHL | "Regulatory Effects of microRNA 92 miR 92 on VHL Ge ......" | 22043236 |
hsa-miR-210-3p | ovarian cancer | VHL | "Taken together our data demonstrate that the loss ......" | 24549370 |
hsa-miR-210-3p | colorectal cancer | VMP1 | "In addition vacuole membrane protein 1 VMP1 is ide ......" | 24632577 |
hsa-miR-210-3p | liver cancer | VMP1 | "We identify vacuole membrane protein 1 VMP1 as the ......" | 22144109 |
hsa-miR-210-3p | ovarian cancer | VMP1 | "Taken together our data demonstrate that the loss ......" | 24549370 |
hsa-miR-210-3p | bladder cancer | CA9 | "High miR-210 was significantly associated with hig ......" | 27441495 |
hsa-miR-210-3p | glioblastoma | CA9 | "MiR-210-3p levels were found to be high in GBM pat ......" | 25129238 |
hsa-miR-210-3p | esophageal cancer | FGFRL1 | "Finally we identified fibroblast growth factor rec ......" | 23023426 |
hsa-miR-210-3p | liver cancer | FGFRL1 | "Both in vitro and in vivo studies determined tha ......" | 27666683 |
hsa-miR-210-3p | breast cancer | LDHA | "We specifically showed that it increases extracell ......" | 23064179 |
hsa-miR-210-3p | colon cancer | LDHA | "Importantly by blocking lactate production via inh ......" | 27589845 |
hsa-miR-210-3p | glioblastoma | VEGFA | "MiR-210-3p levels were found to be high in GBM pat ......" | 25129238 |
hsa-miR-210-3p | pancreatic cancer | VEGFA | "Moreover CDF decreased gene expression of miR-21 m ......" | 23272057 |
hsa-miR-210-3p | colon cancer | BCL2 | "The expression of hypoxia inducible factor-1α HIF ......" | 25385144 |
hsa-miR-210-3p | colorectal cancer | BCL2L11 | "Moreover miR-210 mediated the induction of apoptos ......" | 27293381 |
hsa-miR-210-3p | colorectal cancer | CASP2 | "Moreover miR-210 mediated the induction of apoptos ......" | 27293381 |
hsa-miR-210-3p | breast cancer | DIRC2 | "Using small interfering RNAs and RCC4 cells transf ......" | 18316553 |
hsa-miR-210-3p | ovarian cancer | E2F3 | "Biocomputational analysis and in vitro assays demo ......" | 18059191 |
hsa-miR-210-3p | breast cancer | ESR1 | "TaqMan MicroRNA assays for miR-210 expression were ......" | 22323552 |
hsa-miR-210-3p | acute myeloid leukemia | FANCB | "Moreover miR-210 expression was associated with va ......" | 26549593 |
hsa-miR-210-3p | breast cancer | FBXO31 | "MicroRNA 210 interacts with FBXO31 to regulate can ......" | 27601917 |
hsa-miR-210-3p | breast cancer | HGS | "Pooled hazard ratios HRs were calculated to evalua ......" | 24595085 |
hsa-miR-210-3p | glioblastoma | HIF3A | "We show that miR-210-3p promotes hypoxic survival ......" | 25129238 |
hsa-miR-210-3p | pancreatic cancer | IL6 | "Moreover CDF decreased gene expression of miR-21 m ......" | 23272057 |
hsa-miR-210-3p | colon cancer | ISCU | "Hypoxia responsive miR 210 promotes self renewal c ......" | 27589845 |
hsa-miR-210-3p | kidney renal cell cancer | LARP6 | "We observed decreased viability of ACHN and CAKI-2 ......" | 23150176 |
hsa-miR-210-3p | lung squamous cell cancer | LAT2 | "The results suggest that miRNA-486 and miR-210 cou ......" | 27499953 |
hsa-miR-210-3p | pancreatic cancer | MIA | "Significant upregulation of serum miRNAs at earlie ......" | 26998056 |
hsa-miR-210-3p | glioblastoma | P4HB | "Forced overexpression of miR-210 led to P4HB downr ......" | 25663939 |
hsa-miR-210-3p | prostate cancer | PIEZO1 | "Treatment with MIB led to an induction of miR-210 ......" | 25846647 |
hsa-miR-210-3p | gastric cancer | PTP4A3 | "We found that PRL-3 transcript levels were positiv ......" | 26548949 |
hsa-miR-210-3p | ovarian cancer | PTPN1 | "Furthermore upregulated miR-210 promoted tumor gro ......" | 24715221 |
hsa-miR-210-3p | colorectal cancer | ROS1 | "Functional effects of a modulated miR-210 expressi ......" | 27293381 |
hsa-miR-210-3p | lung cancer | SDHD | "The transcript coding for one of these ETC compone ......" | 20885442 |
hsa-miR-210-3p | bladder cancer | SLC2A1 | "High miR-210 was significantly associated with hig ......" | 27441495 |
hsa-miR-210-3p | pancreatic cancer | SPNS1 | "Significant upregulation of serum miRNAs at earlie ......" | 26998056 |
hsa-miR-210-3p | ovarian cancer | TCF3 | "Biocomputational analysis and in vitro assays demo ......" | 18059191 |
hsa-miR-210-3p | lung cancer | TIMP1 | "In the present study we demonstrate that an increa ......" | 25263437 |
hsa-miR-210-3p | pancreatic cancer | VIM | "Inhibition of miR-210 expression decreased migrati ......" | 23831622 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-210-3p | ELK3 | 10 cancers: BLCA; BRCA; COAD; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.078; TCGA BRCA -0.115; TCGA COAD -0.16; TCGA LIHC -0.146; TCGA LUAD -0.063; TCGA LUSC -0.126; TCGA PRAD -0.104; TCGA THCA -0.083; TCGA STAD -0.09; TCGA UCEC -0.17 |
hsa-miR-210-3p | GPD1L | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BLCA -0.093; TCGA BRCA -0.096; TCGA CESC -0.095; TCGA ESCA -0.269; TCGA HNSC -0.265; TCGA KIRC -0.412; TCGA KIRP -0.117; TCGA LGG -0.057; TCGA LUAD -0.174; TCGA LUSC -0.276; TCGA OV -0.097; TCGA PRAD -0.094; TCGA SARC -0.114; TCGA THCA -0.086; TCGA UCEC -0.059 |
hsa-miR-210-3p | ISCU | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BLCA -0.078; TCGA BRCA -0.094; TCGA CESC -0.117; TCGA ESCA -0.082; TCGA HNSC -0.074; TCGA KIRC -0.189; TCGA KIRP -0.15; TCGA LIHC -0.107; TCGA LUAD -0.081; TCGA LUSC -0.138; TCGA PAAD -0.111; TCGA SARC -0.149; TCGA THCA -0.117; TCGA STAD -0.087; TCGA UCEC -0.127 |
hsa-miR-210-3p | MDGA1 | 10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.178; TCGA BRCA -0.09; TCGA COAD -0.206; TCGA KIRC -0.107; TCGA LGG -0.072; TCGA LIHC -0.151; TCGA LUAD -0.168; TCGA PAAD -0.256; TCGA STAD -0.186; TCGA UCEC -0.299 |
hsa-miR-210-3p | NCAM1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.689; TCGA BRCA -0.158; TCGA CESC -0.258; TCGA COAD -0.473; TCGA ESCA -0.55; TCGA HNSC -0.386; TCGA KIRP -0.186; TCGA LGG -0.161; TCGA LUAD -0.095; TCGA LUSC -0.207; TCGA PAAD -0.436; TCGA PRAD -0.377; TCGA STAD -0.458; TCGA UCEC -0.42 |
hsa-miR-210-3p | NPTX1 | 9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUSC; PRAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA BLCA -0.335; TCGA BRCA -0.167; TCGA COAD -0.605; TCGA KIRC -0.351; TCGA KIRP -0.358; TCGA LUSC -0.108; TCGA PRAD -0.101; TCGA STAD -0.609; TCGA UCEC -0.219 |
hsa-miR-210-3p | SCN1B | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.324; TCGA BRCA -0.177; TCGA CESC -0.224; TCGA COAD -0.23; TCGA ESCA -0.227; TCGA HNSC -0.354; TCGA LUSC -0.187; TCGA PAAD -0.192; TCGA SARC -0.175; TCGA THCA -0.141; TCGA STAD -0.195; TCGA UCEC -0.243 |
hsa-miR-210-3p | PCYT1B | 10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUAD; OV; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.217; TCGA BRCA -0.091; TCGA COAD -0.306; TCGA KIRC -0.142; TCGA LGG -0.096; TCGA LUAD -0.247; TCGA OV -0.172; TCGA PAAD -0.302; TCGA PRAD -0.328; TCGA STAD -0.311 |
hsa-miR-210-3p | SH3BGRL | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.168; TCGA BRCA -0.051; TCGA CESC -0.177; TCGA COAD -0.179; TCGA ESCA -0.206; TCGA HNSC -0.083; TCGA KIRP -0.08; TCGA LUAD -0.117; TCGA LUSC -0.282; TCGA OV -0.091; TCGA PAAD -0.083; TCGA PRAD -0.156; TCGA SARC -0.106; TCGA STAD -0.205; TCGA UCEC -0.201 |
hsa-miR-210-3p | PDZD4 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.335; TCGA BRCA -0.252; TCGA CESC -0.14; TCGA COAD -0.388; TCGA ESCA -0.22; TCGA HNSC -0.144; TCGA KIRP -0.276; TCGA LGG -0.22; TCGA LIHC -0.278; TCGA LUAD -0.103; TCGA LUSC -0.203; TCGA PAAD -0.234; TCGA STAD -0.508; TCGA UCEC -0.501 |
hsa-miR-210-3p | MPEG1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.32; TCGA BRCA -0.113; TCGA CESC -0.283; TCGA COAD -0.171; TCGA ESCA -0.305; TCGA HNSC -0.255; TCGA KIRP -0.139; TCGA LIHC -0.141; TCGA LUAD -0.135; TCGA LUSC -0.417; TCGA PAAD -0.363; TCGA PRAD -0.102; TCGA SARC -0.216; TCGA STAD -0.108; TCGA UCEC -0.186 |
hsa-miR-210-3p | POU2AF1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.281; TCGA BRCA -0.166; TCGA CESC -0.313; TCGA ESCA -0.388; TCGA HNSC -0.159; TCGA KIRP -0.356; TCGA PAAD -0.425; TCGA PRAD -0.176; TCGA SARC -0.283; TCGA STAD -0.141 |
hsa-miR-210-3p | CORO2B | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.219; TCGA BRCA -0.299; TCGA CESC -0.241; TCGA COAD -0.31; TCGA ESCA -0.369; TCGA HNSC -0.31; TCGA KIRC -0.498; TCGA LUAD -0.297; TCGA LUSC -0.52; TCGA PAAD -0.363; TCGA PRAD -0.187; TCGA SARC -0.214; TCGA STAD -0.27; TCGA UCEC -0.408 |
hsa-miR-210-3p | SLC16A14 | 9 cancers: BLCA; BRCA; HNSC; LGG; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.06; TCGA HNSC -0.176; TCGA LGG -0.071; TCGA OV -0.123; TCGA PAAD -0.161; TCGA SARC -0.167; TCGA STAD -0.133; TCGA UCEC -0.148 |
hsa-miR-210-3p | SCARA3 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.277; TCGA BRCA -0.086; TCGA CESC -0.122; TCGA COAD -0.287; TCGA HNSC -0.309; TCGA LIHC -0.151; TCGA LUAD -0.159; TCGA LUSC -0.069; TCGA PAAD -0.207; TCGA PRAD -0.211; TCGA SARC -0.176; TCGA STAD -0.352; TCGA UCEC -0.189 |
hsa-miR-210-3p | IGF2 | 12 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.334; TCGA CESC -0.25; TCGA COAD -0.419; TCGA HNSC -0.218; TCGA KIRC -0.399; TCGA KIRP -0.18; TCGA LIHC -0.46; TCGA LUSC -0.193; TCGA PRAD -0.14; TCGA SARC -0.242; TCGA STAD -0.115; TCGA UCEC -0.473 |
hsa-miR-210-3p | CLASP2 | 9 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD | miRNAWalker2 validate | TCGA ESCA -0.065; TCGA HNSC -0.061; TCGA KIRC -0.167; TCGA KIRP -0.064; TCGA LGG -0.092; TCGA LUAD -0.055; TCGA LUSC -0.109; TCGA PAAD -0.088; TCGA STAD -0.055 |
Enriched cancer pathways of putative targets