microRNA information: hsa-miR-211-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-211-5p | miRbase |
Accession: | MIMAT0000268 | miRbase |
Precursor name: | hsa-mir-211 | miRbase |
Precursor accession: | MI0000287 | miRbase |
Symbol: | MIR211 | HGNC |
RefSeq ID: | NR_029624 | GenBank |
Sequence: | UUCCCUUUGUCAUCCUUCGCCU |
Reported expression in cancers: hsa-miR-211-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-211-5p | breast cancer | downregulation | "To shed light on their roles of miR-211 in breast ......" | 25680404 | qPCR |
hsa-miR-211-5p | colon cancer | upregulation | "Further later p-TNM hazard ratio HR=2.973 95% conf ......" | 25932237 | |
hsa-miR-211-5p | colorectal cancer | upregulation | "MicroRNA 211 expression is upregulated and associa ......" | 26152286 | qPCR |
hsa-miR-211-5p | gastric cancer | downregulation | "Deregulation of miR-211 has been observed in vario ......" | 26823713 | qPCR |
hsa-miR-211-5p | head and neck cancer | deregulation | "miR 211 promotes the progression of head and neck ......" | 23726841 | |
hsa-miR-211-5p | lung squamous cell cancer | upregulation | "In the current study qRT-PCR was performed to meas ......" | 26277787 | qPCR |
hsa-miR-211-5p | melanoma | downregulation | "An exploratory miRNA analysis of 666 miRs by low d ......" | 20302635 | Microarray |
hsa-miR-211-5p | melanoma | downregulation | "Differential expression of microRNAs during melano ......" | 22223089 | Microarray |
hsa-miR-211-5p | ovarian cancer | downregulation | "miR-211 is known to be dysregulated in ovarian can ......" | 25889927 | |
hsa-miR-211-5p | pancreatic cancer | upregulation | "In a high-throughput microRNA miRNA array miR-211 ......" | 24940696 | Microarray |
Reported cancer pathway affected by hsa-miR-211-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-211-5p | breast cancer | cell cycle pathway | "MicroRNA 211 a direct negative regulator of CDC25B ......" | 25680404 | Luciferase |
hsa-miR-211-5p | lung squamous cell cancer | cell cycle pathway | "miR 211 promotes non small cell lung cancer prolif ......" | 26277787 | Colony formation; Luciferase |
hsa-miR-211-5p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "miR 211 suppresses epithelial ovarian cancer proli ......" | 25889927 | Colony formation; Luciferase |
Reported cancer prognosis affected by hsa-miR-211-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-211-5p | breast cancer | staging | "MicroRNA 211 a direct negative regulator of CDC25B ......" | 25680404 | Luciferase |
hsa-miR-211-5p | colon cancer | worse prognosis | "Further later p-TNM hazard ratio HR=2.973 95% conf ......" | 25932237 | |
hsa-miR-211-5p | colorectal cancer | tumorigenesis; cell migration | "MicroRNA 211 expression promotes colorectal cancer ......" | 22235338 | Flow cytometry; Colony formation |
hsa-miR-211-5p | colorectal cancer | worse prognosis; tumorigenesis; poor survival | "MicroRNA 211 expression is upregulated and associa ......" | 26152286 | |
hsa-miR-211-5p | head and neck cancer | progression; worse prognosis; tumorigenesis | "miR 211 promotes the progression of head and neck ......" | 23726841 | |
hsa-miR-211-5p | melanoma | metastasis | "Specifically compared with expression levels in me ......" | 21072171 | |
hsa-miR-211-5p | melanoma | malignant trasformation; progression | "Intronic miR 211 assumes the tumor suppressive fun ......" | 21109473 | |
hsa-miR-211-5p | melanoma | tumorigenesis | "Downregulation of microRNA 211 is involved in expr ......" | 21687938 | Luciferase |
hsa-miR-211-5p | melanoma | progression; staging | "Differential expression of microRNAs during melano ......" | 22223089 | Colony formation |
hsa-miR-211-5p | melanoma | progression; poor survival; differentiation | "New target genes of MITF induced microRNA 211 cont ......" | 24039954 | |
hsa-miR-211-5p | melanoma | progression; cell migration | "miR 211 and MITF modulation by Bcl 2 protein in me ......" | 26599548 | Western blot |
hsa-miR-211-5p | melanoma | progression | "MicroRNA 211 Functions as a Metabolic Switch in Hu ......" | 26787841 | |
hsa-miR-211-5p | ovarian cancer | progression; tumorigenesis | "miR 211 suppresses epithelial ovarian cancer proli ......" | 25889927 | Colony formation; Luciferase |
hsa-miR-211-5p | pancreatic cancer | worse prognosis | "High throughput microRNA miRNAs arrays unravel the ......" | 23155457 | |
hsa-miR-211-5p | pancreatic cancer | poor survival; cell migration | "miR 211 modulates gemcitabine activity through dow ......" | 24940696 |
Reported gene related to hsa-miR-211-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-211-5p | melanoma | MITF | "We propose a model for the apparent non-overlappin ......" | 21435193 |
hsa-miR-211-5p | melanoma | MITF | "Interestingly one of the miRNAs involved in melano ......" | 23934065 |
hsa-miR-211-5p | melanoma | MITF | "miR 211 and MITF modulation by Bcl 2 protein in me ......" | 26599548 |
hsa-miR-211-5p | melanoma | MITF | "New target genes of MITF induced microRNA 211 cont ......" | 24039954 |
hsa-miR-211-5p | melanoma | TRPM1 | "miR-211 is encoded within the sixth intron of TRPM ......" | 21072171 |
hsa-miR-211-5p | melanoma | TRPM1 | "MiR-211 a melanocyte lineage-specific small non-co ......" | 24039954 |
hsa-miR-211-5p | ovarian cancer | TRPM1 | "The microRNA miR-211 is localized on intron 6 of t ......" | 25889927 |
hsa-miR-211-5p | melanoma | BCL2 | "miR 211 and MITF modulation by Bcl 2 protein in me ......" | 26599548 |
hsa-miR-211-5p | pancreatic cancer | BRCA2 | "Moreover we demonstrated that induction of the miR ......" | 24940696 |
hsa-miR-211-5p | colorectal cancer | CD44 | "Long Non Coding RNA ucoo2kmd.1 Regulates CD44 Depe ......" | 26974151 |
hsa-miR-211-5p | breast cancer | CDC25B | "MicroRNA 211 a direct negative regulator of CDC25B ......" | 25680404 |
hsa-miR-211-5p | colorectal cancer | CHD5 | "MicroRNA 211 expression promotes colorectal cancer ......" | 22235338 |
hsa-miR-211-5p | melanoma | IGF2R | "Specifically melanosomal microRNA-211 directly tar ......" | 27548915 |
hsa-miR-211-5p | melanoma | KCNMA1 | "Mutating the miR-211 binding site seed sequences a ......" | 21072171 |
hsa-miR-211-5p | head and neck cancer | MYC | "A novel role for miR-211 in the regulation of TGFÎ ......" | 23726841 |
hsa-miR-211-5p | melanoma | NUAK1 | "Transcription factor/microRNA axis blocks melanoma ......" | 23934065 |
hsa-miR-211-5p | lung cancer | OSR1 | "The individuals with both a risk genotype of miRNA ......" | 27663200 |
hsa-miR-211-5p | melanoma | PDK4 | "HIF-1α protein loss was correlated with the downr ......" | 26787841 |
hsa-miR-211-5p | melanoma | POU3F2 | "Melanoma cell invasiveness is regulated by miR 211 ......" | 21435193 |
hsa-miR-211-5p | melanoma | PRAME | "We focused on one commonly downregulated miRNA miR ......" | 21687938 |
hsa-miR-211-5p | pancreatic cancer | RRM2 | "Moreover we demonstrated that induction of the miR ......" | 24940696 |
hsa-miR-211-5p | liver cancer | SATB2 | "miR 211 suppresses hepatocellular carcinoma by dow ......" | 25888635 |
hsa-miR-211-5p | gastric cancer | SOX4 | "MiR 211 inhibits cell proliferation and invasion o ......" | 26823713 |
hsa-miR-211-5p | lung squamous cell cancer | SRCIN1 | "miR 211 promotes non small cell lung cancer prolif ......" | 26277787 |