microRNA information: hsa-miR-211-5p

SectionIDlink
Mature name: hsa-miR-211-5pmiRbase
Accession: MIMAT0000268miRbase
Precursor name: hsa-mir-211 miRbase
Precursor accession: MI0000287miRbase
Symbol: MIR211HGNC
RefSeq ID: NR_029624GenBank
Sequence: UUCCCUUUGUCAUCCUUCGCCU



Reported expression in cancers: hsa-miR-211-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-211-5p

breast cancerdownregulation"To shed light on their roles of miR-211 in breast ......"25680404qPCR
hsa-miR-211-5p

colon cancerupregulation"Further later p-TNM hazard ratio HR=2.973 95% conf ......"25932237
hsa-miR-211-5p

colorectal cancerupregulation"MicroRNA 211 expression is upregulated and associa ......"26152286qPCR
hsa-miR-211-5p

gastric cancerdownregulation"Deregulation of miR-211 has been observed in vario ......"26823713qPCR
hsa-miR-211-5p

head and neck cancerderegulation"miR 211 promotes the progression of head and neck ......"23726841
hsa-miR-211-5p

lung squamous cell cancerupregulation"In the current study qRT-PCR was performed to meas ......"26277787qPCR
hsa-miR-211-5p

melanomadownregulation"An exploratory miRNA analysis of 666 miRs by low d ......"20302635Microarray
hsa-miR-211-5p

melanomadownregulation"Differential expression of microRNAs during melano ......"22223089Microarray
hsa-miR-211-5p

ovarian cancerdownregulation"miR-211 is known to be dysregulated in ovarian can ......"25889927
hsa-miR-211-5p

pancreatic cancerupregulation"In a high-throughput microRNA miRNA array miR-211 ......"24940696Microarray



Reported cancer pathway affected by hsa-miR-211-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-211-5p

breast cancercell cycle pathway"MicroRNA 211 a direct negative regulator of CDC25B ......"25680404Luciferase
hsa-miR-211-5p

lung squamous cell cancercell cycle pathway"miR 211 promotes non small cell lung cancer prolif ......"26277787Colony formation; Luciferase
hsa-miR-211-5p

ovarian cancercell cycle pathway; Apoptosis pathway"miR 211 suppresses epithelial ovarian cancer proli ......"25889927Colony formation; Luciferase



Reported cancer prognosis affected by hsa-miR-211-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-211-5p

breast cancerstaging"MicroRNA 211 a direct negative regulator of CDC25B ......"25680404Luciferase
hsa-miR-211-5p

colon cancerworse prognosis"Further later p-TNM hazard ratio HR=2.973 95% conf ......"25932237
hsa-miR-211-5p

colorectal cancertumorigenesis; cell migration"MicroRNA 211 expression promotes colorectal cancer ......"22235338Flow cytometry; Colony formation
hsa-miR-211-5p

colorectal cancerworse prognosis; tumorigenesis; poor survival"MicroRNA 211 expression is upregulated and associa ......"26152286
hsa-miR-211-5p

head and neck cancerprogression; worse prognosis; tumorigenesis"miR 211 promotes the progression of head and neck ......"23726841
hsa-miR-211-5p

melanomametastasis"Specifically compared with expression levels in me ......"21072171
hsa-miR-211-5p

melanomamalignant trasformation; progression"Intronic miR 211 assumes the tumor suppressive fun ......"21109473
hsa-miR-211-5p

melanomatumorigenesis"Downregulation of microRNA 211 is involved in expr ......"21687938Luciferase
hsa-miR-211-5p

melanomaprogression; staging"Differential expression of microRNAs during melano ......"22223089Colony formation
hsa-miR-211-5p

melanomaprogression; poor survival; differentiation"New target genes of MITF induced microRNA 211 cont ......"24039954
hsa-miR-211-5p

melanomaprogression; cell migration"miR 211 and MITF modulation by Bcl 2 protein in me ......"26599548Western blot
hsa-miR-211-5p

melanomaprogression"MicroRNA 211 Functions as a Metabolic Switch in Hu ......"26787841
hsa-miR-211-5p

ovarian cancerprogression; tumorigenesis"miR 211 suppresses epithelial ovarian cancer proli ......"25889927Colony formation; Luciferase
hsa-miR-211-5p

pancreatic cancerworse prognosis"High throughput microRNA miRNAs arrays unravel the ......"23155457
hsa-miR-211-5p

pancreatic cancerpoor survival; cell migration"miR 211 modulates gemcitabine activity through dow ......"24940696



Reported gene related to hsa-miR-211-5p

miRNAcancergenereportingPUBMED
hsa-miR-211-5p

melanomaMITF"We propose a model for the apparent non-overlappin ......"21435193
hsa-miR-211-5p

melanomaMITF"Interestingly one of the miRNAs involved in melano ......"23934065
hsa-miR-211-5p

melanomaMITF"miR 211 and MITF modulation by Bcl 2 protein in me ......"26599548
hsa-miR-211-5p

melanomaMITF"New target genes of MITF induced microRNA 211 cont ......"24039954
hsa-miR-211-5p

melanomaTRPM1"miR-211 is encoded within the sixth intron of TRPM ......"21072171
hsa-miR-211-5p

melanomaTRPM1"MiR-211 a melanocyte lineage-specific small non-co ......"24039954
hsa-miR-211-5p

ovarian cancerTRPM1"The microRNA miR-211 is localized on intron 6 of t ......"25889927
hsa-miR-211-5p

melanomaBCL2"miR 211 and MITF modulation by Bcl 2 protein in me ......"26599548
hsa-miR-211-5p

pancreatic cancerBRCA2"Moreover we demonstrated that induction of the miR ......"24940696
hsa-miR-211-5p

colorectal cancerCD44"Long Non Coding RNA ucoo2kmd.1 Regulates CD44 Depe ......"26974151
hsa-miR-211-5p

breast cancerCDC25B"MicroRNA 211 a direct negative regulator of CDC25B ......"25680404
hsa-miR-211-5p

colorectal cancerCHD5"MicroRNA 211 expression promotes colorectal cancer ......"22235338
hsa-miR-211-5p

melanomaIGF2R"Specifically melanosomal microRNA-211 directly tar ......"27548915
hsa-miR-211-5p

melanomaKCNMA1"Mutating the miR-211 binding site seed sequences a ......"21072171
hsa-miR-211-5p

head and neck cancerMYC"A novel role for miR-211 in the regulation of TGF ......"23726841
hsa-miR-211-5p

melanomaNUAK1"Transcription factor/microRNA axis blocks melanoma ......"23934065
hsa-miR-211-5p

lung cancerOSR1"The individuals with both a risk genotype of miRNA ......"27663200
hsa-miR-211-5p

melanomaPDK4"HIF-1α protein loss was correlated with the downr ......"26787841
hsa-miR-211-5p

melanomaPOU3F2"Melanoma cell invasiveness is regulated by miR 211 ......"21435193
hsa-miR-211-5p

melanomaPRAME"We focused on one commonly downregulated miRNA miR ......"21687938
hsa-miR-211-5p

pancreatic cancerRRM2"Moreover we demonstrated that induction of the miR ......"24940696
hsa-miR-211-5p

liver cancerSATB2"miR 211 suppresses hepatocellular carcinoma by dow ......"25888635
hsa-miR-211-5p

gastric cancerSOX4"MiR 211 inhibits cell proliferation and invasion o ......"26823713
hsa-miR-211-5p

lung squamous cell cancerSRCIN1"miR 211 promotes non small cell lung cancer prolif ......"26277787