microRNA information: hsa-miR-2110
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-2110 | miRbase |
| Accession: | MIMAT0010133 | miRbase |
| Precursor name: | hsa-mir-2110 | miRbase |
| Precursor accession: | MI0010629 | miRbase |
| Symbol: | MIR2110 | HGNC |
| RefSeq ID: | NR_031747 | GenBank |
| Sequence: | UUGGGGAAACGGCCGCUGAGUG |
Reported expression in cancers: hsa-miR-2110
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-2110
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-2110
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-2110 | lung cancer | metastasis | "MicroRNA microarrays were performed on 26 primary ......" | 24778034 |
Reported gene related to hsa-miR-2110
| miRNA | cancer | gene | reporting | PUBMED |
|---|
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-2110 | C1QTNF3 | 9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.204; TCGA CESC -0.255; TCGA ESCA -0.272; TCGA HNSC -0.19; TCGA LUAD -0.148; TCGA PAAD -0.286; TCGA THCA -0.1; TCGA STAD -0.429; TCGA UCEC -0.136 |
Enriched cancer pathways of putative targets