microRNA information: hsa-miR-212-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-212-3p | miRbase |
Accession: | MIMAT0000269 | miRbase |
Precursor name: | hsa-mir-212 | miRbase |
Precursor accession: | MI0000288 | miRbase |
Symbol: | MIR212 | HGNC |
RefSeq ID: | NR_029625 | GenBank |
Sequence: | UAACAGUCUCCAGUCACGGCC |
Reported expression in cancers: hsa-miR-212-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-212-3p | breast cancer | downregulation | "Aberrant Expression of Breast Development Related ......" | 27382390 | qPCR |
hsa-miR-212-3p | cervical and endocervical cancer | downregulation | "In this study we found that miR-212 and miR-132 fr ......" | 25988335 | |
hsa-miR-212-3p | colorectal cancer | downregulation | "Altered functions of microRNAs miRNAs have been as ......" | 23583431 | qPCR |
hsa-miR-212-3p | gastric cancer | downregulation | "Initially we performed microarray analysis using t ......" | 20020497 | Microarray |
hsa-miR-212-3p | gastric cancer | downregulation | "Moreover low expression of miR-212 and its promote ......" | 26693054 | |
hsa-miR-212-3p | head and neck cancer | downregulation | "Heparin-binding EGF-like growth factor HB-EGF and ......" | 20856931 | |
hsa-miR-212-3p | lung cancer | downregulation | "Epigenetic regulation of miR 212 expression in lun ......" | 22110741 | |
hsa-miR-212-3p | ovarian cancer | downregulation | "We found that miR-212 was significantly downregula ......" | 25201063 | |
hsa-miR-212-3p | prostate cancer | upregulation | "Loss of 18 miRNAs e.g.miR-34c miR-29b miR-212 and ......" | 23781281 |
Reported cancer pathway affected by hsa-miR-212-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-212-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Genetic and epigenetic down regulation of microRNA ......" | 23583431 | |
hsa-miR-212-3p | liver cancer | Apoptosis pathway | "MicroRNA 212 suppresses tumor growth of human hepa ......" | 25965836 | |
hsa-miR-212-3p | lung cancer | cell cycle pathway | "Furthermore miR-212/132 overexpression induced cel ......" | 25435090 | |
hsa-miR-212-3p | lung squamous cell cancer | Apoptosis pathway | "miR 212 increases tumor necrosis factor related ap ......" | 20388802 | |
hsa-miR-212-3p | lung squamous cell cancer | cell cycle pathway | "MicroRNA 212 displays tumor promoting properties i ......" | 22357618 | |
hsa-miR-212-3p | lung squamous cell cancer | Apoptosis pathway | "Synaptic acetylcholinesterase targeted by microRNA ......" | 23974008 | RNAi |
hsa-miR-212-3p | lymphoma | cell cycle pathway; Apoptosis pathway | "Restoration of microRNA 212 causes a G0/G1 cell cy ......" | 27493231 | |
hsa-miR-212-3p | retinoblastoma | cell cycle pathway | "MicroRNA 212 inhibits proliferation of gastric can ......" | 23794145 | Luciferase; Colony formation |
Reported cancer prognosis affected by hsa-miR-212-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-212-3p | colorectal cancer | metastasis; progression; tumorigenesis; cell migration; poor survival | "Genetic and epigenetic down regulation of microRNA ......" | 23583431 | |
hsa-miR-212-3p | colorectal cancer | progression; metastasis | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
hsa-miR-212-3p | esophageal cancer | worse prognosis; poor survival | "Overregulation of microRNA 212 in the poor prognos ......" | 25299094 | |
hsa-miR-212-3p | gastric cancer | tumorigenesis | "miR 212 is downregulated and suppresses methyl CpG ......" | 20020497 | |
hsa-miR-212-3p | gastric cancer | tumorigenesis; progression | "Down regulation of miR 212 expression by DNA hyper ......" | 21053104 | Luciferase |
hsa-miR-212-3p | gastric cancer | metastasis; differentiation; tumor size | "The expressions of 60 candidate miRNAs in 30 gastr ......" | 21987613 | |
hsa-miR-212-3p | gastric cancer | metastasis; worse prognosis; cell migration | "MicroRNA 212 functions as an epigenetic silenced t ......" | 26693054 | Luciferase |
hsa-miR-212-3p | head and neck cancer | drug resistance | "Regulation of heparin binding EGF like growth fact ......" | 20856931 | Western blot; Colony formation |
hsa-miR-212-3p | liver cancer | poor survival | "MicroRNA 212 suppresses tumor growth of human hepa ......" | 25965836 | |
hsa-miR-212-3p | lung cancer | poor survival; recurrence | "In the multivariate Cox regression analysis mir-14 ......" | 27695346 | |
hsa-miR-212-3p | lung squamous cell cancer | drug resistance | "miR 212 increases tumor necrosis factor related ap ......" | 20388802 | |
hsa-miR-212-3p | lung squamous cell cancer | progression; tumorigenesis | "MicroRNA 212 displays tumor promoting properties i ......" | 22357618 | |
hsa-miR-212-3p | lymphoma | progression; tumorigenesis | "Restoration of microRNA 212 causes a G0/G1 cell cy ......" | 27493231 | |
hsa-miR-212-3p | pancreatic cancer | staging; differentiation | "Expressions of miRNAs were determined with the Taq ......" | 22851141 | |
hsa-miR-212-3p | pancreatic cancer | metastasis; progression | "miR 212 promotes pancreatic cancer cell growth and ......" | 24961235 | Luciferase |
hsa-miR-212-3p | prostate cancer | drug resistance; progression | "Dysregulation of miR 212 Promotes Castration Resis ......" | 26553749 | |
hsa-miR-212-3p | sarcoma | progression | "MicroRNA 212 inhibits osteosarcoma cells prolifera ......" | 25562164 | Luciferase |
Reported gene related to hsa-miR-212-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-212-3p | lung squamous cell cancer | PTCH1 | "MicroRNA 212 displays tumor promoting properties i ......" | 22357618 |
hsa-miR-212-3p | pancreatic cancer | PTCH1 | "miR 212 promotes pancreatic cancer cell growth and ......" | 24961235 |
hsa-miR-212-3p | retinoblastoma | RBP2 | "The expression of RBP2 was stronger in cancerous t ......" | 23922798 |
hsa-miR-212-3p | retinoblastoma | RBP2 | "We used bioinformatics to predict that microRNA-21 ......" | 23794145 |
hsa-miR-212-3p | prostate cancer | SOX4 | "Immunohistochemistry IHC was used to detect the ex ......" | 27527117 |
hsa-miR-212-3p | sarcoma | SOX4 | "MicroRNA 212 inhibits osteosarcoma cells prolifera ......" | 25562164 |
hsa-miR-212-3p | prostate cancer | AR | "Aberrant coexpression of AR and hnRNPH1 and downre ......" | 26553749 |
hsa-miR-212-3p | lymphoma | CCND3 | "Restoration of microRNA 212 causes a G0/G1 cell cy ......" | 27493231 |
hsa-miR-212-3p | gastric cancer | CXXC1 | "miR 212 is downregulated and suppresses methyl CpG ......" | 20020497 |
hsa-miR-212-3p | head and neck cancer | EGF | "Regulation of heparin binding EGF like growth fact ......" | 20856931 |
hsa-miR-212-3p | liver cancer | FOXA1 | "MicroRNA 212 suppresses tumor growth of human hepa ......" | 25965836 |
hsa-miR-212-3p | ovarian cancer | HBEGF | "MiR 212 exerts suppressive effect on SKOV3 ovarian ......" | 25201063 |
hsa-miR-212-3p | pancreatic cancer | HLA-E | "More importantly PC-derived exosomes inhibit RFXAP ......" | 26337469 |
hsa-miR-212-3p | prostate cancer | HNRNPH1 | "Aberrant coexpression of AR and hnRNPH1 and downre ......" | 26553749 |
hsa-miR-212-3p | retinoblastoma | MBD2 | "Histone demethylase retinoblastoma binding protein ......" | 23922798 |
hsa-miR-212-3p | gastric cancer | MECP2 | "miR 212 is downregulated and suppresses methyl CpG ......" | 20020497 |
hsa-miR-212-3p | gastric cancer | MYC | "The expression of miR-212 was evaluated before and ......" | 21053104 |
hsa-miR-212-3p | lung squamous cell cancer | PLAT | "We found that miR-212 was up-regulated when cells ......" | 22357618 |
hsa-miR-212-3p | gastric cancer | PXN | "MicroRNA 212 functions as an epigenetic silenced t ......" | 26693054 |
hsa-miR-212-3p | gastric cancer | REM1 | "qRT-PCR was used to detect the expression of miR-2 ......" | 21053104 |
hsa-miR-212-3p | pancreatic cancer | RFXAP | "Pancreatic cancer derived exosomes transfer miRNAs ......" | 26337469 |
hsa-miR-212-3p | glioblastoma | SGK3 | "MiR 212 3p inhibits glioblastoma cell proliferatio ......" | 25720694 |
hsa-miR-212-3p | prostate cancer | SIRT1 | "MicroRNA 212 negatively regulates starvation induc ......" | 26439987 |
hsa-miR-212-3p | colorectal cancer | SOD2 | "Genetic and epigenetic down regulation of microRNA ......" | 23583431 |
hsa-miR-212-3p | colorectal cancer | TJP1 | "To confirm the reliability of the analyses we iden ......" | 26692142 |
hsa-miR-212-3p | lung squamous cell cancer | TNF | "miR 212 increases tumor necrosis factor related ap ......" | 20388802 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-212-3p | MAOA | 10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.457; TCGA BRCA -0.18; TCGA COAD -0.236; TCGA ESCA -0.314; TCGA LIHC -0.219; TCGA LUAD -0.163; TCGA PRAD -0.144; TCGA SARC -0.621; TCGA STAD -0.546; TCGA UCEC -0.2 |
hsa-miR-212-3p | TIA1 | 10 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PRAD; STAD | MirTarget | TCGA BLCA -0.209; TCGA ESCA -0.08; TCGA HNSC -0.107; TCGA KIRP -0.234; TCGA LGG -0.119; TCGA LUAD -0.105; TCGA LUSC -0.108; TCGA OV -0.082; TCGA PRAD -0.16; TCGA STAD -0.132 |
hsa-miR-212-3p | ZNF133 | 10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PRAD; UCEC | MirTarget | TCGA BLCA -0.111; TCGA CESC -0.058; TCGA COAD -0.132; TCGA HNSC -0.19; TCGA KIRP -0.176; TCGA LGG -0.095; TCGA LUAD -0.08; TCGA OV -0.06; TCGA PRAD -0.119; TCGA UCEC -0.055 |
hsa-miR-212-3p | ZFP3 | 9 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.271; TCGA COAD -0.342; TCGA KIRC -0.081; TCGA KIRP -0.189; TCGA LGG -0.079; TCGA LUAD -0.14; TCGA THCA -0.053; TCGA STAD -0.288; TCGA UCEC -0.254 |
hsa-miR-212-3p | BTG2 | 10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; OV; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.398; TCGA BRCA -0.267; TCGA COAD -0.197; TCGA ESCA -0.181; TCGA LGG -0.065; TCGA LUAD -0.22; TCGA LUSC -0.182; TCGA OV -0.1; TCGA STAD -0.372; TCGA UCEC -0.134 |
hsa-miR-212-3p | EPM2AIP1 | 9 cancers: BLCA; COAD; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.148; TCGA COAD -0.493; TCGA LIHC -0.119; TCGA LUAD -0.093; TCGA LUSC -0.138; TCGA OV -0.134; TCGA SARC -0.079; TCGA STAD -0.182; TCGA UCEC -0.191 |
hsa-miR-212-3p | PACRG | 9 cancers: BLCA; CESC; KIRC; LIHC; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.863; TCGA CESC -0.281; TCGA KIRC -0.261; TCGA LIHC -0.365; TCGA LUAD -0.336; TCGA LUSC -0.392; TCGA OV -0.479; TCGA STAD -0.455; TCGA UCEC -0.653 |
hsa-miR-212-3p | MAPT | 9 cancers: BLCA; BRCA; KIRC; LGG; LUAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.187; TCGA BRCA -0.517; TCGA KIRC -0.371; TCGA LGG -0.058; TCGA LUAD -0.235; TCGA PRAD -0.106; TCGA SARC -0.392; TCGA THCA -0.196; TCGA STAD -0.518 |
hsa-miR-212-3p | SRCIN1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.581; TCGA BRCA -0.208; TCGA CESC -0.193; TCGA HNSC -0.117; TCGA KIRP -0.478; TCGA LUAD -0.315; TCGA OV -0.239; TCGA PRAD -0.211; TCGA SARC -0.225; TCGA UCEC -0.279 |
hsa-miR-212-3p | MON2 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.073; TCGA BRCA -0.094; TCGA COAD -0.081; TCGA ESCA -0.085; TCGA KIRC -0.073; TCGA LIHC -0.057; TCGA LUSC -0.077; TCGA STAD -0.139; TCGA UCEC -0.075 |
hsa-miR-212-3p | FAM189A1 | 10 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.367; TCGA BRCA -0.238; TCGA CESC -0.393; TCGA COAD -0.648; TCGA KIRC -0.273; TCGA KIRP -0.355; TCGA LUAD -0.221; TCGA PRAD -0.234; TCGA STAD -0.65; TCGA UCEC -0.43 |
hsa-miR-212-3p | ABCC5 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; STAD | mirMAP | TCGA BLCA -0.222; TCGA BRCA -0.102; TCGA COAD -0.173; TCGA ESCA -0.482; TCGA HNSC -0.157; TCGA KIRP -0.11; TCGA LUAD -0.094; TCGA PRAD -0.095; TCGA STAD -0.125 |
hsa-miR-212-3p | C1orf21 | 9 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.1; TCGA BRCA -0.281; TCGA ESCA -0.173; TCGA LUAD -0.241; TCGA LUSC -0.199; TCGA PRAD -0.1; TCGA THCA -0.116; TCGA STAD -0.349; TCGA UCEC -0.124 |
hsa-miR-212-3p | MTR | 10 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.058; TCGA BRCA -0.07; TCGA ESCA -0.227; TCGA KIRC -0.073; TCGA LIHC -0.081; TCGA LUAD -0.059; TCGA SARC -0.127; TCGA THCA -0.058; TCGA STAD -0.148; TCGA UCEC -0.112 |
hsa-miR-212-3p | GAS8 | 10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; UCEC | mirMAP | TCGA BLCA -0.094; TCGA CESC -0.068; TCGA HNSC -0.093; TCGA KIRC -0.135; TCGA KIRP -0.179; TCGA LIHC -0.092; TCGA LUAD -0.199; TCGA OV -0.079; TCGA PRAD -0.053; TCGA UCEC -0.097 |
hsa-miR-212-3p | GFRA1 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.23; TCGA BRCA -0.625; TCGA COAD -0.497; TCGA ESCA -0.603; TCGA KIRC -0.354; TCGA LGG -0.108; TCGA LIHC -0.402; TCGA LUAD -0.453; TCGA LUSC -0.515; TCGA STAD -0.6; TCGA UCEC -0.344 |
hsa-miR-212-3p | AR | 10 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; OV; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.374; TCGA BRCA -0.561; TCGA ESCA -0.4; TCGA KIRC -0.366; TCGA LIHC -0.444; TCGA LUAD -0.188; TCGA OV -0.248; TCGA SARC -0.474; TCGA STAD -0.458; TCGA UCEC -0.596 |
hsa-miR-212-3p | DTWD2 | 12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.124; TCGA BRCA -0.17; TCGA CESC -0.093; TCGA ESCA -0.179; TCGA KIRC -0.189; TCGA LIHC -0.075; TCGA LUAD -0.057; TCGA LUSC -0.064; TCGA SARC -0.09; TCGA THCA -0.096; TCGA STAD -0.12; TCGA UCEC -0.068 |
hsa-miR-212-3p | KSR2 | 9 cancers: BLCA; BRCA; CESC; LUAD; LUSC; OV; SARC; THCA; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.529; TCGA BRCA -0.195; TCGA CESC -0.372; TCGA LUAD -0.177; TCGA LUSC -0.235; TCGA OV -0.158; TCGA SARC -0.345; TCGA THCA -0.104; TCGA UCEC -0.135 |
hsa-miR-212-3p | BTBD7 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.116; TCGA BRCA -0.071; TCGA COAD -0.083; TCGA ESCA -0.113; TCGA KIRP -0.132; TCGA LUSC -0.059; TCGA SARC -0.075; TCGA STAD -0.15; TCGA UCEC -0.074 |
hsa-miR-212-3p | SEPSECS | 11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.145; TCGA BRCA -0.121; TCGA CESC -0.095; TCGA KIRC -0.167; TCGA KIRP -0.1; TCGA LGG -0.066; TCGA LIHC -0.222; TCGA LUAD -0.085; TCGA LUSC -0.128; TCGA STAD -0.112; TCGA UCEC -0.082 |
hsa-miR-212-3p | SAMD12 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC | miRNATAP | TCGA BLCA -0.47; TCGA BRCA -0.145; TCGA COAD -0.209; TCGA ESCA -0.53; TCGA KIRC -0.211; TCGA KIRP -0.113; TCGA LUAD -0.144; TCGA LUSC -0.288; TCGA PAAD -0.221; TCGA UCEC -0.318 |
hsa-miR-212-3p | CACNB4 | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.231; TCGA BRCA -0.094; TCGA CESC -0.213; TCGA ESCA -0.353; TCGA KIRC -0.214; TCGA LUAD -0.346; TCGA LUSC -0.424; TCGA SARC -0.191; TCGA THCA -0.457; TCGA STAD -0.211 |
hsa-miR-212-3p | EIF4A2 | 11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; OV; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.142; TCGA CESC -0.073; TCGA COAD -0.13; TCGA ESCA -0.163; TCGA KIRC -0.06; TCGA LIHC -0.096; TCGA OV -0.138; TCGA PRAD -0.056; TCGA SARC -0.103; TCGA STAD -0.192; TCGA UCEC -0.053 |
hsa-miR-212-3p | GIGYF1 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; PRAD | miRNATAP | TCGA BLCA -0.14; TCGA BRCA -0.053; TCGA CESC -0.083; TCGA HNSC -0.108; TCGA KIRP -0.217; TCGA LGG -0.104; TCGA LIHC -0.084; TCGA LUAD -0.189; TCGA PRAD -0.129 |
hsa-miR-212-3p | PIK3IP1 | 9 cancers: BLCA; BRCA; COAD; KIRC; LUAD; LUSC; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.273; TCGA BRCA -0.082; TCGA COAD -0.286; TCGA KIRC -0.102; TCGA LUAD -0.184; TCGA LUSC -0.157; TCGA SARC -0.171; TCGA STAD -0.135; TCGA UCEC -0.095 |
hsa-miR-212-3p | DCAF8 | 11 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.078; TCGA BRCA -0.105; TCGA ESCA -0.06; TCGA KIRC -0.059; TCGA LIHC -0.177; TCGA LUAD -0.091; TCGA LUSC -0.056; TCGA OV -0.087; TCGA SARC -0.068; TCGA STAD -0.119; TCGA UCEC -0.105 |
hsa-miR-212-3p | SAP30L | 11 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.096; TCGA CESC -0.097; TCGA COAD -0.123; TCGA ESCA -0.134; TCGA KIRC -0.069; TCGA LIHC -0.15; TCGA LUAD -0.084; TCGA LUSC -0.106; TCGA SARC -0.057; TCGA STAD -0.107; TCGA UCEC -0.062 |
hsa-miR-212-3p | GAB1 | 9 cancers: BRCA; COAD; ESCA; KIRC; LGG; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BRCA -0.078; TCGA COAD -0.174; TCGA ESCA -0.24; TCGA KIRC -0.081; TCGA LGG -0.085; TCGA LUAD -0.113; TCGA LUSC -0.159; TCGA STAD -0.295; TCGA UCEC -0.09 |
Enriched cancer pathways of putative targets