microRNA information: hsa-miR-214-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-214-5p | miRbase |
Accession: | MIMAT0004564 | miRbase |
Precursor name: | hsa-mir-214 | miRbase |
Precursor accession: | MI0000290 | miRbase |
Symbol: | MIR214 | HGNC |
RefSeq ID: | NR_029627 | GenBank |
Sequence: | UGCCUGUCUACACUUGCUGUGC |
Reported expression in cancers: hsa-miR-214-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-214-5p | bladder cancer | downregulation | "MicroRNA-214 miR-214 has been reported to be dysre ......" | 25706919 | |
hsa-miR-214-5p | breast cancer | upregulation | "An increasing number of studies has confirmed that ......" | 25738546 | |
hsa-miR-214-5p | breast cancer | downregulation | "miR-214 is involved in numerous physiological and ......" | 27422604 | |
hsa-miR-214-5p | cervical and endocervical cancer | downregulation | "We determined the expression level of miR-214 and ......" | 19859982 | |
hsa-miR-214-5p | colon cancer | upregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
hsa-miR-214-5p | colon cancer | downregulation | "miR-214 has been reported to be associated with se ......" | 25621032 | |
hsa-miR-214-5p | colorectal cancer | downregulation | "Identification of microRNA 214 as a negative regul ......" | 24616020 | Microarray; Reverse transcription PCR |
hsa-miR-214-5p | esophageal cancer | upregulation | "Prediction value of miR 483 and miR 214 in prognos ......" | 23721345 | qPCR |
hsa-miR-214-5p | gastric cancer | deregulation | "353 gastric samples from two independent subsets o ......" | 20022810 | Microarray |
hsa-miR-214-5p | gastric cancer | deregulation | "miRNA expression signature was first analyzed by r ......" | 21628394 | qPCR |
hsa-miR-214-5p | gastric cancer | upregulation | "The miRNAs differentially expressed in gastric can ......" | 24473397 | qPCR; Microarray |
hsa-miR-214-5p | gastric cancer | downregulation | "Clinicopathological significance of microRNA 214 i ......" | 24614175 | qPCR |
hsa-miR-214-5p | liver cancer | downregulation | "In this study we showed that miR-214 as well as mi ......" | 22359598 | |
hsa-miR-214-5p | liver cancer | downregulation | "The down-regulation of miR-214 has previously been ......" | 22962603 | qPCR |
hsa-miR-214-5p | liver cancer | downregulation | "MiR 214 inhibits cell growth in hepatocellular car ......" | 23068095 | |
hsa-miR-214-5p | liver cancer | downregulation | "miR-214 is one of the most significantly downregul ......" | 23962428 | |
hsa-miR-214-5p | melanoma | upregulation | "Using a melanoma progression model we identified a ......" | 21468029 | |
hsa-miR-214-5p | ovarian cancer | deregulation | "We found that in ovarian CAFs miR-31 and miR-214 w ......" | 23171795 | |
hsa-miR-214-5p | pancreatic cancer | deregulation | "Dysregulation of miR 15a and miR 214 in human panc ......" | 21106054 | qPCR |
hsa-miR-214-5p | prostate cancer | downregulation | "MicroRNA profiling in prostate cancer the diagnost ......" | 24167554 | qPCR |
hsa-miR-214-5p | sarcoma | upregulation | "Previous studies have shown that miR-214 functions ......" | 24802407 |
Reported cancer pathway affected by hsa-miR-214-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-214-5p | bladder cancer | Apoptosis pathway | "MicroRNA 214 suppresses oncogenesis and exerts imp ......" | 25706919 | Luciferase |
hsa-miR-214-5p | breast cancer | Apoptosis pathway | "MiR 214 increases the sensitivity of breast cancer ......" | 26666173 | Western blot; Luciferase |
hsa-miR-214-5p | breast cancer | Wnt signaling pathway; Apoptosis pathway; Notch signaling pathway | "The miRNAs and their clusters such as the miR-200 ......" | 26712794 | |
hsa-miR-214-5p | breast cancer | PI3K/Akt signaling pathway | "MicroRNA 214 acts as a potential oncogene in breas ......" | 26951965 | Luciferase |
hsa-miR-214-5p | breast cancer | cell cycle pathway; Apoptosis pathway | "Tumor suppressing roles of miR 214 and miR 218 in ......" | 27109339 | |
hsa-miR-214-5p | breast cancer | Apoptosis pathway | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 | |
hsa-miR-214-5p | cervical and endocervical cancer | Apoptosis pathway | "MiR 214 reduces cell survival and enhances cisplat ......" | 23337879 | |
hsa-miR-214-5p | cervical and endocervical cancer | cell cycle pathway | "The inhibitory role of miR 214 in cervical cancer ......" | 25556274 | Colony formation |
hsa-miR-214-5p | colon cancer | Apoptosis pathway | "microRNA 214 functions as a tumor suppressor in hu ......" | 25621032 | Colony formation; Western blot; Luciferase |
hsa-miR-214-5p | gastric cancer | Apoptosis pathway | "Clinicopathological significance of microRNA 214 i ......" | 24614175 | |
hsa-miR-214-5p | liver cancer | Apoptosis pathway | "In this study we showed that miR-214 as well as mi ......" | 22359598 | Western blot; Luciferase |
hsa-miR-214-5p | lung cancer | Wnt signaling pathway | "Targeting the Wnt Regulatory Protein CTNNBIP1 by m ......" | 26299367 | |
hsa-miR-214-5p | lung cancer | Epithelial mesenchymal transition pathway | "microRNA 214 promotes epithelial mesenchymal trans ......" | 26462018 | |
hsa-miR-214-5p | ovarian cancer | Apoptosis pathway | "MiR 214 suppressed ovarian cancer and negatively r ......" | 26718213 | Luciferase |
hsa-miR-214-5p | sarcoma | Apoptosis pathway | "MiR 214 and N ras regulatory loop suppresses rhabd ......" | 24811402 | Colony formation |
hsa-miR-214-5p | sarcoma | Apoptosis pathway | "MicroRNA 214 Promotes Apoptosis in Canine Hemangio ......" | 26335793 |
Reported cancer prognosis affected by hsa-miR-214-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-214-5p | B cell lymphoma | poor survival | "Comprehensive miRNA sequence analysis reveals surv ......" | 25723320 | |
hsa-miR-214-5p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
hsa-miR-214-5p | bladder cancer | staging; recurrence; progression | "Cell Free microRNA 214 From Urine as a Biomarker f ......" | 24255763 | |
hsa-miR-214-5p | bladder cancer | worse prognosis; staging; poor survival; recurrence | "MicroRNA 214 suppresses oncogenesis and exerts imp ......" | 25706919 | Luciferase |
hsa-miR-214-5p | bladder cancer | staging; poor survival; recurrence | "Downregulation of urinary cell free microRNA 214 a ......" | 25975233 | |
hsa-miR-214-5p | breast cancer | tumorigenesis | "Decreased microRNA 214 levels in breast cancer cel ......" | 21828058 | Luciferase |
hsa-miR-214-5p | breast cancer | malignant trasformation | "Diagnostic potential of PTEN targeting miR 214 in ......" | 22350790 | |
hsa-miR-214-5p | breast cancer | poor survival | "High expression of miR 214 is associated with a wo ......" | 25705321 | |
hsa-miR-214-5p | breast cancer | progression | "microRNA 214 enhances the invasion ability of brea ......" | 25738546 | Luciferase |
hsa-miR-214-5p | breast cancer | drug resistance | "MiR 214 increases the sensitivity of breast cancer ......" | 26666173 | Western blot; Luciferase |
hsa-miR-214-5p | breast cancer | tumorigenesis | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 | |
hsa-miR-214-5p | cervical and endocervical cancer | metastasis | "Plexin B1 is a target of miR 214 in cervical cance ......" | 21216304 | Western blot |
hsa-miR-214-5p | cervical and endocervical cancer | poor survival | "MiR 214 reduces cell survival and enhances cisplat ......" | 23337879 | |
hsa-miR-214-5p | cervical and endocervical cancer | progression | "The inhibitory role of miR 214 in cervical cancer ......" | 25556274 | Colony formation |
hsa-miR-214-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-214-5p | colorectal cancer | metastasis; worse prognosis; poor survival | "Identification of microRNA 214 as a negative regul ......" | 24616020 | |
hsa-miR-214-5p | colorectal cancer | progression | "MicroRNA 214 suppresses growth migration and invas ......" | 27537384 | Luciferase |
hsa-miR-214-5p | esophageal cancer | staging; metastasis | "MicroRNA 98 and microRNA 214 post transcriptionall ......" | 22867052 | Western blot |
hsa-miR-214-5p | esophageal cancer | worse prognosis; drug resistance; poor survival | "Prediction value of miR 483 and miR 214 in prognos ......" | 23721345 | |
hsa-miR-214-5p | gastric cancer | staging; metastasis; poor survival | "353 gastric samples from two independent subsets o ......" | 20022810 | |
hsa-miR-214-5p | gastric cancer | progression; worse prognosis | "MiR 214 regulate gastric cancer cell proliferation ......" | 23834902 | Western blot; Luciferase |
hsa-miR-214-5p | gastric cancer | progression; tumorigenesis; worse prognosis; metastasis; cell migration | "Clinicopathological significance of microRNA 214 i ......" | 24614175 | |
hsa-miR-214-5p | gastric cancer | metastasis | "Hemolysis free plasma miR 214 as novel biomarker o ......" | 25973319 | |
hsa-miR-214-5p | gastric cancer | metastasis; progression | "MicroRNA 214 promotes peritoneal metastasis throug ......" | 27339596 | Western blot |
hsa-miR-214-5p | liver cancer | tumorigenesis; poor survival; progression | "In this study we showed that miR-214 as well as mi ......" | 22359598 | Western blot; Luciferase |
hsa-miR-214-5p | liver cancer | recurrence; metastasis | "MiR 214 targets β catenin pathway to suppress inv ......" | 22962603 | Luciferase |
hsa-miR-214-5p | liver cancer | tumorigenesis | "MiR 214 inhibits cell growth in hepatocellular car ......" | 23068095 | |
hsa-miR-214-5p | liver cancer | metastasis; progression; recurrence | "Downregulation of microRNA 214 and overexpression ......" | 23962428 | Western blot; Luciferase |
hsa-miR-214-5p | lung cancer | metastasis; progression; staging | "microRNA 214 promotes epithelial mesenchymal trans ......" | 26462018 | |
hsa-miR-214-5p | lung cancer | metastasis; progression | "microRNA 214 Governs Lung Cancer Growth and Metast ......" | 27494742 | |
hsa-miR-214-5p | melanoma | progression; metastasis; poor survival | "microRNA 214 contributes to melanoma tumour progre ......" | 21468029 | |
hsa-miR-214-5p | melanoma | progression; metastasis | "miR 214 coordinates melanoma progression by upregu ......" | 23667173 | |
hsa-miR-214-5p | melanoma | metastasis | "miR 214 and miR 148b Targeting Inhibits Disseminat ......" | 27328731 | |
hsa-miR-214-5p | ovarian cancer | poor survival; drug resistance | "MicroRNA expression profiling in human ovarian can ......" | 18199536 | |
hsa-miR-214-5p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
hsa-miR-214-5p | ovarian cancer | drug resistance | "Furthermore we discuss several other microRNAs tha ......" | 20083225 | |
hsa-miR-214-5p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
hsa-miR-214-5p | ovarian cancer | metastasis; drug resistance | "MicroRNA miR 214 regulates ovarian cancer cell ste ......" | 22927443 | |
hsa-miR-214-5p | ovarian cancer | staging | "Moreover miRNAs also have possible implications fo ......" | 23237306 | |
hsa-miR-214-5p | ovarian cancer | poor survival | "Nucleoside analog inhibits microRNA 214 through ta ......" | 24033540 | |
hsa-miR-214-5p | ovarian cancer | metastasis; drug resistance | "For example deficiencies of enzymes including Dice ......" | 24822185 | |
hsa-miR-214-5p | ovarian cancer | drug resistance | "miR 214 mediated downregulation of RNF8 induces ch ......" | 25483088 | |
hsa-miR-214-5p | ovarian cancer | malignant trasformation; progression | "MiR 214 suppressed ovarian cancer and negatively r ......" | 26718213 | Luciferase |
hsa-miR-214-5p | pancreatic cancer | drug resistance | "Dysregulation of miR 15a and miR 214 in human panc ......" | 21106054 | |
hsa-miR-214-5p | pancreatic cancer | poor survival | "Quantitative real-time PCR qRT-PCR was subsequentl ......" | 26819679 | |
hsa-miR-214-5p | sarcoma | progression; worse prognosis; metastasis; tumor size; drug resistance; poor survival | "Upregulated expression of microRNA 214 is linked t ......" | 24038809 | |
hsa-miR-214-5p | sarcoma | tumorigenesis; differentiation | "MiR 214 and N ras regulatory loop suppresses rhabd ......" | 24811402 | Colony formation |
hsa-miR-214-5p | sarcoma | poor survival | "MicroRNA 214 regulates osteosarcoma survival and g ......" | 25310480 | |
hsa-miR-214-5p | sarcoma | poor survival | "Using a qPCR-based platform that analyzes more tha ......" | 25784290 | |
hsa-miR-214-5p | sarcoma | tumorigenesis | "MicroRNA 214 Promotes Apoptosis in Canine Hemangio ......" | 26335793 |
Reported gene related to hsa-miR-214-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-214-5p | breast cancer | PTEN | "MicroRNA 214 acts as a potential oncogene in breas ......" | 26951965 |
hsa-miR-214-5p | breast cancer | PTEN | "Diagnostic potential of PTEN targeting miR 214 in ......" | 22350790 |
hsa-miR-214-5p | gastric cancer | PTEN | "MicroRNA 214 promotes peritoneal metastasis throug ......" | 27339596 |
hsa-miR-214-5p | gastric cancer | PTEN | "MiR 214 regulate gastric cancer cell proliferation ......" | 23834902 |
hsa-miR-214-5p | ovarian cancer | PTEN | "MicroRNA expression profiling in human ovarian can ......" | 18199536 |
hsa-miR-214-5p | breast cancer | TP53 | "microRNA 214 enhances the invasion ability of brea ......" | 25738546 |
hsa-miR-214-5p | breast cancer | TP53 | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 |
hsa-miR-214-5p | ovarian cancer | TP53 | "Enforcing expression of miR-214 increases whereas ......" | 22927443 |
hsa-miR-214-5p | sarcoma | TP53 | "MicroRNA 214 Promotes Apoptosis in Canine Hemangio ......" | 26335793 |
hsa-miR-214-5p | breast cancer | EZH2 | "Decreased microRNA 214 levels in breast cancer cel ......" | 21828058 |
hsa-miR-214-5p | esophageal cancer | EZH2 | "In Eca109 cells overexpression of miR-98 and miR-2 ......" | 22867052 |
hsa-miR-214-5p | liver cancer | EZH2 | "The enhancer of zeste homologue 2 EZH2 and β-cate ......" | 22962603 |
hsa-miR-214-5p | melanoma | ALCAM | "miR 214 coordinates melanoma progression by upregu ......" | 23667173 |
hsa-miR-214-5p | melanoma | ALCAM | "Notably transendothelial migration in vitro and ex ......" | 27328731 |
hsa-miR-214-5p | ovarian cancer | CCL5 | "The most highly upregulated chemokine CCL5 C-C mot ......" | 23171795 |
hsa-miR-214-5p | ovarian cancer | CCL5 | "They identified CCL5 a protumorigenic chemokine th ......" | 23230184 |
hsa-miR-214-5p | colorectal cancer | FGFR1 | "Further studies indicated that fibroblast growth f ......" | 24616020 |
hsa-miR-214-5p | liver cancer | FGFR1 | "Downregulation of microRNA 214 and overexpression ......" | 23962428 |
hsa-miR-214-5p | bladder cancer | FRTS1 | "Moreover miR-214 could serve as an independent fac ......" | 25706919 |
hsa-miR-214-5p | bladder cancer | FRTS1 | "Additionally miR-214 in urine supernatant could se ......" | 25975233 |
hsa-miR-214-5p | lung cancer | NANOG | "Strikingly downregulation of miR-214 expression in ......" | 26299367 |
hsa-miR-214-5p | ovarian cancer | NANOG | "Enforcing expression of miR-214 increases whereas ......" | 22927443 |
hsa-miR-214-5p | breast cancer | SUFU | "Crosstalk between the vitamin D receptor VDR and m ......" | 27693451 |
hsa-miR-214-5p | lung cancer | SUFU | "microRNA 214 promotes epithelial mesenchymal trans ......" | 26462018 |
hsa-miR-214-5p | esophageal cancer | AKR1B1 | "Downregulation of miR-483 and miR-214 could confer ......" | 23721345 |
hsa-miR-214-5p | colon cancer | ARL2 | "ADP-ribosylation factor-like protein 2 ARL2 is pre ......" | 25621032 |
hsa-miR-214-5p | cervical and endocervical cancer | BCL2L2 | "MiR 214 reduces cell survival and enhances cisplat ......" | 23337879 |
hsa-miR-214-5p | esophageal cancer | CDC37 | "MicroRNA 98 and microRNA 214 post transcriptionall ......" | 22867052 |
hsa-miR-214-5p | lung cancer | CPD | "microRNA 214 Governs Lung Cancer Growth and Metast ......" | 27494742 |
hsa-miR-214-5p | gastric cancer | CSF1 | "Colony stimulating factor 1 CSF1 was identified as ......" | 24614175 |
hsa-miR-214-5p | gastric cancer | CSF2 | "Colony stimulating factor 1 CSF1 was identified as ......" | 24614175 |
hsa-miR-214-5p | liver cancer | CTNNB1 | "The enhancer of zeste homologue 2 EZH2 and β-cate ......" | 22962603 |
hsa-miR-214-5p | lung cancer | CTNNBIP1 | "Targeting the Wnt Regulatory Protein CTNNBIP1 by m ......" | 26299367 |
hsa-miR-214-5p | cervical and endocervical cancer | GALNT7 | "MicroRNA 214 suppresses growth and invasiveness of ......" | 22399294 |
hsa-miR-214-5p | pancreatic cancer | GEM | "In vitro experiments showed that overexpression of ......" | 21106054 |
hsa-miR-214-5p | colorectal cancer | HMGA1 | "HMGA1 and miR-214 expression levels were estimated ......" | 27537384 |
hsa-miR-214-5p | ovarian cancer | HSF1 | "Moreover by targeting HSF1 Ly101-4B inhibits the b ......" | 24033540 |
hsa-miR-214-5p | melanoma | ITGA5 | "Notably transendothelial migration in vitro and ex ......" | 27328731 |
hsa-miR-214-5p | lung cancer | LCT | "We demonstrate that miR-214 overexpression enhance ......" | 26299367 |
hsa-miR-214-5p | sarcoma | LZTS1 | "miR 214 promotes the proliferation and invasion of ......" | 24802407 |
hsa-miR-214-5p | cervical and endocervical cancer | MAP2K3 | "HeLa cells that stably overexpress miR-214 downreg ......" | 19859982 |
hsa-miR-214-5p | cervical and endocervical cancer | MAPK8 | "HeLa cells that stably overexpress miR-214 downreg ......" | 19859982 |
hsa-miR-214-5p | esophageal cancer | MPP2 | "MicroRNA 98 and microRNA 214 post transcriptionall ......" | 22867052 |
hsa-miR-214-5p | gastric cancer | MTHFR | "In this study we explored the effect of a function ......" | 25998065 |
hsa-miR-214-5p | bladder cancer | NMI | "Thus urinary cell-free microRNA-214 might be a use ......" | 24255763 |
hsa-miR-214-5p | sarcoma | NRAS | "MiR 214 and N ras regulatory loop suppresses rhabd ......" | 24811402 |
hsa-miR-214-5p | bladder cancer | PDRG1 | "MicroRNA 214 suppresses oncogenesis and exerts imp ......" | 25706919 |
hsa-miR-214-5p | cervical and endocervical cancer | PLXNB1 | "Plexin B1 is a target of miR 214 in cervical cance ......" | 21216304 |
hsa-miR-214-5p | liver cancer | RAB15 | "The editing event caused a decrease of the RNA tra ......" | 24386085 |
hsa-miR-214-5p | breast cancer | RFWD2 | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 |
hsa-miR-214-5p | ovarian cancer | RNF8 | "miR 214 mediated downregulation of RNF8 induces ch ......" | 25483088 |
hsa-miR-214-5p | ovarian cancer | SEMA4D | "MiR 214 suppressed ovarian cancer and negatively r ......" | 26718213 |
hsa-miR-214-5p | ovarian cancer | SEMA6A | "MiR-214 and semaphorin 4D sema 4D were found to be ......" | 26718213 |
hsa-miR-214-5p | breast cancer | TAM | "MiR-214 increased the sensitivity of breast cancer ......" | 26666173 |
hsa-miR-214-5p | cervical and endocervical cancer | TFAM | "The inhibitory role of miR 214 in cervical cancer ......" | 25556274 |
hsa-miR-214-5p | melanoma | TFAP2A | "miR 214 coordinates melanoma progression by upregu ......" | 23667173 |
hsa-miR-214-5p | melanoma | TFAP2C | "microRNA 214 contributes to melanoma tumour progre ......" | 21468029 |
hsa-miR-214-5p | breast cancer | UCP2 | "The expression of miR-214 and uncoupling protein 2 ......" | 26666173 |
hsa-miR-214-5p | breast cancer | VDR | "Crosstalk between the vitamin D receptor VDR and m ......" | 27693451 |
hsa-miR-214-5p | colon cancer | WDTC1 | "microRNA 214 functions as a tumor suppressor in hu ......" | 25621032 |
hsa-miR-214-5p | liver cancer | XBP1 | "To further explore the role of miR-214 in hepatoca ......" | 22359598 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-214-5p | LRTOMT | 10 cancers: BLCA; BRCA; KIRP; LIHC; LUSC; OV; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.071; TCGA BRCA -0.081; TCGA KIRP -0.056; TCGA LIHC -0.07; TCGA LUSC -0.118; TCGA OV -0.092; TCGA PAAD -0.204; TCGA PRAD -0.056; TCGA SARC -0.094; TCGA THCA -0.064 |
hsa-miR-214-5p | GGA3 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD | MirTarget | TCGA BLCA -0.092; TCGA BRCA -0.092; TCGA CESC -0.056; TCGA ESCA -0.116; TCGA HNSC -0.051; TCGA KIRP -0.057; TCGA LIHC -0.109; TCGA LUSC -0.106; TCGA PAAD -0.082 |
hsa-miR-214-5p | WASL | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.11; TCGA COAD -0.121; TCGA ESCA -0.094; TCGA HNSC -0.083; TCGA KIRP -0.081; TCGA LUAD -0.116; TCGA LUSC -0.07; TCGA PRAD -0.084; TCGA THCA -0.053; TCGA STAD -0.068 |
hsa-miR-214-5p | NHEJ1 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PRAD | miRNATAP | TCGA BLCA -0.057; TCGA BRCA -0.08; TCGA COAD -0.062; TCGA ESCA -0.126; TCGA HNSC -0.06; TCGA KIRC -0.082; TCGA LIHC -0.101; TCGA LUAD -0.097; TCGA PRAD -0.091 |
hsa-miR-214-5p | POM121 | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD | miRNATAP | TCGA BLCA -0.05; TCGA BRCA -0.068; TCGA ESCA -0.075; TCGA HNSC -0.053; TCGA KIRC -0.083; TCGA KIRP -0.085; TCGA LIHC -0.063; TCGA PAAD -0.184; TCGA PRAD -0.124 |
hsa-miR-214-5p | UBE2K | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.072; TCGA BRCA -0.057; TCGA COAD -0.112; TCGA ESCA -0.061; TCGA HNSC -0.062; TCGA LUAD -0.112; TCGA PAAD -0.055; TCGA PRAD -0.142; TCGA STAD -0.118 |
hsa-miR-214-5p | MAT2A | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUSC; OV; SARC; STAD | miRNATAP | TCGA BLCA -0.118; TCGA COAD -0.125; TCGA ESCA -0.17; TCGA HNSC -0.072; TCGA KIRC -0.073; TCGA LUSC -0.08; TCGA OV -0.067; TCGA SARC -0.091; TCGA STAD -0.118 |
hsa-miR-214-5p | PARS2 | 10 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; OV; PAAD; PRAD; THCA; UCEC | MirTarget | TCGA BRCA -0.11; TCGA ESCA -0.153; TCGA HNSC -0.082; TCGA KIRP -0.077; TCGA LIHC -0.107; TCGA OV -0.143; TCGA PAAD -0.123; TCGA PRAD -0.101; TCGA THCA -0.074; TCGA UCEC -0.075 |
hsa-miR-214-5p | YEATS4 | 10 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | MirTarget | TCGA BRCA -0.14; TCGA COAD -0.181; TCGA HNSC -0.075; TCGA LIHC -0.075; TCGA LUAD -0.177; TCGA LUSC -0.078; TCGA OV -0.142; TCGA PAAD -0.174; TCGA PRAD -0.159; TCGA UCEC -0.064 |
hsa-miR-214-5p | SUZ12 | 10 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BRCA -0.088; TCGA COAD -0.141; TCGA HNSC -0.126; TCGA LIHC -0.069; TCGA LUAD -0.123; TCGA LUSC -0.152; TCGA PRAD -0.207; TCGA SARC -0.113; TCGA STAD -0.096; TCGA UCEC -0.062 |
hsa-miR-214-5p | SLC35A3 | 9 cancers: COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA COAD -0.194; TCGA ESCA -0.369; TCGA HNSC -0.185; TCGA LUAD -0.08; TCGA LUSC -0.11; TCGA PRAD -0.266; TCGA SARC -0.071; TCGA STAD -0.233; TCGA UCEC -0.108 |
Enriched cancer pathways of putative targets