microRNA information: hsa-miR-215-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-215-5p | miRbase |
Accession: | MIMAT0000272 | miRbase |
Precursor name: | hsa-mir-215 | miRbase |
Precursor accession: | MI0000291 | miRbase |
Symbol: | MIR215 | HGNC |
RefSeq ID: | NR_029628 | GenBank |
Sequence: | AUGACCUAUGAAUUGACAGAC |
Reported expression in cancers: hsa-miR-215-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-215-5p | acute myeloid leukemia | downregulation | "Reduced miR 215 expression predicts poor prognosis ......" | 26802165 | qPCR |
hsa-miR-215-5p | breast cancer | upregulation | "Aberrant miR 215 expression is associated with cli ......" | 25270284 | |
hsa-miR-215-5p | colon cancer | deregulation | "The aberrant expression of miRNA-215 miR-215 has b ......" | 27663660 | |
hsa-miR-215-5p | colorectal cancer | downregulation | "MicroRNA 215 inhibits relapse of colorectal cancer ......" | 23532818 | qPCR |
hsa-miR-215-5p | gastric cancer | upregulation | "Here we report that miR-215 is significantly up-re ......" | 23981575 | |
hsa-miR-215-5p | gastric cancer | upregulation | "However the role of miR-215 or miR-192 in gastric ......" | 24981590 | qPCR |
hsa-miR-215-5p | gastric cancer | upregulation | "Thus the differential expression of a panel of miR ......" | 26171025 | Microarray; qPCR |
hsa-miR-215-5p | gastric cancer | upregulation | "miR-215 was reported to be downregulated and funct ......" | 26716895 | |
hsa-miR-215-5p | kidney renal cell cancer | downregulation | "Here we investigated three miRNAs that are signifi ......" | 23715501 | |
hsa-miR-215-5p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-215-5p | liver cancer | upregulation | "Serum microRNA 143 and microRNA 215 as potential b ......" | 24993656 | qPCR |
hsa-miR-215-5p | liver cancer | upregulation | "MicroRNA 215 is upregulated by treatment with Adri ......" | 26135967 | |
hsa-miR-215-5p | lung squamous cell cancer | downregulation | "MicroRNA-215 miR-215 has previously been demonstra ......" | 26622784 | qPCR |
hsa-miR-215-5p | pancreatic cancer | downregulation | "It has been shown that microRNA-215 miR-215 is dys ......" | 26662405 | qPCR |
hsa-miR-215-5p | prostate cancer | deregulation | "Upregulation of miR-122 miR-335 miR-184 miR-193 mi ......" | 23781281 | |
hsa-miR-215-5p | sarcoma | upregulation | "Further studies revealed that over-expression of m ......" | 20433742 |
Reported cancer pathway affected by hsa-miR-215-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-215-5p | colon cancer | cell cycle pathway | "Prognostic significance of miR 215 in colon cancer ......" | 21752725 | |
hsa-miR-215-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "We chose miR-215 miR-375 miR-378 miR-422a and miR- ......" | 22469014 | |
hsa-miR-215-5p | colorectal cancer | cell cycle pathway | "The CDX1 microRNA 215 axis regulates colorectal ca ......" | 25775580 | Luciferase |
hsa-miR-215-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "miR 215 promotes malignant progression of gastric ......" | 26716895 | Luciferase; Colony formation |
hsa-miR-215-5p | lung squamous cell cancer | Apoptosis pathway | "miR 215 functions as a tumor suppressor and direct ......" | 26622784 | Luciferase |
hsa-miR-215-5p | ovarian cancer | Apoptosis pathway | "miR 215 functions as a tumor suppressor in epithel ......" | 26676658 | |
hsa-miR-215-5p | pancreatic cancer | Apoptosis pathway | "MicroRNA 215 functions as a tumor suppressor and d ......" | 26662405 | Luciferase |
hsa-miR-215-5p | sarcoma | cell cycle pathway | "Molecular mechanism of chemoresistance by miR 215 ......" | 20433742 |
Reported cancer prognosis affected by hsa-miR-215-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-215-5p | acute myeloid leukemia | worse prognosis; poor survival | "Reduced miR 215 expression predicts poor prognosis ......" | 26802165 | |
hsa-miR-215-5p | breast cancer | metastasis; worse prognosis; malignant trasformation; tumor size; poor survival | "Aberrant miR 215 expression is associated with cli ......" | 25270284 | |
hsa-miR-215-5p | breast cancer | metastasis | "These included miR-141 miR-144 miR-193b miR-200a m ......" | 26785733 | |
hsa-miR-215-5p | cervical and endocervical cancer | staging; metastasis; progression; poor survival; recurrence | "MicroRNA 215 is a potential prognostic marker for ......" | 24710934 | |
hsa-miR-215-5p | colon cancer | drug resistance; poor survival; staging | "Prognostic significance of miR 215 in colon cancer ......" | 21752725 | |
hsa-miR-215-5p | colon cancer | staging | "Using miRNA microarrays we analysed 40 paired stag ......" | 24239208 | |
hsa-miR-215-5p | colon cancer | staging | "Six miRNAs previously identified as prognostic mar ......" | 27247088 | |
hsa-miR-215-5p | colorectal cancer | staging | "We chose miR-215 miR-375 miR-378 miR-422a and miR- ......" | 22469014 | |
hsa-miR-215-5p | colorectal cancer | staging | "MicroRNA 215 inhibits relapse of colorectal cancer ......" | 23532818 | |
hsa-miR-215-5p | colorectal cancer | staging | "The Agilent Human miRNA Microarray V19.0 was used ......" | 25484364 | |
hsa-miR-215-5p | colorectal cancer | differentiation | "The CDX1 microRNA 215 axis regulates colorectal ca ......" | 25775580 | Luciferase |
hsa-miR-215-5p | gastric cancer | tumorigenesis; metastasis; worse prognosis | "However the role of miR-215 or miR-192 in gastric ......" | 24981590 | |
hsa-miR-215-5p | gastric cancer | staging; metastasis; differentiation | "Thus the differential expression of a panel of miR ......" | 26171025 | |
hsa-miR-215-5p | gastric cancer | malignant trasformation; progression; metastasis; staging | "miR 215 promotes malignant progression of gastric ......" | 26716895 | Luciferase; Colony formation |
hsa-miR-215-5p | kidney renal cell cancer | metastasis; progression | "miRNA profiling in metastatic renal cell carcinoma ......" | 22033272 | |
hsa-miR-215-5p | kidney renal cell cancer | poor survival | "Here we investigated three miRNAs that are signifi ......" | 23715501 | Luciferase |
hsa-miR-215-5p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-215-5p | liver cancer | drug resistance | "MicroRNA 215 is upregulated by treatment with Adri ......" | 26135967 | Colony formation |
hsa-miR-215-5p | lung squamous cell cancer | progression; tumorigenesis; staging; metastasis | "miR 215 functions as a tumor suppressor and direct ......" | 26622784 | Luciferase |
hsa-miR-215-5p | ovarian cancer | drug resistance | "Analysis of microarray identified genes and microR ......" | 26261572 | |
hsa-miR-215-5p | pancreatic cancer | progression; worse prognosis; staging; metastasis; poor survival; tumor size | "MicroRNA 215 functions as a tumor suppressor and d ......" | 26662405 | Luciferase |
hsa-miR-215-5p | sarcoma | drug resistance | "Molecular mechanism of chemoresistance by miR 215 ......" | 20433742 | |
hsa-miR-215-5p | sarcoma | metastasis | "This potential path highlights the crucial role of ......" | 25984907 |
Reported gene related to hsa-miR-215-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-215-5p | colorectal cancer | ALCAM | "Enhanced expression of CD44 CD166 and miR-21 with ......" | 27153478 |
hsa-miR-215-5p | gastric cancer | ALCAM | "Luciferase assays suggested that microRNA-215 inhi ......" | 21119604 |
hsa-miR-215-5p | colon cancer | DTL | "miR-215 is a tumor suppressor candidate due to the ......" | 21752725 |
hsa-miR-215-5p | sarcoma | DTL | "Taken together our results indicate that miR-215 t ......" | 20433742 |
hsa-miR-215-5p | lung squamous cell cancer | ZEB2 | "miR 215 functions as a tumor suppressor and direct ......" | 26622784 |
hsa-miR-215-5p | pancreatic cancer | ZEB2 | "MicroRNA 215 functions as a tumor suppressor and d ......" | 26662405 |
hsa-miR-215-5p | colorectal cancer | BMI1 | "In particular the miR-215 target gene BMI1 has bee ......" | 25775580 |
hsa-miR-215-5p | colorectal cancer | CD44 | "Enhanced expression of CD44 CD166 and miR-21 with ......" | 27153478 |
hsa-miR-215-5p | colorectal cancer | CDKN1A | "Interestingly cell-unique downregulation of miR-22 ......" | 26634414 |
hsa-miR-215-5p | colorectal cancer | CDX1 | "The CDX1 microRNA 215 axis regulates colorectal ca ......" | 25775580 |
hsa-miR-215-5p | sarcoma | DHFR | "In this study we investigated the roles of miR-215 ......" | 20433742 |
hsa-miR-215-5p | sarcoma | MTX1 | "In this study we investigated the roles of miR-215 ......" | 20433742 |
hsa-miR-215-5p | gastric cancer | RUNX1 | "miR 215 promotes malignant progression of gastric ......" | 26716895 |
hsa-miR-215-5p | colon cancer | TP53 | "miR-215 is a tumor suppressor candidate due to the ......" | 21752725 |
hsa-miR-215-5p | ovarian cancer | XIAP | "Upregulation of miR-215 notably inhibited the expr ......" | 26676658 |
hsa-miR-215-5p | colon cancer | YY1 | "MicroRNA 215 suppresses cell proliferation migrati ......" | 27663660 |
hsa-miR-215-5p | lung squamous cell cancer | ZEB2-AS1 | "Furthermore luciferase reporter assay analysis ide ......" | 26622784 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-215-5p | ANKRD6 | 9 cancers: BLCA; COAD; ESCA; LGG; LUAD; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.066; TCGA COAD -0.229; TCGA ESCA -0.149; TCGA LGG -0.052; TCGA LUAD -0.051; TCGA PAAD -0.076; TCGA THCA -0.094; TCGA STAD -0.127; TCGA UCEC -0.15 |
hsa-miR-215-5p | ARL4C | 9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LIHC; LUSC; PAAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.138; TCGA CESC -0.06; TCGA COAD -0.131; TCGA ESCA -0.232; TCGA KIRP -0.246; TCGA LIHC -0.11; TCGA LUSC -0.083; TCGA PAAD -0.112; TCGA STAD -0.113 |
hsa-miR-215-5p | C1QTNF3 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.128; TCGA BRCA -0.224; TCGA COAD -0.228; TCGA ESCA -0.123; TCGA KIRC -0.108; TCGA KIRP -0.313; TCGA LIHC -0.374; TCGA LUAD -0.104; TCGA LUSC -0.135; TCGA STAD -0.176; TCGA UCEC -0.141 |
hsa-miR-215-5p | CLIP4 | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.244; TCGA CESC -0.232; TCGA COAD -0.245; TCGA ESCA -0.301; TCGA HNSC -0.072; TCGA KIRC -0.109; TCGA LGG -0.058; TCGA LIHC -0.25; TCGA LUAD -0.065; TCGA LUSC -0.138; TCGA PAAD -0.161; TCGA THCA -0.115; TCGA STAD -0.23; TCGA UCEC -0.139 |
hsa-miR-215-5p | CLSTN1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA | miRNAWalker2 validate | TCGA BLCA -0.076; TCGA BRCA -0.067; TCGA CESC -0.084; TCGA ESCA -0.104; TCGA HNSC -0.091; TCGA KIRC -0.066; TCGA KIRP -0.069; TCGA LIHC -0.101; TCGA LUSC -0.134; TCGA THCA -0.065 |
hsa-miR-215-5p | CORO2B | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.114; TCGA CESC -0.162; TCGA COAD -0.245; TCGA ESCA -0.082; TCGA KIRC -0.3; TCGA LIHC -0.123; TCGA PAAD -0.212; TCGA STAD -0.122; TCGA UCEC -0.345 |
hsa-miR-215-5p | DNAJB5 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.252; TCGA CESC -0.119; TCGA COAD -0.213; TCGA ESCA -0.228; TCGA HNSC -0.143; TCGA LGG -0.058; TCGA LIHC -0.079; TCGA PAAD -0.147; TCGA SARC -0.149; TCGA THCA -0.148; TCGA STAD -0.286; TCGA UCEC -0.172 |
hsa-miR-215-5p | FGF2 | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.235; TCGA COAD -0.2; TCGA ESCA -0.105; TCGA KIRC -0.156; TCGA KIRP -0.272; TCGA LIHC -0.153; TCGA THCA -0.114; TCGA STAD -0.156; TCGA UCEC -0.327 |
hsa-miR-215-5p | FZD1 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.051; TCGA CESC -0.088; TCGA COAD -0.071; TCGA ESCA -0.139; TCGA KIRP -0.109; TCGA LUAD -0.127; TCGA LUSC -0.096; TCGA PAAD -0.067; TCGA STAD -0.074; TCGA UCEC -0.098 |
hsa-miR-215-5p | HSPA2 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.09; TCGA BRCA -0.186; TCGA CESC -0.176; TCGA COAD -0.122; TCGA ESCA -0.239; TCGA KIRC -0.527; TCGA LIHC -0.07; TCGA STAD -0.213; TCGA UCEC -0.149 |
hsa-miR-215-5p | IGF1R | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.142; TCGA BRCA -0.089; TCGA CESC -0.171; TCGA COAD -0.097; TCGA ESCA -0.168; TCGA PAAD -0.154; TCGA THCA -0.062; TCGA STAD -0.126; TCGA UCEC -0.113 |
hsa-miR-215-5p | KCTD15 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.138; TCGA BRCA -0.112; TCGA CESC -0.221; TCGA ESCA -0.266; TCGA HNSC -0.104; TCGA LIHC -0.101; TCGA LUSC -0.136; TCGA PAAD -0.078; TCGA STAD -0.185; TCGA UCEC -0.23 |
hsa-miR-215-5p | MCAM | 10 cancers: BLCA; CESC; COAD; LIHC; LUAD; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.107; TCGA CESC -0.233; TCGA COAD -0.087; TCGA LIHC -0.119; TCGA LUAD -0.055; TCGA PAAD -0.096; TCGA SARC -0.167; TCGA THCA -0.192; TCGA STAD -0.149; TCGA UCEC -0.156 |
hsa-miR-215-5p | MSN | 9 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; PAAD; THCA; STAD | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.172; TCGA CESC -0.245; TCGA COAD -0.148; TCGA ESCA -0.217; TCGA LIHC -0.067; TCGA LUAD -0.102; TCGA PAAD -0.081; TCGA THCA -0.221; TCGA STAD -0.106 |
hsa-miR-215-5p | NT5M | 11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.139; TCGA BRCA -0.13; TCGA ESCA -0.15; TCGA KIRC -0.089; TCGA KIRP -0.083; TCGA LGG -0.087; TCGA LUAD -0.061; TCGA PAAD -0.169; TCGA SARC -0.154; TCGA STAD -0.11; TCGA UCEC -0.072 |
hsa-miR-215-5p | PDLIM3 | 9 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.408; TCGA CESC -0.233; TCGA COAD -0.279; TCGA ESCA -0.186; TCGA LIHC -0.12; TCGA LUAD -0.052; TCGA SARC -0.283; TCGA STAD -0.26; TCGA UCEC -0.499 |
hsa-miR-215-5p | PLAU | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA | miRNAWalker2 validate | TCGA BLCA -0.187; TCGA BRCA -0.081; TCGA CESC -0.227; TCGA ESCA -0.195; TCGA HNSC -0.235; TCGA KIRC -0.225; TCGA LIHC -0.138; TCGA LUAD -0.167; TCGA LUSC -0.224; TCGA PAAD -0.125; TCGA THCA -0.432 |
hsa-miR-215-5p | PLS3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.13; TCGA CESC -0.097; TCGA COAD -0.098; TCGA ESCA -0.148; TCGA HNSC -0.059; TCGA KIRC -0.17; TCGA LUAD -0.139; TCGA THCA -0.068; TCGA STAD -0.089 |
hsa-miR-215-5p | PRICKLE1 | 13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.245; TCGA CESC -0.256; TCGA COAD -0.333; TCGA ESCA -0.255; TCGA KIRC -0.118; TCGA KIRP -0.149; TCGA LGG -0.063; TCGA LUAD -0.101; TCGA LUSC -0.137; TCGA PAAD -0.207; TCGA THCA -0.219; TCGA STAD -0.162; TCGA UCEC -0.295 |
hsa-miR-215-5p | PRNP | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.206; TCGA CESC -0.218; TCGA COAD -0.118; TCGA ESCA -0.231; TCGA HNSC -0.135; TCGA LUAD -0.062; TCGA LUSC -0.157; TCGA PAAD -0.113; TCGA THCA -0.052; TCGA STAD -0.208; TCGA UCEC -0.211 |
hsa-miR-215-5p | PRSS23 | 9 cancers: BLCA; BRCA; COAD; HNSC; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.13; TCGA BRCA -0.203; TCGA COAD -0.15; TCGA HNSC -0.137; TCGA PAAD -0.073; TCGA SARC -0.155; TCGA THCA -0.321; TCGA STAD -0.134; TCGA UCEC -0.192 |
hsa-miR-215-5p | RAB23 | 11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.212; TCGA CESC -0.067; TCGA COAD -0.136; TCGA ESCA -0.077; TCGA KIRC -0.055; TCGA LIHC -0.071; TCGA LUAD -0.054; TCGA LUSC -0.058; TCGA PAAD -0.067; TCGA STAD -0.212; TCGA UCEC -0.223 |
hsa-miR-215-5p | RADIL | 9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.154; TCGA CESC -0.125; TCGA ESCA -0.302; TCGA KIRC -0.092; TCGA KIRP -0.232; TCGA LUAD -0.132; TCGA PAAD -0.171; TCGA STAD -0.217; TCGA UCEC -0.327 |
hsa-miR-215-5p | RHOBTB3 | 9 cancers: BLCA; CESC; KIRC; LGG; LUAD; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.08; TCGA CESC -0.109; TCGA KIRC -0.361; TCGA LGG -0.054; TCGA LUAD -0.103; TCGA PAAD -0.172; TCGA THCA -0.169; TCGA STAD -0.094; TCGA UCEC -0.173 |
hsa-miR-215-5p | SLCO3A1 | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; PAAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.121; TCGA CESC -0.095; TCGA COAD -0.113; TCGA ESCA -0.137; TCGA KIRC -0.087; TCGA LIHC -0.074; TCGA LUAD -0.091; TCGA PAAD -0.102; TCGA STAD -0.112 |
hsa-miR-215-5p | TMEM200B | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.203; TCGA CESC -0.189; TCGA COAD -0.293; TCGA ESCA -0.259; TCGA HNSC -0.242; TCGA LUAD -0.109; TCGA LUSC -0.139; TCGA SARC -0.26; TCGA UCEC -0.412 |
hsa-miR-215-5p | TRIM23 | 10 cancers: BLCA; CESC; COAD; ESCA; LGG; LUAD; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.071; TCGA CESC -0.055; TCGA COAD -0.076; TCGA ESCA -0.053; TCGA LGG -0.066; TCGA LUAD -0.064; TCGA PAAD -0.092; TCGA SARC -0.06; TCGA STAD -0.103; TCGA UCEC -0.123 |
hsa-miR-215-5p | TRPC1 | 12 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.074; TCGA COAD -0.245; TCGA ESCA -0.125; TCGA KIRP -0.135; TCGA LGG -0.09; TCGA LIHC -0.186; TCGA LUAD -0.09; TCGA LUSC -0.11; TCGA PAAD -0.162; TCGA SARC -0.09; TCGA STAD -0.209; TCGA UCEC -0.314 |
hsa-miR-215-5p | WWC3 | 11 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.128; TCGA CESC -0.104; TCGA COAD -0.134; TCGA ESCA -0.145; TCGA LIHC -0.122; TCGA LUAD -0.095; TCGA LUSC -0.074; TCGA PAAD -0.066; TCGA THCA -0.085; TCGA STAD -0.15; TCGA UCEC -0.115 |
hsa-miR-215-5p | KCNMB4 | 9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.121; TCGA CESC -0.243; TCGA COAD -0.247; TCGA ESCA -0.114; TCGA KIRC -0.099; TCGA LIHC -0.118; TCGA PAAD -0.2; TCGA STAD -0.194; TCGA UCEC -0.149 |
hsa-miR-215-5p | SYNGR1 | 11 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.093; TCGA CESC -0.169; TCGA COAD -0.235; TCGA ESCA -0.233; TCGA KIRC -0.248; TCGA KIRP -0.163; TCGA LGG -0.059; TCGA LIHC -0.193; TCGA LUSC -0.122; TCGA PAAD -0.144; TCGA UCEC -0.154 |
hsa-miR-215-5p | MEX3B | 9 cancers: CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.104; TCGA COAD -0.087; TCGA ESCA -0.158; TCGA KIRP -0.052; TCGA LGG -0.127; TCGA LIHC -0.104; TCGA LUAD -0.052; TCGA STAD -0.115; TCGA UCEC -0.245 |
hsa-miR-215-5p | MTSS1 | 11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.408; TCGA ESCA -0.314; TCGA HNSC -0.095; TCGA KIRC -0.054; TCGA KIRP -0.111; TCGA LGG -0.086; TCGA LUSC -0.168; TCGA PAAD -0.079; TCGA THCA -0.156; TCGA STAD -0.13; TCGA UCEC -0.149 |
hsa-miR-215-5p | NPHP3 | 9 cancers: CESC; COAD; ESCA; KIRP; LIHC; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.063; TCGA COAD -0.057; TCGA ESCA -0.055; TCGA KIRP -0.096; TCGA LIHC -0.066; TCGA LUSC -0.077; TCGA PAAD -0.059; TCGA STAD -0.087; TCGA UCEC -0.086 |
hsa-miR-215-5p | PHTF2 | 10 cancers: CESC; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.061; TCGA ESCA -0.105; TCGA KIRP -0.06; TCGA LIHC -0.094; TCGA LUAD -0.072; TCGA LUSC -0.054; TCGA PAAD -0.123; TCGA SARC -0.079; TCGA STAD -0.104; TCGA UCEC -0.079 |
Enriched cancer pathways of putative targets