microRNA information: hsa-miR-216a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-216a-5p | miRbase |
Accession: | MIMAT0000273 | miRbase |
Precursor name: | hsa-mir-216a | miRbase |
Precursor accession: | MI0000292 | miRbase |
Symbol: | MIR216A | HGNC |
RefSeq ID: | NR_029629 | GenBank |
Sequence: | UAAUCUCAGCUGGCAACUGUGA |
Reported expression in cancers: hsa-miR-216a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-216a-5p | lung cancer | upregulation | "By examining the expression of 22 HCC-related miRN ......" | 22392644 | |
hsa-miR-216a-5p | pancreatic cancer | downregulation | "Expression of miR 216a in pancreatic cancer and it ......" | 23174591 | Microarray |
hsa-miR-216a-5p | pancreatic cancer | downregulation | "miR 148a and miR 216a regulated oncolytic adenovir ......" | 24895996 | |
hsa-miR-216a-5p | pancreatic cancer | downregulation | "MicroRNA miR-216a expression is significantly down ......" | 25220761 | |
hsa-miR-216a-5p | pancreatic cancer | downregulation | "This study was aimed to investigate miR-216a expre ......" | 26149212 | |
hsa-miR-216a-5p | sarcoma | deregulation | "Hypoxic conditions were verified and miRNA express ......" | 24927770 | Microarray |
Reported cancer pathway affected by hsa-miR-216a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-216a-5p | bladder cancer | cell cycle pathway; Apoptosis pathway | "A recombinant lentivirus Lv vector expressing miR- ......" | 27578985 | Western blot; Flow cytometry; Colony formation; Transwell assay |
hsa-miR-216a-5p | pancreatic cancer | Apoptosis pathway | "MicroRNA 216a inhibits pancreatic cancer by direct ......" | 25220761 | Luciferase; Western blot |
hsa-miR-216a-5p | pancreatic cancer | Apoptosis pathway | "MicroRNA 216a enhances the radiosensitivity of pan ......" | 26134156 | Luciferase; Colony formation |
Reported cancer prognosis affected by hsa-miR-216a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-216a-5p | bladder cancer | cell migration | "A recombinant lentivirus Lv vector expressing miR- ......" | 27578985 | Western blot; Flow cytometry; Colony formation; Transwell assay |
hsa-miR-216a-5p | liver cancer | worse prognosis | "Expression of serum microRNAs miR 222 miR 181 miR ......" | 24124720 | |
hsa-miR-216a-5p | lung cancer | tumorigenesis; staging | "Androgen pathway stimulates microRNA 216a transcri ......" | 22392644 | |
hsa-miR-216a-5p | lung cancer | metastasis | "MicroRNA microarrays were performed on 26 primary ......" | 24778034 | |
hsa-miR-216a-5p | pancreatic cancer | tumorigenesis | "Expression of miR 216a in pancreatic cancer and it ......" | 23174591 | |
hsa-miR-216a-5p | pancreatic cancer | staging | "miR 148a and miR 216a regulated oncolytic adenovir ......" | 24895996 | |
hsa-miR-216a-5p | pancreatic cancer | drug resistance | "MicroRNA 216a enhances the radiosensitivity of pan ......" | 26134156 | Luciferase; Colony formation |
hsa-miR-216a-5p | pancreatic cancer | staging | "At 25 weeks the miRNA microarray analysis revealed ......" | 26516699 | |
hsa-miR-216a-5p | prostate cancer | drug resistance | "MicroRNA Library Based Functional Screening Identi ......" | 26506397 | |
hsa-miR-216a-5p | sarcoma | drug resistance | "Hypoxic conditions were verified and miRNA express ......" | 24927770 | Luciferase |
Reported gene related to hsa-miR-216a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-216a-5p | pancreatic cancer | JAK2 | "MicroRNA 216a inhibits pancreatic cancer by direct ......" | 25220761 |
hsa-miR-216a-5p | pancreatic cancer | JAK2 | "miR 216a may inhibit pancreatic tumor growth by ta ......" | 26149212 |
hsa-miR-216a-5p | lung cancer | AR | "Finally the androgen receptor level increased in m ......" | 22392644 |
hsa-miR-216a-5p | pancreatic cancer | BECN1 | "MicroRNA 216a enhances the radiosensitivity of pan ......" | 26134156 |
hsa-miR-216a-5p | lung cancer | CADM1 | "One target of miR-216a was shown to be the tumor s ......" | 22392644 |
hsa-miR-216a-5p | pancreatic cancer | COL14A1 | "Four of seven miRNAs miR-216a -196a -143 und -155 ......" | 22905187 |
hsa-miR-216a-5p | pancreatic cancer | ELAVL1 | "miR 216 and miR 217 expression is reduced in trans ......" | 27541609 |
hsa-miR-216a-5p | lung cancer | LNCR1 | "Androgen pathway stimulates microRNA 216a transcri ......" | 22392644 |
hsa-miR-216a-5p | bladder cancer | RFXANK | "A recombinant lentivirus Lv vector expressing miR- ......" | 27578985 |
hsa-miR-216a-5p | pancreatic cancer | STAT3 | "Phosphorylation of the signal transducer and activ ......" | 25220761 |
hsa-miR-216a-5p | prostate cancer | VCAM1 | "Moreover miR-216 mimic reversed the WISP-1-enhance ......" | 25277191 |