microRNA information: hsa-miR-217
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-217 | miRbase |
| Accession: | MIMAT0000274 | miRbase |
| Precursor name: | hsa-mir-217 | miRbase |
| Precursor accession: | MI0000293 | miRbase |
| Symbol: | MIR217 | HGNC |
| RefSeq ID: | NR_029630 | GenBank |
| Sequence: | UACUGCAUCAGGAACUGAUUGGA |
Reported expression in cancers: hsa-miR-217
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-217 | breast cancer | upregulation | "The expression of miR-217 was detected by Taqman P ......" | 25653720 | |
| hsa-miR-217 | colorectal cancer | downregulation | "Recent studies have indicated the possible functio ......" | 26016795 | |
| hsa-miR-217 | gastric cancer | downregulation | "However little is known about the potential role o ......" | 26098560 | |
| hsa-miR-217 | kidney renal cell cancer | downregulation | "MicroRNA 217 down regulated in clear cell renal ce ......" | 23790169 | qPCR |
| hsa-miR-217 | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
| hsa-miR-217 | liver cancer | deregulation | "In this study we identified 10 upregulated miRNAs ......" | 22362728 | qPCR |
| hsa-miR-217 | liver cancer | deregulation | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Microarray; Reverse transcription PCR |
| hsa-miR-217 | ovarian cancer | downregulation | "Accumulating evidence shows that microRNA-217 miR- ......" | 26708715 | |
| hsa-miR-217 | pancreatic cancer | downregulation | "Clinical information from a cohort of 54 PC patien ......" | 25172416 | |
| hsa-miR-217 | pancreatic cancer | downregulation | "miRNAs that were differentially expressed in pancr ......" | 25485236 | Microarray; qPCR |
| hsa-miR-217 | sarcoma | downregulation | "Our findings indicated that decreased expression o ......" | 26224480 |
Reported cancer pathway affected by hsa-miR-217
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-217 | breast cancer | cell cycle pathway | "MiR 217 Promotes Tumor Proliferation in Breast Can ......" | 25653720 | Western blot; Luciferase |
| hsa-miR-217 | breast cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "MicroRNA 217 overexpression induces drug resistanc ......" | 26109338 | Western blot |
| hsa-miR-217 | colorectal cancer | Apoptosis pathway | "MicroRNA 217 functions as a prognosis predictor an ......" | 26016795 | Luciferase; Colony formation |
| hsa-miR-217 | lung cancer | Apoptosis pathway | "MicroRNA 217 functions as a tumour suppressor gene ......" | 25234467 | Western blot; Luciferase |
| hsa-miR-217 | pancreatic cancer | Epithelial mesenchymal transition pathway | "Chronic pancreatitis and pancreatic cancer demonst ......" | 25172416 | |
| hsa-miR-217 | sarcoma | Apoptosis pathway | "The microRNA 217 functions as a tumor suppressor a ......" | 25960216 | Cell migration assay |
| hsa-miR-217 | sarcoma | Apoptosis pathway | "miR 217 targeting Wnt5a in osteosarcoma functions ......" | 26054690 | Luciferase |
Reported cancer prognosis affected by hsa-miR-217
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-217 | breast cancer | staging; progression | "MiR 217 Promotes Tumor Proliferation in Breast Can ......" | 25653720 | Western blot; Luciferase |
| hsa-miR-217 | breast cancer | drug resistance; poor survival; progression; tumorigenesis | "MicroRNA 217 overexpression induces drug resistanc ......" | 26109338 | Western blot |
| hsa-miR-217 | colorectal cancer | worse prognosis; tumorigenesis; differentiation; poor survival | "MicroRNA 217 functions as a prognosis predictor an ......" | 26016795 | Luciferase; Colony formation |
| hsa-miR-217 | gastric cancer | metastasis; progression; worse prognosis; poor survival | "microRNA 217 inhibits tumor progression and metast ......" | 25869101 | |
| hsa-miR-217 | gastric cancer | progression | "Gastric cancer is the most common cancer in the wo ......" | 27044823 | |
| hsa-miR-217 | kidney renal cell cancer | poor survival; staging; motility | "MicroRNA 217 down regulated in clear cell renal ce ......" | 23790169 | MTT assay |
| hsa-miR-217 | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
| hsa-miR-217 | liver cancer | progression | "miR 217 inhibits invasion of hepatocellular carcin ......" | 24671492 | |
| hsa-miR-217 | lung cancer | metastasis | "MicroRNA microarrays were performed on 26 primary ......" | 24778034 | |
| hsa-miR-217 | lung cancer | drug resistance | "MicroRNA 217 functions as a tumour suppressor gene ......" | 25234467 | Western blot; Luciferase |
| hsa-miR-217 | ovarian cancer | metastasis; tumorigenesis; staging | "Tumor suppressor role of miR 217 in human epitheli ......" | 26708715 | Luciferase; Western blot |
| hsa-miR-217 | pancreatic cancer | staging; metastasis | "Chronic pancreatitis and pancreatic cancer demonst ......" | 25172416 | |
| hsa-miR-217 | pancreatic cancer | staging | "At 25 weeks the miRNA microarray analysis revealed ......" | 26516699 | |
| hsa-miR-217 | sarcoma | metastasis; tumorigenesis | "MicroRNA 217 regulates WASF3 expression and suppre ......" | 25289936 | |
| hsa-miR-217 | sarcoma | tumorigenesis; staging; metastasis; tumor size; poor survival | "The microRNA 217 functions as a tumor suppressor a ......" | 25960216 | Cell migration assay |
| hsa-miR-217 | sarcoma | metastasis | "Quercetin Enhances Cisplatin Sensitivity of Human ......" | 26062553 | Western blot; Transwell assay |
| hsa-miR-217 | sarcoma | metastasis; progression; worse prognosis; staging; poor survival | "Downregulation of microRNA 217 and microRNA 646 ac ......" | 26224480 |
Reported gene related to hsa-miR-217
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-217 | lung cancer | KRAS | "The overexpression of miR-217 significantly inhibi ......" | 25234467 |
| hsa-miR-217 | sarcoma | KRAS | "Quercetin Enhances Cisplatin Sensitivity of Human ......" | 26062553 |
| hsa-miR-217 | breast cancer | CCND1 | "In MDA-MB-231 cells treatment with miR-217 inhibit ......" | 25653720 |
| hsa-miR-217 | breast cancer | CDH1 | "In addition the overexpression of miR-217 inhibite ......" | 26109338 |
| hsa-miR-217 | breast cancer | DACH1 | "MiR 217 Promotes Tumor Proliferation in Breast Can ......" | 25653720 |
| hsa-miR-217 | liver cancer | E2F3 | "miR 217 inhibits invasion of hepatocellular carcin ......" | 24671492 |
| hsa-miR-217 | pancreatic cancer | ELAVL1 | "miR 216 and miR 217 expression is reduced in trans ......" | 27541609 |
| hsa-miR-217 | gastric cancer | EZH2 | "microRNA 217 inhibits tumor progression and metast ......" | 25869101 |
| hsa-miR-217 | gastric cancer | GPC5 | "The MicroRNA 217 Functions as a Potential Tumor Su ......" | 26098560 |
| hsa-miR-217 | ovarian cancer | IGF1R | "Tumor suppressor role of miR 217 in human epitheli ......" | 26708715 |
| hsa-miR-217 | kidney renal cell cancer | LARP6 | "786-O and ACHN cells were transfected with miR-217 ......" | 23790169 |
| hsa-miR-217 | esophageal cancer | MALAT1 | "Silencing of long noncoding RNA MALAT1 by miR 101 ......" | 25538231 |
| hsa-miR-217 | colorectal cancer | MTDH | "MicroRNA 217 functions as a prognosis predictor an ......" | 26016795 |
| hsa-miR-217 | breast cancer | PCNA | "In vitro treatment with miR-217 mimics significant ......" | 25653720 |
| hsa-miR-217 | breast cancer | PTEN | "MicroRNA 217 overexpression induces drug resistanc ......" | 26109338 |
| hsa-miR-217 | pancreatic cancer | SCARNA17 | "Also the differences between the spike and U91 wer ......" | 26499892 |
| hsa-miR-217 | pancreatic cancer | SIRT1 | "Chronic pancreatitis and pancreatic cancer demonst ......" | 25172416 |
| hsa-miR-217 | breast cancer | SNAI1 | "In addition the overexpression of miR-217 inhibite ......" | 26109338 |
| hsa-miR-217 | sarcoma | WASF3 | "MicroRNA 217 regulates WASF3 expression and suppre ......" | 25289936 |
| hsa-miR-217 | sarcoma | WNT5A | "miR 217 targeting Wnt5a in osteosarcoma functions ......" | 26054690 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-217 | GRHL1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; STAD | PITA; miRanda | TCGA BLCA -0.228; TCGA CESC -0.24; TCGA COAD -0.125; TCGA ESCA -0.24; TCGA HNSC -0.126; TCGA KIRP -0.143; TCGA LUAD -0.15; TCGA PAAD -0.054; TCGA STAD -0.139 |
hsa-miR-217 | EPN3 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUSC; THCA; STAD | miRanda | TCGA BLCA -0.208; TCGA BRCA -0.182; TCGA CESC -0.106; TCGA COAD -0.134; TCGA HNSC -0.079; TCGA LGG -0.177; TCGA LIHC -0.068; TCGA LUSC -0.14; TCGA THCA -0.174; TCGA STAD -0.257 |
hsa-miR-217 | MXD1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.082; TCGA BRCA -0.063; TCGA CESC -0.123; TCGA COAD -0.175; TCGA ESCA -0.135; TCGA HNSC -0.22; TCGA LUSC -0.099; TCGA PAAD -0.062; TCGA PRAD -0.058; TCGA STAD -0.169 |
hsa-miR-217 | RAPGEFL1 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.135; TCGA BRCA -0.081; TCGA CESC -0.319; TCGA ESCA -0.196; TCGA KIRC -0.068; TCGA LGG -0.113; TCGA LIHC -0.059; TCGA LUSC -0.185; TCGA PAAD -0.08; TCGA STAD -0.141; TCGA UCEC -0.079 |
hsa-miR-217 | DSC2 | 9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD | miRanda | TCGA CESC -0.193; TCGA COAD -0.12; TCGA ESCA -0.299; TCGA HNSC -0.297; TCGA KIRP -0.088; TCGA LUAD -0.115; TCGA LUSC -0.232; TCGA PRAD -0.116; TCGA STAD -0.196 |
hsa-miR-217 | PFKP | 12 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; SARC; THCA; STAD; UCEC | miRanda | TCGA COAD -0.193; TCGA ESCA -0.109; TCGA HNSC -0.054; TCGA KIRC -0.189; TCGA KIRP -0.077; TCGA LGG -0.056; TCGA LIHC -0.059; TCGA LUSC -0.139; TCGA SARC -0.092; TCGA THCA -0.093; TCGA STAD -0.103; TCGA UCEC -0.062 |
Enriched cancer pathways of putative targets