microRNA information: hsa-miR-219a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-219a-5p | miRbase |
| Accession: | MIMAT0000276 | miRbase |
| Precursor name: | hsa-mir-219a-1 | miRbase |
| Precursor accession: | MI0000296 | miRbase |
| Symbol: | NA | HGNC |
| RefSeq ID: | NA | GenBank |
| Sequence: | UGAUUGUCCAAACGCAAUUCU |
Reported expression in cancers: hsa-miR-219a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-219a-5p | prostate cancer | downregulation | "In this study we examined global miRNA expression ......" | 25075250 | in situ hybridization; Microarray |
Reported cancer pathway affected by hsa-miR-219a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-219a-5p | colon cancer | Apoptosis pathway | "miR 219 5p plays a tumor suppressive role in colon ......" | 26238082 | Western blot; Luciferase; Transwell assay; Wound Healing Assay; Flow cytometry |
Reported cancer prognosis affected by hsa-miR-219a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-219a-5p | colon cancer | cell migration | "miR 219 5p plays a tumor suppressive role in colon ......" | 26238082 | Western blot; Luciferase; Transwell assay; Wound Healing Assay; Flow cytometry |
| hsa-miR-219a-5p | colorectal cancer | poor survival | "The expression levels of miR-206 miR-219 miR-192 m ......" | 27666868 | |
| hsa-miR-219a-5p | liver cancer | motility | "A novel miR 219 SMC4 JAK2/Stat3 regulatory pathway ......" | 24980149 | Western blot; Colony formation; Luciferase |
Reported gene related to hsa-miR-219a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-219a-5p | thyroid cancer | ESR1 | "miR 219 5p modulates cell growth of papillary thyr ......" | 25423566 |
| hsa-miR-219a-5p | chronic myeloid leukemia | EZH2 | "Importantly downregulation of EZH2 by short hairpi ......" | 27070757 |
| hsa-miR-219a-5p | liver cancer | GPC1 | "MiR 219 5p inhibits hepatocellular carcinoma cell ......" | 22449976 |
| hsa-miR-219a-5p | liver cancer | GPC3 | "MiR 219 5p inhibits hepatocellular carcinoma cell ......" | 22449976 |
| hsa-miR-219a-5p | pancreatic cancer | LOC100508689 | "miR 219 1 3p is a negative regulator of the mucin ......" | 24608432 |
| hsa-miR-219a-5p | pancreatic cancer | MUC4 | "miR 219 1 3p is a negative regulator of the mucin ......" | 24608432 |
| hsa-miR-219a-5p | colon cancer | SALL4 | "miR 219 5p plays a tumor suppressive role in colon ......" | 26238082 |
| hsa-miR-219a-5p | liver cancer | SMC4 | "A novel miR 219 SMC4 JAK2/Stat3 regulatory pathway ......" | 24980149 |
| hsa-miR-219a-5p | chronic myeloid leukemia | XIAP | "Importantly downregulation of EZH2 by short hairpi ......" | 27070757 |
Expression profile in cancer corhorts:
