microRNA information: hsa-miR-221-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-221-5p | miRbase |
| Accession: | MIMAT0004568 | miRbase |
| Precursor name: | hsa-mir-221 | miRbase |
| Precursor accession: | MI0000298 | miRbase |
| Symbol: | MIR221 | HGNC |
| RefSeq ID: | NR_029635 | GenBank |
| Sequence: | ACCUGGCAUACAAUGUAGAUUU |
Reported expression in cancers: hsa-miR-221-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-221-5p | bladder cancer | upregulation | "Accumulating evidence indicates that EMT can be re ......" | 25928257 | |
| hsa-miR-221-5p | breast cancer | upregulation | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | qPCR |
| hsa-miR-221-5p | breast cancer | upregulation | "MiR-221 displayed an upregulation in breast cancer ......" | 23801152 | |
| hsa-miR-221-5p | breast cancer | upregulation | "In this study we found the level of microRNA221 mi ......" | 25686829 | |
| hsa-miR-221-5p | breast cancer | upregulation | "In this study the expression of miR-221 in breast ......" | 26503209 | |
| hsa-miR-221-5p | breast cancer | upregulation | "We found that miR-221 was upregulated in BCSCs com ......" | 26556862 | |
| hsa-miR-221-5p | colon cancer | upregulation | "Expression of miR 221 in colon cancer correlates w ......" | 25932237 | qPCR |
| hsa-miR-221-5p | colorectal cancer | upregulation | "MicroRNA 221 inhibits CDKN1C/p57 expression in hum ......" | 21278784 | qPCR |
| hsa-miR-221-5p | colorectal cancer | upregulation | "MicroRNA 221 controls CDKN1C/P57 expression in hum ......" | 21538272 | qPCR |
| hsa-miR-221-5p | colorectal cancer | upregulation | "The increased expression of miR-200c miR-221 and m ......" | 21873159 | |
| hsa-miR-221-5p | colorectal cancer | upregulation | "We provide insight into the behavior of miR-221 in ......" | 24269686 | |
| hsa-miR-221-5p | colorectal cancer | upregulation | "microRNA 221 and microRNA 18a identification in st ......" | 25233396 | |
| hsa-miR-221-5p | endometrial cancer | deregulation | "In endometrial cancer cells expression levels of m ......" | 26535032 | |
| hsa-miR-221-5p | gastric cancer | upregulation | "Increased Expression of MicroRNA 221 in gastric ca ......" | 22613407 | Reverse transcription PCR; qPCR |
| hsa-miR-221-5p | gastric cancer | upregulation | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | qPCR |
| hsa-miR-221-5p | gastric cancer | upregulation | "The miRNAs differentially expressed in gastric can ......" | 24473397 | qPCR; Microarray |
| hsa-miR-221-5p | gastric cancer | upregulation | "Expression Analysis of mir 21 and mir 221 in Cance ......" | 26209976 | qPCR |
| hsa-miR-221-5p | gastric cancer | upregulation | "From the set of the 29 microRNAs of interest we fo ......" | 27081844 | |
| hsa-miR-221-5p | glioblastoma | upregulation | "These include two sites for microRNA 221 and 222 w ......" | 17721077 | |
| hsa-miR-221-5p | glioblastoma | upregulation | "MicroRNA miR-221 and miR-222 are frequently upregu ......" | 20428775 | |
| hsa-miR-221-5p | glioblastoma | upregulation | "MiR-221 and miR-222 miR-221/222 are frequently up- ......" | 20813046 | |
| hsa-miR-221-5p | glioblastoma | upregulation | "Overexpression of miR-221 led to cell survival and ......" | 24780067 | |
| hsa-miR-221-5p | head and neck cancer | deregulation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | qPCR; Microarray |
| hsa-miR-221-5p | liver cancer | upregulation | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
| hsa-miR-221-5p | liver cancer | upregulation | "Expression of serum miR 221 in human hepatocellula ......" | 21295551 | qPCR |
| hsa-miR-221-5p | liver cancer | upregulation | "Deregulated expression of microRNA 221 with the po ......" | 21458843 | |
| hsa-miR-221-5p | liver cancer | upregulation | "Increased miR 221 expression in hepatocellular car ......" | 23320393 | qPCR |
| hsa-miR-221-5p | liver cancer | upregulation | "p53/mdm2 feedback loop sustains miR 221 expression ......" | 24324033 | |
| hsa-miR-221-5p | liver cancer | upregulation | "Inhibiting the oncogenic mir 221 by microRNA spong ......" | 25436097 | |
| hsa-miR-221-5p | lung squamous cell cancer | upregulation | "In conclusion we show that high expression levels ......" | 18246122 | |
| hsa-miR-221-5p | ovarian cancer | downregulation | "Using microRNA microarrays we identify several miR ......" | 18560586 | Microarray |
| hsa-miR-221-5p | ovarian cancer | upregulation | "Prognostic significance of serum microRNA 221 expr ......" | 23569131 | Reverse transcription PCR; qPCR |
| hsa-miR-221-5p | pancreatic cancer | upregulation | "Profiling of 95 microRNAs in pancreatic cancer cel ......" | 19030927 | qPCR |
| hsa-miR-221-5p | pancreatic cancer | deregulation | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-miR-221-5p | pancreatic cancer | deregulation | "In the present study we found that the expression ......" | 24224124 | |
| hsa-miR-221-5p | pancreatic cancer | downregulation | "Moreover we showed that the down-regulation of miR ......" | 25955843 | |
| hsa-miR-221-5p | prostate cancer | downregulation | "Expression of microRNA 221 is progressively reduce ......" | 19585579 | Microarray |
| hsa-miR-221-5p | prostate cancer | downregulation | "miR 221 Is down regulated in TMPRSS2:ERG fusion po ......" | 21378318 | Microarray |
| hsa-miR-221-5p | prostate cancer | downregulation | "Downregulation of miR 221 30d and 15a contributes ......" | 25761682 | qPCR |
| hsa-miR-221-5p | prostate cancer | downregulation | "Our present study of the microRNA miRNA expression ......" | 26325107 | |
| hsa-miR-221-5p | prostate cancer | downregulation | "By microarray approach we identified seven miRNAs ......" | 26831660 | Microarray; qPCR |
| hsa-miR-221-5p | thyroid cancer | upregulation | "A set of five miRNAs including the three most up-r ......" | 16365291 | |
| hsa-miR-221-5p | thyroid cancer | upregulation | "We studied the expression levels of miR-221 using ......" | 22855362 | Northern blot |
| hsa-miR-221-5p | thyroid cancer | upregulation | "Using laser microdissection followed by quantitati ......" | 23563786 | qPCR |
| hsa-miR-221-5p | thyroid cancer | upregulation | "MiR-221 is frequently upregulated in papillary thy ......" | 27077469 |
Reported cancer pathway affected by hsa-miR-221-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-221-5p | bladder cancer | Apoptosis pathway | "MicroRNA 221 silencing predisposed human bladder c ......" | 19767219 | Flow cytometry; Western blot |
| hsa-miR-221-5p | bladder cancer | Epithelial mesenchymal transition pathway | "miR 221 facilitates the TGFbeta1 induced epithelia ......" | 25928257 | Western blot; Luciferase |
| hsa-miR-221-5p | breast cancer | Apoptosis pathway | "Of the elevated miRNAs in ERalpha-negative cells m ......" | 18790736 | |
| hsa-miR-221-5p | breast cancer | cell cycle pathway; Apoptosis pathway | "miR 221 promotes tumorigenesis in human triple neg ......" | 23637992 | |
| hsa-miR-221-5p | breast cancer | Apoptosis pathway | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 | |
| hsa-miR-221-5p | breast cancer | cell cycle pathway | "miRNA inhibitors specially targeting miR-221 or mi ......" | 24886939 | |
| hsa-miR-221-5p | breast cancer | Epithelial mesenchymal transition pathway | "Trail resistance induces epithelial mesenchymal tr ......" | 24905916 | |
| hsa-miR-221-5p | breast cancer | Epithelial mesenchymal transition pathway | "In this study we found the level of microRNA221 mi ......" | 25686829 | |
| hsa-miR-221-5p | breast cancer | Apoptosis pathway | "Knockdown of miR 221 promotes the cisplatin induci ......" | 26503209 | MTT assay |
| hsa-miR-221-5p | cervical and endocervical cancer | PI3K/Akt signaling pathway | "MicroRNA 221 targets PTEN to reduce the sensitivit ......" | 26482612 | |
| hsa-miR-221-5p | colorectal cancer | Apoptosis pathway | "MicroRNA 221 inhibits CDKN1C/p57 expression in hum ......" | 21278784 | Western blot; Flow cytometry; MTT assay; Luciferase |
| hsa-miR-221-5p | colorectal cancer | Apoptosis pathway | "Effect of miR 221 specific inhibitor on the prolif ......" | 21515467 | Flow cytometry; MTT assay |
| hsa-miR-221-5p | colorectal cancer | Apoptosis pathway | "MicroRNA 221 controls CDKN1C/P57 expression in hum ......" | 21538272 | Western blot; Flow cytometry; MTT assay |
| hsa-miR-221-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 | Western blot; Luciferase |
| hsa-miR-221-5p | gastric cancer | Apoptosis pathway | "Propofol suppresses proliferation and invasion of ......" | 26214494 | MTT assay |
| hsa-miR-221-5p | glioblastoma | cell cycle pathway | "Northern blot analysis was conducted to detect the ......" | 19953484 | Flow cytometry; Western blot |
| hsa-miR-221-5p | glioblastoma | PI3K/Akt signaling pathway; Apoptosis pathway | "MicroRNA 221 targeting PI3 K/Akt signaling axis in ......" | 24780067 | |
| hsa-miR-221-5p | liver cancer | cell cycle pathway | "MiR 221 controls CDKN1C/p57 and CDKN1B/p27 express ......" | 18521080 | |
| hsa-miR-221-5p | liver cancer | cell cycle pathway | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
| hsa-miR-221-5p | liver cancer | Apoptosis pathway | "MicroRNA 221 targets Bmf in hepatocellular carcino ......" | 19671867 | Luciferase |
| hsa-miR-221-5p | liver cancer | cell cycle pathway | "Clinical significance of miR 221 and its inverse c ......" | 20146005 | Western blot |
| hsa-miR-221-5p | liver cancer | Apoptosis pathway | "Effect of miR 221 on the viability and apoptosis o ......" | 22152314 | Flow cytometry |
| hsa-miR-221-5p | liver cancer | Apoptosis pathway; cell cycle pathway | "Increased miR 221 expression in hepatocellular car ......" | 23320393 | Flow cytometry |
| hsa-miR-221-5p | liver cancer | cell cycle pathway | "p53/mdm2 feedback loop sustains miR 221 expression ......" | 24324033 | |
| hsa-miR-221-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "miRNAs are small non-coding RNAs which target comp ......" | 24496037 | |
| hsa-miR-221-5p | liver cancer | Apoptosis pathway | "Bioinformatics analysis identifies miR 221 as a co ......" | 24993451 | |
| hsa-miR-221-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "Growth inhibitory effects of miR 221 and miR 222 i ......" | 25641933 | |
| hsa-miR-221-5p | ovarian cancer | cell cycle pathway | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 | |
| hsa-miR-221-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "The contribution of overexpressed microRNA-21 and ......" | 19730150 | |
| hsa-miR-221-5p | pancreatic cancer | Epithelial mesenchymal transition pathway | "MicroRNA 221 mediates the effects of PDGF BB on mi ......" | 23967190 | |
| hsa-miR-221-5p | prostate cancer | cell cycle pathway | "miR 221 and miR 222 expression affects the prolife ......" | 17569667 | Colony formation |
| hsa-miR-221-5p | prostate cancer | cell cycle pathway | "The inhibition of the highly expressed miR 221 and ......" | 19107213 | |
| hsa-miR-221-5p | prostate cancer | Apoptosis pathway | "Overexpression of ARHI inhibited cell proliferatio ......" | 21071579 | Colony formation; Luciferase |
| hsa-miR-221-5p | prostate cancer | cell cycle pathway | "MiR 221 promotes the development of androgen indep ......" | 23770851 | |
| hsa-miR-221-5p | prostate cancer | Apoptosis pathway; Jak-STAT signaling pathway | "Survival in patients with high risk prostate cance ......" | 24607843 | |
| hsa-miR-221-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "Down regulation of mir 221 and mir 222 restrain pr ......" | 24892674 | |
| hsa-miR-221-5p | sarcoma | Apoptosis pathway; cell cycle pathway | "MicroRNA 221 induces cell survival and cisplatin r ......" | 23372675 | Western blot; Luciferase |
| hsa-miR-221-5p | thyroid cancer | Apoptosis pathway | "MiR 221 Exacerbate Cell Proliferation and Invasion ......" | 27077469 |
Reported cancer prognosis affected by hsa-miR-221-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-221-5p | acute myeloid leukemia | differentiation | "We studied miRNA expression of leukemic blasts of ......" | 20425795 | |
| hsa-miR-221-5p | acute myeloid leukemia | differentiation | "The integrated information gathered from the two m ......" | 25612891 | |
| hsa-miR-221-5p | bladder cancer | immune evasion | "MiR 221 induced PUMA silencing mediates immune eva ......" | 25585941 | |
| hsa-miR-221-5p | bladder cancer | metastasis; progression; malignant trasformation | "miR 221 facilitates the TGFbeta1 induced epithelia ......" | 25928257 | Western blot; Luciferase |
| hsa-miR-221-5p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
| hsa-miR-221-5p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-221-5p | breast cancer | cell migration | "We identified the microRNAs miRNAs miR-221 and miR ......" | 21673316 | |
| hsa-miR-221-5p | breast cancer | drug resistance | "Plasma miR 221 as a predictive biomarker for chemo ......" | 22156446 | |
| hsa-miR-221-5p | breast cancer | cell migration | "Correlation between Slug transcription factor and ......" | 23031797 | Western blot; Wound Healing Assay |
| hsa-miR-221-5p | breast cancer | progression | "MiR-221 expression was significantly increased in ......" | 23226290 | |
| hsa-miR-221-5p | breast cancer | progression; drug resistance | "Here we find that nucleolin NCL a major nucleolar ......" | 23610125 | |
| hsa-miR-221-5p | breast cancer | tumorigenesis; progression; cell migration | "miR 221 promotes tumorigenesis in human triple neg ......" | 23637992 | |
| hsa-miR-221-5p | breast cancer | staging | "MiR-221/-222 expressions were analysed in 86 breas ......" | 24129242 | |
| hsa-miR-221-5p | breast cancer | metastasis; drug resistance; malignant trasformation; progression; worse prognosis | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 | |
| hsa-miR-221-5p | breast cancer | drug resistance | "Trail resistance induces epithelial mesenchymal tr ......" | 24905916 | |
| hsa-miR-221-5p | breast cancer | malignant trasformation | "In this study we found the level of microRNA221 mi ......" | 25686829 | |
| hsa-miR-221-5p | breast cancer | staging; poor survival | "Prognostic and biological significance of microRNA ......" | 26253160 | |
| hsa-miR-221-5p | breast cancer | progression | "Slug upregulated miR 221 promotes breast cancer pr ......" | 27174021 | |
| hsa-miR-221-5p | breast cancer | staging | "We report for the first time an extremely high pre ......" | 27404381 | |
| hsa-miR-221-5p | colon cancer | worse prognosis; staging; poor survival | "Expression of miR 221 in colon cancer correlates w ......" | 25932237 | |
| hsa-miR-221-5p | colorectal cancer | poor survival; worse prognosis | "Circulating miR 221 directly amplified from plasma ......" | 20880178 | |
| hsa-miR-221-5p | colorectal cancer | staging; progression | "MicroRNA 221 inhibits CDKN1C/p57 expression in hum ......" | 21278784 | Western blot; Flow cytometry; MTT assay; Luciferase |
| hsa-miR-221-5p | colorectal cancer | progression | "MicroRNA 221 controls CDKN1C/P57 expression in hum ......" | 21538272 | Western blot; Flow cytometry; MTT assay |
| hsa-miR-221-5p | colorectal cancer | metastasis | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 | |
| hsa-miR-221-5p | colorectal cancer | metastasis; cell migration | "MicroRNA 221 promotes colorectal cancer cell invas ......" | 24269686 | |
| hsa-miR-221-5p | colorectal cancer | staging; drug resistance | "To explore the potential molecular biomarkers pred ......" | 24460313 | |
| hsa-miR-221-5p | colorectal cancer | staging | "microRNA 221 and microRNA 18a identification in st ......" | 25233396 | |
| hsa-miR-221-5p | endometrial cancer | metastasis; tumorigenesis | "In endometrial cancer cells expression levels of m ......" | 26535032 | |
| hsa-miR-221-5p | gastric cancer | drug resistance; progression; malignant trasformation | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 | Western blot; Luciferase |
| hsa-miR-221-5p | gastric cancer | differentiation | "Differential miRNAs were identified in serum pools ......" | 22432036 | |
| hsa-miR-221-5p | gastric cancer | malignant trasformation; progression; staging; metastasis; poor survival | "Increased Expression of MicroRNA 221 in gastric ca ......" | 22613407 | |
| hsa-miR-221-5p | gastric cancer | metastasis; poor survival | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | |
| hsa-miR-221-5p | glioblastoma | malignant trasformation | "In our study we examined by microarray the global ......" | 16039986 | |
| hsa-miR-221-5p | glioblastoma | poor survival | "MiR 221 and miR 222 target PUMA to induce cell sur ......" | 20813046 | |
| hsa-miR-221-5p | glioblastoma | tumorigenesis | "Among different miRs we focused our attention on m ......" | 21743492 | Western blot |
| hsa-miR-221-5p | glioblastoma | differentiation | "Using this in vitro system a microarray-based high ......" | 24155920 | |
| hsa-miR-221-5p | glioblastoma | drug resistance | "In our study we found that radiation induced c-jun ......" | 24295494 | RNAi |
| hsa-miR-221-5p | glioblastoma | drug resistance; poor survival | "MicroRNA 221 targeting PI3 K/Akt signaling axis in ......" | 24780067 | |
| hsa-miR-221-5p | head and neck cancer | malignant trasformation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | |
| hsa-miR-221-5p | kidney renal cell cancer | poor survival; metastasis; staging | "Higher circulating expression levels of miR 221 as ......" | 24379138 | |
| hsa-miR-221-5p | kidney renal cell cancer | poor survival | "Impact of miR 21 miR 126 and miR 221 as prognostic ......" | 25279769 | |
| hsa-miR-221-5p | kidney renal cell cancer | progression | "In this study we investigated the role of miR-221 ......" | 26191221 | Luciferase |
| hsa-miR-221-5p | kidney renal cell cancer | poor survival | "We validated the negative correlation between miR- ......" | 26201448 | |
| hsa-miR-221-5p | kidney renal cell cancer | worse prognosis | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
| hsa-miR-221-5p | liver cancer | worse prognosis; drug resistance; tumorigenesis | "MiR 221 controls CDKN1C/p57 and CDKN1B/p27 express ......" | 18521080 | |
| hsa-miR-221-5p | liver cancer | progression | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
| hsa-miR-221-5p | liver cancer | tumorigenesis; recurrence | "MicroRNA 221 targets Bmf in hepatocellular carcino ......" | 19671867 | Luciferase |
| hsa-miR-221-5p | liver cancer | staging; metastasis; tumor size; tumorigenesis | "Clinical significance of miR 221 and its inverse c ......" | 20146005 | Western blot |
| hsa-miR-221-5p | liver cancer | worse prognosis; staging; tumor size; poor survival | "Expression of serum miR 221 in human hepatocellula ......" | 21295551 | |
| hsa-miR-221-5p | liver cancer | recurrence; metastasis; tumorigenesis | "Deregulated expression of microRNA 221 with the po ......" | 21458843 | |
| hsa-miR-221-5p | liver cancer | progression | "The miRNA levels were examined using microarray te ......" | 21876625 | |
| hsa-miR-221-5p | liver cancer | poor survival | "miR 221 silencing blocks hepatocellular carcinoma ......" | 22009537 | |
| hsa-miR-221-5p | liver cancer | staging | "Effect of miR 221 on the viability and apoptosis o ......" | 22152314 | Flow cytometry |
| hsa-miR-221-5p | liver cancer | staging; worse prognosis | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | |
| hsa-miR-221-5p | liver cancer | staging; worse prognosis | "Increased miR 221 expression in hepatocellular car ......" | 23320393 | Flow cytometry |
| hsa-miR-221-5p | liver cancer | drug resistance; progression | "p53/mdm2 feedback loop sustains miR 221 expression ......" | 24324033 | |
| hsa-miR-221-5p | liver cancer | cell migration; worse prognosis | "miRNAs are small non-coding RNAs which target comp ......" | 24496037 | |
| hsa-miR-221-5p | liver cancer | tumorigenesis; malignant trasformation | "Bioinformatics analysis identifies miR 221 as a co ......" | 24993451 | |
| hsa-miR-221-5p | liver cancer | staging; metastasis; recurrence | "Inhibiting the oncogenic mir 221 by microRNA spong ......" | 25436097 | |
| hsa-miR-221-5p | liver cancer | malignant trasformation; progression; tumorigenesis | "MicroRNA 221 governs tumor suppressor HDAC6 to pot ......" | 25817558 | |
| hsa-miR-221-5p | lung squamous cell cancer | drug resistance | "We show that in TRAIL-resistant NSCLC cells levels ......" | 18246122 | |
| hsa-miR-221-5p | lung squamous cell cancer | staging; recurrence | "In an exploratory study we determined whether expr ......" | 20975375 | |
| hsa-miR-221-5p | lung squamous cell cancer | worse prognosis | "High-throughput microarray was used to measure miR ......" | 22618509 | |
| hsa-miR-221-5p | lung squamous cell cancer | tumorigenesis; drug resistance | "It has been recently reported that epidermal growt ......" | 24286402 | |
| hsa-miR-221-5p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
| hsa-miR-221-5p | lung squamous cell cancer | worse prognosis; poor survival; progression | "Overexpression of MicroRNA 221 is associated with ......" | 26831656 | |
| hsa-miR-221-5p | lymphoma | poor survival; drug resistance | "Diagnostic and prognostic value of circulating miR ......" | 21206010 | |
| hsa-miR-221-5p | melanoma | progression; differentiation | "We have identified the promyelocytic leukemia zinc ......" | 18417445 | |
| hsa-miR-221-5p | melanoma | progression | "MicroRNA 221 and 222 pathway controls melanoma pro ......" | 18983236 | |
| hsa-miR-221-5p | melanoma | malignant trasformation; staging; recurrence; progression | "The circulating microRNA 221 level in patients wit ......" | 21273047 | |
| hsa-miR-221-5p | melanoma | malignant trasformation | "Construction of circular miRNA sponges targeting m ......" | 24035906 | |
| hsa-miR-221-5p | melanoma | malignant trasformation; worse prognosis | "Circulating miR 221 expression level and prognosis ......" | 25430553 | |
| hsa-miR-221-5p | ovarian cancer | poor survival | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 | |
| hsa-miR-221-5p | ovarian cancer | worse prognosis; staging; poor survival | "Prognostic significance of serum microRNA 221 expr ......" | 23569131 | |
| hsa-miR-221-5p | pancreatic cancer | malignant trasformation | "The contribution of overexpressed microRNA-21 and ......" | 19730150 | |
| hsa-miR-221-5p | pancreatic cancer | tumorigenesis | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-miR-221-5p | pancreatic cancer | metastasis; malignant trasformation | "Clinical impact of circulating miR 221 in plasma o ......" | 23329235 | |
| hsa-miR-221-5p | pancreatic cancer | poor survival | "Down regulation of miR 221 inhibits proliferation ......" | 24224124 | |
| hsa-miR-221-5p | pancreatic cancer | metastasis; tumorigenesis; drug resistance; progression | "Antisense inhibition of microRNA 21 and microRNA 2 ......" | 25639539 | Flow cytometry |
| hsa-miR-221-5p | pancreatic cancer | progression | "Serum samples were collected for the measurement o ......" | 26998056 | |
| hsa-miR-221-5p | pancreatic cancer | drug resistance | "In particular modulations of let-7 miR-29a miR-17- ......" | 27539232 | |
| hsa-miR-221-5p | prostate cancer | drug resistance | "The role of microRNA 221 and microRNA 222 in andro ......" | 19351832 | |
| hsa-miR-221-5p | prostate cancer | metastasis; progression; recurrence | "Expression of microRNA 221 is progressively reduce ......" | 19585579 | |
| hsa-miR-221-5p | prostate cancer | differentiation; staging | "MiR 221 expression affects invasion potential of h ......" | 21487968 | Cell proliferation assay; Cell Proliferation Assay; Western blot |
| hsa-miR-221-5p | prostate cancer | progression | "The expression and clinical significance of GTP bi ......" | 22117988 | |
| hsa-miR-221-5p | prostate cancer | recurrence | "miR 21 miR 221 and miR 222 expression and prostate ......" | 23353719 | |
| hsa-miR-221-5p | prostate cancer | metastasis | "MiR 221 promotes the development of androgen indep ......" | 23770851 | |
| hsa-miR-221-5p | prostate cancer | poor survival | "Survival in patients with high risk prostate cance ......" | 24607843 | |
| hsa-miR-221-5p | prostate cancer | recurrence | "Investigation of miR 21 miR 141 and miR 221 expres ......" | 25252191 | |
| hsa-miR-221-5p | prostate cancer | cell migration | "Our present study of the microRNA miRNA expression ......" | 26325107 | |
| hsa-miR-221-5p | sarcoma | poor survival; drug resistance; malignant trasformation | "MicroRNA 221 induces cell survival and cisplatin r ......" | 23372675 | Western blot; Luciferase |
| hsa-miR-221-5p | sarcoma | progression; tumorigenesis | "MiR 221 increases osteosarcoma cell proliferation ......" | 26397386 | Cell migration assay; Wound Healing Assay; Western blot |
| hsa-miR-221-5p | thyroid cancer | tumorigenesis | "A set of five miRNAs including the three most up-r ......" | 16365291 | |
| hsa-miR-221-5p | thyroid cancer | tumorigenesis | "MicroRNA miRNA microarray analysis has consistentl ......" | 18587330 | |
| hsa-miR-221-5p | thyroid cancer | malignant trasformation | "Quantitative polymerase chain reaction on a panel ......" | 21275764 | |
| hsa-miR-221-5p | thyroid cancer | metastasis; recurrence | "In this study we evaluated miRNA expression as a m ......" | 21537871 | |
| hsa-miR-221-5p | thyroid cancer | malignant trasformation | "A limited set of miRNA have been assessed as part ......" | 22771635 | |
| hsa-miR-221-5p | thyroid cancer | staging; metastasis; tumor size | "Overexpression of miR 221 is associated with aggre ......" | 22855362 | |
| hsa-miR-221-5p | thyroid cancer | motility | "HMGB1 induces the overexpression of miR 222 and mi ......" | 23023232 | |
| hsa-miR-221-5p | thyroid cancer | tumorigenesis | "Upregulation of miRNAs such as miR-146b miR-221 an ......" | 25202329 | |
| hsa-miR-221-5p | thyroid cancer | malignant trasformation | "We found that miR-146-5p miR-221-5p miR-222-3p miR ......" | 27586203 |
Reported gene related to hsa-miR-221-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-221-5p | breast cancer | CDKN1B | "miR-221 knockdown not only blocked cell cycle prog ......" | 23637992 |
| hsa-miR-221-5p | breast cancer | CDKN1B | "A Slug/miR-221 network has been suggested linking ......" | 23939688 |
| hsa-miR-221-5p | breast cancer | CDKN1B | "Peptide nucleic acids targeting miR 221 modulate p ......" | 22992757 |
| hsa-miR-221-5p | glioblastoma | CDKN1B | "Based on bioinformatic analysis we found that the ......" | 19953484 |
| hsa-miR-221-5p | glioblastoma | CDKN1B | "Antagonism of either microRNA 221 or 222 in gliobl ......" | 17721077 |
| hsa-miR-221-5p | liver cancer | CDKN1B | "Matched HCC and adjacent non-cancerous samples wer ......" | 20146005 |
| hsa-miR-221-5p | melanoma | CDKN1B | "Moreover a series of functional assays demonstrate ......" | 19126397 |
| hsa-miR-221-5p | ovarian cancer | CDKN1B | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 |
| hsa-miR-221-5p | pancreatic cancer | CDKN1B | "Additionally the PDGF-dependent increase in cell p ......" | 23967190 |
| hsa-miR-221-5p | prostate cancer | CDKN1B | "miR 221 and miR 222 expression affects the prolife ......" | 17569667 |
| hsa-miR-221-5p | breast cancer | PTEN | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 |
| hsa-miR-221-5p | breast cancer | PTEN | "Trail resistance induces epithelial mesenchymal tr ......" | 24905916 |
| hsa-miR-221-5p | cervical and endocervical cancer | PTEN | "MicroRNA 221 targets PTEN to reduce the sensitivit ......" | 26482612 |
| hsa-miR-221-5p | colorectal cancer | PTEN | "The X-ray radiation dose had a significant effect ......" | 24409057 |
| hsa-miR-221-5p | colorectal cancer | PTEN | "Anti microRNA 221 enhances radiosensitivity of col ......" | 23688995 |
| hsa-miR-221-5p | gastric cancer | PTEN | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 |
| hsa-miR-221-5p | glioblastoma | PTEN | "Further investigation revealed that miR-221 down-r ......" | 24780067 |
| hsa-miR-221-5p | pancreatic cancer | PTEN | "Protein levels of tumor suppressor targets of the ......" | 19730150 |
| hsa-miR-221-5p | sarcoma | PTEN | "Moreover luciferase reporter assay and western blo ......" | 23372675 |
| hsa-miR-221-5p | sarcoma | PTEN | "MiR 221 increases osteosarcoma cell proliferation ......" | 26397386 |
| hsa-miR-221-5p | breast cancer | DIRAS3 | "Effects of ARHI on breast cancer cell biological b ......" | 23801152 |
| hsa-miR-221-5p | prostate cancer | DIRAS3 | "Further studies on a new mechanism of ARHI downreg ......" | 21071579 |
| hsa-miR-221-5p | prostate cancer | DIRAS3 | "MicroRNA 221 and 222 have been shown to regulate A ......" | 22117988 |
| hsa-miR-221-5p | colorectal cancer | RECK | "MicroRNA 221 promotes colorectal cancer cell invas ......" | 24269686 |
| hsa-miR-221-5p | gastric cancer | RECK | "miR 221 and miR 222 Simultaneously Target RECK and ......" | 26364844 |
| hsa-miR-221-5p | pancreatic cancer | RECK | "Protein levels of tumor suppressor targets of the ......" | 19730150 |
| hsa-miR-221-5p | breast cancer | SNAI2 | "Slug upregulated miR 221 promotes breast cancer pr ......" | 27174021 |
| hsa-miR-221-5p | breast cancer | SNAI2 | "A Slug/miR-221 network has been suggested linking ......" | 23939688 |
| hsa-miR-221-5p | breast cancer | SNAI2 | "Correlation between Slug transcription factor and ......" | 23031797 |
| hsa-miR-221-5p | prostate cancer | AR | "Overexpressing of miR-221 in LNCaP reduced the tra ......" | 23770851 |
| hsa-miR-221-5p | prostate cancer | AR | "Unexpectedly it was found that treatment with the ......" | 25846647 |
| hsa-miR-221-5p | bladder cancer | BBC3 | "MiR 221 induced PUMA silencing mediates immune eva ......" | 25585941 |
| hsa-miR-221-5p | glioblastoma | BBC3 | "MiR 221 and miR 222 target PUMA to induce cell sur ......" | 20813046 |
| hsa-miR-221-5p | breast cancer | NR4A1 | "We demonstrated that ERalpha negatively modulates ......" | 20388878 |
| hsa-miR-221-5p | breast cancer | NR4A1 | "The expression level of miR-221 was significantly ......" | 22156446 |
| hsa-miR-221-5p | colorectal cancer | TP53 | "Circulating miR 221 directly amplified from plasma ......" | 20880178 |
| hsa-miR-221-5p | liver cancer | TP53 | "Interestingly miR-221 can activate the p53/mdm2 ax ......" | 24324033 |
| hsa-miR-221-5p | breast cancer | TRPS1 | "In breast cancer the microRNAs miRNAs miR-221 and ......" | 23776679 |
| hsa-miR-221-5p | pancreatic cancer | TRPS1 | "Down-regulation of TRPS1 by miR-221 is critical fo ......" | 23967190 |
| hsa-miR-221-5p | liver cancer | ANG | "We unraveled a linear pathway in which SND1-induce ......" | 22396537 |
| hsa-miR-221-5p | liver cancer | ANXA5 | "More cell apoptosis and necrosis were significantl ......" | 22152314 |
| hsa-miR-221-5p | cervical and endocervical cancer | ARID1A | "MiR 221 and miR 222 simultaneously target ARID1A a ......" | 27160122 |
| hsa-miR-221-5p | breast cancer | ATXN1 | "The EMT related gene ATXN1 was found to be a miR-2 ......" | 25686829 |
| hsa-miR-221-5p | cervical and endocervical cancer | BCL2 | "Upregulation of miR-221 expression in cervical can ......" | 26482612 |
| hsa-miR-221-5p | breast cancer | BCL2L11 | "Knockdown of miR 221 promotes the cisplatin induci ......" | 26503209 |
| hsa-miR-221-5p | liver cancer | BMF | "MicroRNA 221 targets Bmf in hepatocellular carcino ......" | 19671867 |
| hsa-miR-221-5p | thyroid cancer | BRAF | "Overexpression of miR 221 is associated with aggre ......" | 22855362 |
| hsa-miR-221-5p | breast cancer | CDH1 | "Slug upregulated miR 221 promotes breast cancer pr ......" | 27174021 |
| hsa-miR-221-5p | ovarian cancer | CDKN1C | "miR-221 and miR-222 negatively regulate expression ......" | 20461750 |
| hsa-miR-221-5p | liver cancer | CDKN3 | "Here we proved that the cyclin-dependent kinase in ......" | 18521080 |
| hsa-miR-221-5p | melanoma | CMM | "The aim of this study was to investigate the feasi ......" | 25430553 |
| hsa-miR-221-5p | liver cancer | CXCL16 | "We unraveled a linear pathway in which SND1-induce ......" | 22396537 |
| hsa-miR-221-5p | breast cancer | DNMT3B | "MiR 221 promotes stemness of breast cancer cells b ......" | 26556862 |
| hsa-miR-221-5p | prostate cancer | DVL2 | "MiR 221 expression affects invasion potential of h ......" | 21487968 |
| hsa-miR-221-5p | prostate cancer | ENO2 | "Overexpression of miR-221 in LNCaP cells significa ......" | 21487968 |
| hsa-miR-221-5p | breast cancer | ERBB2 | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 |
| hsa-miR-221-5p | liver cancer | ESR1 | "HBx protein induced upregulation of microRNA 221 p ......" | 25483016 |
| hsa-miR-221-5p | melanoma | ETS1 | "To close the loop we demonstrate ETS-1 as a direct ......" | 21711453 |
| hsa-miR-221-5p | thyroid cancer | FLNA | "In addition the oPD thyroid carcinomas demonstrate ......" | 24443580 |
| hsa-miR-221-5p | melanoma | FRTS1 | "Patients with high serum miR-221 levels had a sign ......" | 25430553 |
| hsa-miR-221-5p | liver cancer | HDAC6 | "MicroRNA 221 governs tumor suppressor HDAC6 to pot ......" | 25817558 |
| hsa-miR-221-5p | prostate cancer | HECTD2 | "MiR 221 promotes the development of androgen indep ......" | 23770851 |
| hsa-miR-221-5p | thyroid cancer | HMGB1 | "HMGB1 induces the overexpression of miR 222 and mi ......" | 23023232 |
| hsa-miR-221-5p | thyroid cancer | HOXB5 | "Of several genes downregulated more than 2-fold by ......" | 18794255 |
| hsa-miR-221-5p | pancreatic cancer | HRAS | "Similarly the effect of ASO-miR-221 transfection i ......" | 26046003 |
| hsa-miR-221-5p | melanoma | IFNB1 | "Inhibition of hPNPaseold-35 by shRNA or stable ove ......" | 20547861 |
| hsa-miR-221-5p | prostate cancer | IRF2 | "Survival in patients with high risk prostate cance ......" | 24607843 |
| hsa-miR-221-5p | kidney renal cell cancer | KDR | "We validated the negative correlation between miR- ......" | 26201448 |
| hsa-miR-221-5p | kidney renal cell cancer | LARP6 | "Gain of function experiments showed that miR-221 a ......" | 26201448 |
| hsa-miR-221-5p | colorectal cancer | MBD2 | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 |
| hsa-miR-221-5p | liver cancer | MDM2 | "Interestingly miR-221 can activate the p53/mdm2 ax ......" | 24324033 |
| hsa-miR-221-5p | pancreatic cancer | MIA | "Significant upregulation of serum miRNAs at earlie ......" | 26998056 |
| hsa-miR-221-5p | breast cancer | PAK1 | "The investigation of miR 221 3p and PAK1 gene expr ......" | 25447917 |
| hsa-miR-221-5p | prostate cancer | PDZD2 | "MiR-221 was significantly increased compared AIPC ......" | 21487968 |
| hsa-miR-221-5p | glioblastoma | PI3 | "MicroRNA 221 targeting PI3 K/Akt signaling axis in ......" | 24780067 |
| hsa-miR-221-5p | cervical and endocervical cancer | PIK3CD | "Importantly gefitinib sensitivity was decreased by ......" | 26482612 |
| hsa-miR-221-5p | melanoma | PML | "We have identified the promyelocytic leukemia zinc ......" | 18417445 |
| hsa-miR-221-5p | melanoma | PNPT1 | "Human polynucleotide phosphorylase selectively and ......" | 20547861 |
| hsa-miR-221-5p | breast cancer | QRSL1 | "In breast cancer the microRNAs miRNAs miR-221 and ......" | 23776679 |
| hsa-miR-221-5p | prostate cancer | RAB1A | "MiR 221 promotes the development of androgen indep ......" | 23770851 |
| hsa-miR-221-5p | colorectal cancer | RELA | "Human CRC tissues had higher levels of miR-221 and ......" | 24931456 |
| hsa-miR-221-5p | acute myeloid leukemia | RUNX1 | "The integrated information gathered from the two m ......" | 25612891 |
| hsa-miR-221-5p | colorectal cancer | SERPINB5 | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 |
| hsa-miR-221-5p | prostate cancer | SIRT1 | "Down regulation of mir 221 and mir 222 restrain pr ......" | 24892674 |
| hsa-miR-221-5p | breast cancer | SNAI1 | "Moreover miR-221 was specifically upregulated by S ......" | 27174021 |
| hsa-miR-221-5p | liver cancer | SND1 | "Because SND1 regulates NF-κB and miR-221 two impo ......" | 22396537 |
| hsa-miR-221-5p | prostate cancer | SOCS3 | "Survival in patients with high risk prostate cance ......" | 24607843 |
| hsa-miR-221-5p | pancreatic cancer | SPNS1 | "Significant upregulation of serum miRNAs at earlie ......" | 26998056 |
| hsa-miR-221-5p | colorectal cancer | STAT3 | "A microRNA 221 and 222 mediated feedback loop main ......" | 24931456 |
| hsa-miR-221-5p | bladder cancer | STMN1 | "miR 221 facilitates the TGFbeta1 induced epithelia ......" | 25928257 |
| hsa-miR-221-5p | kidney renal cell cancer | TIMP2 | "Moreover at the molecular level our results sugges ......" | 26191221 |
| hsa-miR-221-5p | thyroid cancer | TIMP3 | "MiR 221 Exacerbate Cell Proliferation and Invasion ......" | 27077469 |
| hsa-miR-221-5p | breast cancer | WIPF2 | "In addition we showed that in Slug-silenced cells ......" | 23031797 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-221-5p | MCF2L | 9 cancers: BLCA; CESC; COAD; KIRP; LUAD; LUSC; PAAD; THCA; UCEC | mirMAP | TCGA BLCA -0.324; TCGA CESC -0.22; TCGA COAD -0.134; TCGA KIRP -0.106; TCGA LUAD -0.288; TCGA LUSC -0.172; TCGA PAAD -0.15; TCGA THCA -0.069; TCGA UCEC -0.14 |
Enriched cancer pathways of putative targets