microRNA information: hsa-miR-223-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-223-3p | miRbase |
| Accession: | MIMAT0000280 | miRbase |
| Precursor name: | hsa-mir-223 | miRbase |
| Precursor accession: | MI0000300 | miRbase |
| Symbol: | MIR223 | HGNC |
| RefSeq ID: | NR_029637 | GenBank |
| Sequence: | UGUCAGUUUGUCAAAUACCCCA |
Reported expression in cancers: hsa-miR-223-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-223-3p | B cell lymphoma | deregulation | "Expression of microRNA 223 and its clinicopatholog ......" | 22932402 | Microarray; Reverse transcription PCR; qPCR |
| hsa-miR-223-3p | T cell leukemia | deregulation | "Specifically miR-150 and miR-223 were up-regulated ......" | 19246560 | |
| hsa-miR-223-3p | acute myeloid leukemia | downregulation | "Among them miR-128a and -128b are significantly ov ......" | 18056805 | qPCR |
| hsa-miR-223-3p | acute myeloid leukemia | downregulation | "Recent studies show microRNA-223 miR-223 a transcr ......" | 20029046 | |
| hsa-miR-223-3p | acute myeloid leukemia | downregulation | "We identified a single case with a hemizygous dele ......" | 24009227 | |
| hsa-miR-223-3p | breast cancer | downregulation | "RNA was extracted reverse transcribed and subjecte ......" | 24498016 | Microarray |
| hsa-miR-223-3p | breast cancer | downregulation | "MiR-223 reportedly acts as a tumor suppressor in a ......" | 27618431 | |
| hsa-miR-223-3p | cervical and endocervical cancer | downregulation | "MiR 223 inhibited cell metastasis of human cervica ......" | 26617846 | |
| hsa-miR-223-3p | colon cancer | downregulation | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | Microarray; qPCR |
| hsa-miR-223-3p | colorectal cancer | upregulation | "Deregulated level of microRNA-223 miR-223 was scre ......" | 24819398 | qPCR; Microarray |
| hsa-miR-223-3p | colorectal cancer | upregulation | "Overexpression of miR 223 correlates with tumor me ......" | 25270282 | qPCR |
| hsa-miR-223-3p | colorectal cancer | upregulation | "The functional effects of miR-223 and the effects ......" | 25867276 | |
| hsa-miR-223-3p | colorectal cancer | upregulation | "Serum miRNAs were extracted from all subjects to a ......" | 27135244 | |
| hsa-miR-223-3p | esophageal cancer | downregulation | "We found that miR-223 expression was significantly ......" | 22108521 | |
| hsa-miR-223-3p | esophageal cancer | deregulation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
| hsa-miR-223-3p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
| hsa-miR-223-3p | esophageal cancer | upregulation | "Importantly the high ESCC marked-ZD esophagus had ......" | 26918602 | |
| hsa-miR-223-3p | gastric cancer | upregulation | "MicroRNA 223 functions as an oncogene in human gas ......" | 22270966 | qPCR |
| hsa-miR-223-3p | gastric cancer | upregulation | "In the group of consistently reported microRNAs mi ......" | 24902858 | |
| hsa-miR-223-3p | gastric cancer | upregulation | "Increased microRNA 223 in Helicobacter pylori asso ......" | 25036956 | |
| hsa-miR-223-3p | head and neck cancer | upregulation | "To explore circulating miRNAs as cancer therapy bi ......" | 25950115 | qPCR; Microarray |
| hsa-miR-223-3p | kidney renal cell cancer | upregulation | "Expression of miR 223 in clear cell renal cell car ......" | 25818776 | qPCR |
| hsa-miR-223-3p | liver cancer | downregulation | "MicroRNA 223 is commonly repressed in hepatocellul ......" | 18555017 | Microarray |
| hsa-miR-223-3p | liver cancer | downregulation | "This study was divided into four phases: I Ten can ......" | 22174818 | qPCR |
| hsa-miR-223-3p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
| hsa-miR-223-3p | lymphoma | downregulation | "miR 223 regulates cell growth and targets proto on ......" | 24304814 | |
| hsa-miR-223-3p | melanoma | deregulation | "Comparative microarray analysis of microRNA expres ......" | 23111773 | Microarray; RNA-Seq; qPCR |
| hsa-miR-223-3p | pancreatic cancer | downregulation | "The miR-223 inhibitor was used to determine its ro ......" | 25638153 | |
| hsa-miR-223-3p | prostate cancer | upregulation | "The altered expression of miR-223 has been reporte ......" | 25519054 | |
| hsa-miR-223-3p | prostate cancer | downregulation | "Tumor suppressive microRNA 223 inhibits cancer cel ......" | 26509963 | |
| hsa-miR-223-3p | sarcoma | downregulation | "Similar analysis in mouse metastatic sarcomas reve ......" | 26044957 |
Reported cancer pathway affected by hsa-miR-223-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-223-3p | acute myeloid leukemia | cell cycle pathway | "Cell cycle regulator E2F1 and microRNA 223 compris ......" | 20029046 | |
| hsa-miR-223-3p | breast cancer | Apoptosis pathway | "MicroRNA 223 Increases the Sensitivity of Triple N ......" | 27618431 | |
| hsa-miR-223-3p | cervical and endocervical cancer | Epithelial mesenchymal transition pathway | "MiR 223 inhibited cell metastasis of human cervica ......" | 26617846 | Cell migration assay |
| hsa-miR-223-3p | gastric cancer | Apoptosis pathway | "MicroRNA 223 functions as an oncogene in human gas ......" | 22270966 | Western blot; Flow cytometry; Colony formation; Transwell assay; Luciferase |
| hsa-miR-223-3p | gastric cancer | Apoptosis pathway | "We also identified miR-223 which can regulate FBXW ......" | 25159729 | |
| hsa-miR-223-3p | gastric cancer | cell cycle pathway | "MiR 223 promotes the cisplatin resistance of human ......" | 25888377 | |
| hsa-miR-223-3p | glioblastoma | cell cycle pathway | "microRNA 223 promotes the growth and invasion of g ......" | 23970099 | Luciferase |
| hsa-miR-223-3p | kidney renal cell cancer | cell cycle pathway | "Expression of miR 223 in clear cell renal cell car ......" | 25818776 | Flow cytometry |
| hsa-miR-223-3p | lymphoma | Apoptosis pathway | "According to the literature and miRNA database the ......" | 22177245 | |
| hsa-miR-223-3p | lymphoma | Apoptosis pathway | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
| hsa-miR-223-3p | pancreatic cancer | Apoptosis pathway | "Genistein down regulates miR 223 expression in pan ......" | 23834147 | |
| hsa-miR-223-3p | pancreatic cancer | Epithelial mesenchymal transition pathway | "Down regulation of miR 223 reverses epithelial mes ......" | 25638153 | Western blot |
| hsa-miR-223-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "Heat shock protein 90B1 plays an oncogenic role an ......" | 23208072 | Luciferase; Western blot; MTT assay; Flow cytometry |
| hsa-miR-223-3p | sarcoma | cell cycle pathway | "Cell cycle analysis by flow cytometry showed the a ......" | 23601845 | Flow cytometry |
| hsa-miR-223-3p | sarcoma | cell cycle pathway | "MicroRNA-223 miR-223 has been demonstrated to be i ......" | 24784921 |
Reported cancer prognosis affected by hsa-miR-223-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-223-3p | B cell lymphoma | worse prognosis; poor survival | "Expression of microRNA 223 and its clinicopatholog ......" | 22932402 | |
| hsa-miR-223-3p | acute myeloid leukemia | progression; differentiation | "Cell cycle regulator E2F1 and microRNA 223 compris ......" | 20029046 | |
| hsa-miR-223-3p | acute myeloid leukemia | differentiation | "The integrated information gathered from the two m ......" | 25612891 | |
| hsa-miR-223-3p | acute myeloid leukemia | differentiation; poor survival | "De Novo Acute Myeloid Leukemia in Adults: Suppress ......" | 25710580 | |
| hsa-miR-223-3p | acute myeloid leukemia | differentiation; worse prognosis; staging | "MicroRNA 223 dose levels fine tune proliferation a ......" | 26163797 | |
| hsa-miR-223-3p | bladder cancer | tumorigenesis | "miR 223 increases gallbladder cancer cell sensitiv ......" | 27577078 | Flow cytometry; Western blot |
| hsa-miR-223-3p | bladder cancer | cell migration | "Ginkgolide B Inhibits Human Bladder Cancer Cell Mi ......" | 27744452 | Western blot |
| hsa-miR-223-3p | breast cancer | malignant trasformation | "Caprin 1 is a novel microRNA 223 target for regula ......" | 23953883 | |
| hsa-miR-223-3p | breast cancer | progression; tumorigenesis; poor survival; drug resistance | "miR 223 is a coordinator of breast cancer progress ......" | 24400121 | |
| hsa-miR-223-3p | breast cancer | staging | "Global miRNA analysis was performed on prospective ......" | 25004125 | |
| hsa-miR-223-3p | breast cancer | drug resistance; recurrence | "Radiotherapy induced miR 223 prevents relapse of b ......" | 26876200 | |
| hsa-miR-223-3p | cervical and endocervical cancer | metastasis; cell migration | "MiR 223 inhibited cell metastasis of human cervica ......" | 26617846 | Cell migration assay |
| hsa-miR-223-3p | colon cancer | staging | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | |
| hsa-miR-223-3p | colorectal cancer | cell migration; staging | "MicroRNA 223 functions as an oncogene in human col ......" | 24819398 | Colony formation; Transwell assay |
| hsa-miR-223-3p | colorectal cancer | metastasis; worse prognosis; tumorigenesis; staging; poor survival; differentiation; tumor size; progression | "Overexpression of miR 223 correlates with tumor me ......" | 25270282 | |
| hsa-miR-223-3p | esophageal cancer | cell migration; metastasis | "miR 223 regulates migration and invasion by target ......" | 21453483 | Western blot; Wound Healing Assay; Luciferase |
| hsa-miR-223-3p | esophageal cancer | worse prognosis; poor survival | "Overexpression of microRNA 223 regulates the ubiqu ......" | 22108521 | |
| hsa-miR-223-3p | esophageal cancer | poor survival | "Clinical significance of serum miR 223 miR 25 and ......" | 24390317 | |
| hsa-miR-223-3p | gastric cancer | poor survival | "Several microarray studies have reported microRNA ......" | 19951901 | |
| hsa-miR-223-3p | gastric cancer | metastasis; poor survival | "In this study we evaluated the miRNA expression pa ......" | 21628394 | |
| hsa-miR-223-3p | gastric cancer | motility; staging; metastasis | "MicroRNA 223 functions as an oncogene in human gas ......" | 22270966 | Western blot; Flow cytometry; Colony formation; Transwell assay; Luciferase |
| hsa-miR-223-3p | gastric cancer | metastasis; tumorigenesis; staging | "Plasma microRNAs miR 223 miR 21 and miR 218 as nov ......" | 22860003 | |
| hsa-miR-223-3p | gastric cancer | worse prognosis | "Increased microRNA 223 in Helicobacter pylori asso ......" | 25036956 | Colony formation |
| hsa-miR-223-3p | gastric cancer | drug resistance | "We also identified miR-223 which can regulate FBXW ......" | 25159729 | |
| hsa-miR-223-3p | gastric cancer | drug resistance | "MiR 223 promotes the cisplatin resistance of human ......" | 25888377 | |
| hsa-miR-223-3p | gastric cancer | staging | "In the second stage differentially expressed miRNA ......" | 26172537 | |
| hsa-miR-223-3p | kidney renal cell cancer | tumor size; cell migration | "Expression of miR 223 in clear cell renal cell car ......" | 25818776 | Flow cytometry |
| hsa-miR-223-3p | liver cancer | tumorigenesis | "Role of microRNA 223 and its target gene oncogene ......" | 21492514 | Western blot |
| hsa-miR-223-3p | liver cancer | recurrence | "18 miRNAs including 6 up-regulated and 12 down-reg ......" | 22552153 | |
| hsa-miR-223-3p | liver cancer | drug resistance | "MiR 223 modulates multidrug resistance via downreg ......" | 23925649 | Western blot |
| hsa-miR-223-3p | liver cancer | metastasis; cell migration | "Sulfatide epigenetically regulates miR 223 and pro ......" | 24333181 | |
| hsa-miR-223-3p | liver cancer | staging | "Serum microRNAs; miR 30c 5p miR 223 3p miR 302c 3p ......" | 25391771 | |
| hsa-miR-223-3p | lung squamous cell cancer | poor survival | "Five selected miRNAs let-7f miR-20b miR-30e-3p miR ......" | 20595154 | |
| hsa-miR-223-3p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
| hsa-miR-223-3p | lung squamous cell cancer | drug resistance | "miR 223 enhances the sensitivity of non small cell ......" | 27177336 | Western blot |
| hsa-miR-223-3p | lymphoma | staging; progression | "miR 223 regulates cell growth and targets proto on ......" | 24304814 | |
| hsa-miR-223-3p | lymphoma | differentiation | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
| hsa-miR-223-3p | lymphoma | poor survival | "Studies using miRNA arrays and subsequent real-tim ......" | 24745613 | |
| hsa-miR-223-3p | lymphoma | worse prognosis; drug resistance | "Presence of certain miRs miRNA-16 -21 -24 -29b -12 ......" | 25388103 | |
| hsa-miR-223-3p | melanoma | metastasis; malignant trasformation | "Comparative microarray analysis of microRNA expres ......" | 23111773 | |
| hsa-miR-223-3p | pancreatic cancer | staging | "In addition from 10 to 50 weeks of age stage-speci ......" | 26516699 | |
| hsa-miR-223-3p | pancreatic cancer | staging | "Using Affymetrix microarrays we established a glob ......" | 26807325 | |
| hsa-miR-223-3p | pancreatic cancer | motility | "Synergistic reversal effect of epithelial to mesen ......" | 27429851 | |
| hsa-miR-223-3p | prostate cancer | cell migration | "Tumor suppressive microRNA 223 inhibits cancer cel ......" | 26509963 | |
| hsa-miR-223-3p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
| hsa-miR-223-3p | sarcoma | progression | "Cell cycle analysis by flow cytometry showed the a ......" | 23601845 | Flow cytometry |
| hsa-miR-223-3p | sarcoma | progression; metastasis; recurrence; drug resistance; worse prognosis | "MicroRNA-223 miR-223 has been demonstrated to be i ......" | 24784921 | |
| hsa-miR-223-3p | sarcoma | poor survival; cell migration; staging; metastasis | "MicroRNA-223 miR-223 has been shown to be a potent ......" | 27335775 |
Reported gene related to hsa-miR-223-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-223-3p | esophageal cancer | FBXW7 | "Overexpression of microRNA 223 regulates the ubiqu ......" | 22108521 |
| hsa-miR-223-3p | gastric cancer | FBXW7 | "MiR 223 promotes the cisplatin resistance of human ......" | 25888377 |
| hsa-miR-223-3p | gastric cancer | FBXW7 | "We also identified miR-223 which can regulate FBXW ......" | 25159729 |
| hsa-miR-223-3p | gastric cancer | FBXW7 | "FBXW7/hCdc4 protein FBW7 levels in gastric cancer ......" | 22270966 |
| hsa-miR-223-3p | lung squamous cell cancer | FBXW7 | "In addition FBW7 was identified as a functional ta ......" | 27398136 |
| hsa-miR-223-3p | pancreatic cancer | FBXW7 | "We found that genistein treatment significantly in ......" | 23834147 |
| hsa-miR-223-3p | pancreatic cancer | FBXW7 | "More importantly miR-223 governs GR-induced EMT in ......" | 25638153 |
| hsa-miR-223-3p | bladder cancer | STMN1 | "miR 223 increases gallbladder cancer cell sensitiv ......" | 27577078 |
| hsa-miR-223-3p | gastric cancer | STMN1 | "We also explored the regulation of STMN1 expressio ......" | 22470493 |
| hsa-miR-223-3p | liver cancer | STMN1 | "A strong inverse relationship between STMN1 mRNA a ......" | 18555017 |
| hsa-miR-223-3p | sarcoma | ECT2 | "MicroRNA-223 miR-223 has been demonstrated to be i ......" | 24784921 |
| hsa-miR-223-3p | sarcoma | ECT2 | "Further mechanistic study indicated that Ect2 was ......" | 23601845 |
| hsa-miR-223-3p | gastric cancer | EPB41L3 | "Mechanistically miR-223 induced by the transcripti ......" | 21628394 |
| hsa-miR-223-3p | lung cancer | EPB41L3 | "MicroRNA 223 delivered by platelet derived microve ......" | 25881295 |
| hsa-miR-223-3p | B cell lymphoma | LMO2 | "We provide experimental evidence that these change ......" | 19047678 |
| hsa-miR-223-3p | acute myeloid leukemia | LMO2 | "De Novo Acute Myeloid Leukemia in Adults: Suppress ......" | 25710580 |
| hsa-miR-223-3p | liver cancer | ABCB1 | "MiR 223 modulates multidrug resistance via downreg ......" | 23925649 |
| hsa-miR-223-3p | esophageal cancer | ARTN | "miR 223 regulates migration and invasion by target ......" | 21453483 |
| hsa-miR-223-3p | breast cancer | CAPRIN1 | "Caprin 1 is a novel microRNA 223 target for regula ......" | 23953883 |
| hsa-miR-223-3p | lung cancer | CASP3 | "miR-223 transfection in the LLC cells was observed ......" | 24137330 |
| hsa-miR-223-3p | breast cancer | CASZ1 | "The analysis of miR-223 predicted targets revealed ......" | 24400121 |
| hsa-miR-223-3p | cervical and endocervical cancer | CDH1 | "In terms of mechanism miR-223 influenced the expre ......" | 26617846 |
| hsa-miR-223-3p | lung cancer | CDK2 | "Using a luciferase activity assay and western blot ......" | 24137330 |
| hsa-miR-223-3p | acute myeloid leukemia | CORD1 | "MicroRNA 223 dose levels fine tune proliferation a ......" | 26163797 |
| hsa-miR-223-3p | acute myeloid leukemia | E2F1 | "Cell cycle regulator E2F1 and microRNA 223 compris ......" | 20029046 |
| hsa-miR-223-3p | breast cancer | EGF | "Radiotherapy induced miR 223 prevents relapse of b ......" | 26876200 |
| hsa-miR-223-3p | breast cancer | EGFR | "Accordingly both RT-induced miR-223 and peri-opera ......" | 26876200 |
| hsa-miR-223-3p | acute myeloid leukemia | FANCB | "In AML not otherwise specified category AML with m ......" | 25710580 |
| hsa-miR-223-3p | liver cancer | GAL3ST1 | "Orthotopic growth and intrahepatic and pulmonary m ......" | 24333181 |
| hsa-miR-223-3p | B cell lymphoma | GBA | "The expression levels of miR-223 measured by real- ......" | 22932402 |
| hsa-miR-223-3p | breast cancer | HAX1 | "MicroRNA 223 Increases the Sensitivity of Triple N ......" | 27618431 |
| hsa-miR-223-3p | liver cancer | HDAC10 | "The expression of histone deacetylases HDAC9 and H ......" | 24333181 |
| hsa-miR-223-3p | liver cancer | HDAC9 | "The expression of histone deacetylases HDAC9 and H ......" | 24333181 |
| hsa-miR-223-3p | sarcoma | HSP90B1 | "Co-transfection of miR-223 expression vector with ......" | 23208072 |
| hsa-miR-223-3p | B cell lymphoma | IRF4 | "We provide experimental evidence that these change ......" | 19047678 |
| hsa-miR-223-3p | prostate cancer | ITGA3 | "In silico database and genome-wide gene expression ......" | 26509963 |
| hsa-miR-223-3p | liver cancer | ITGA9 | "Our aim was to investigate miR-223 regulation in H ......" | 24333181 |
| hsa-miR-223-3p | prostate cancer | ITGB1 | "In silico database and genome-wide gene expression ......" | 26509963 |
| hsa-miR-223-3p | liver cancer | KAT6A | "Intriguingly miR-223 expression was suppressed by ......" | 24333181 |
| hsa-miR-223-3p | gastric cancer | MMRN1 | "Gastric cancer cell line SGC7901 transfected with ......" | 22270966 |
| hsa-miR-223-3p | liver cancer | MYC | "Role of microRNA 223 and its target gene oncogene ......" | 21492514 |
| hsa-miR-223-3p | pancreatic cancer | NOTCH1 | "More importantly miR-223 governs GR-induced EMT in ......" | 25638153 |
| hsa-miR-223-3p | liver cancer | NOVA2 | "When all groups were compared versus control group ......" | 24595450 |
| hsa-miR-223-3p | acute myeloid leukemia | NR4A3 | "This also explains the complex yet minor role of m ......" | 26163797 |
| hsa-miR-223-3p | glioblastoma | PAX6 | "microRNA 223 promotes the growth and invasion of g ......" | 23970099 |
| hsa-miR-223-3p | lung cancer | PCNA | "miR 223 functions as a potent tumor suppressor of ......" | 24137330 |
| hsa-miR-223-3p | lymphoma | PRDM1 | "Luciferase assays were performed to verify the dir ......" | 24438193 |
| hsa-miR-223-3p | colorectal cancer | RASA1 | "C/EBP β activated microRNA 223 promotes tumour gr ......" | 25867276 |
| hsa-miR-223-3p | acute myeloid leukemia | RUNX1 | "The integrated information gathered from the two m ......" | 25612891 |
| hsa-miR-223-3p | prostate cancer | SEPT6 | "MiR 223 3p targeting SEPT6 promotes the biological ......" | 25519054 |
| hsa-miR-223-3p | breast cancer | STAT5A | "In addition we proved that STAT5A is a direct miR- ......" | 24400121 |
| hsa-miR-223-3p | lymphoma | TCF3 | "Taken together aberrant E2A expression is a diagno ......" | 20802470 |
| hsa-miR-223-3p | gastric cancer | TIMM8A | "Furthermore miR-223 was found to be significantly ......" | 25888377 |
| hsa-miR-223-3p | lymphoma | TOX | "In addition we showed that the 3'-UTR of TOX mRNA ......" | 24304814 |
| hsa-miR-223-3p | lymphoma | TSPYL2 | "CTCL peripheral blood mononuclear cells and cell l ......" | 24304814 |
| hsa-miR-223-3p | gastric cancer | TWIST1 | "Mechanistically miR-223 induced by the transcripti ......" | 21628394 |
| hsa-miR-223-3p | cervical and endocervical cancer | VIM | "In terms of mechanism miR-223 influenced the expre ......" | 26617846 |
| hsa-miR-223-3p | bladder cancer | ZEB1 | "Bladder cells were treated with different doses of ......" | 27744452 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-223-3p | ACVR2A | 13 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.185; TCGA CESC -0.074; TCGA HNSC -0.165; TCGA KIRC -0.16; TCGA KIRP -0.059; TCGA LGG -0.102; TCGA LUAD -0.061; TCGA OV -0.071; TCGA PAAD -0.062; TCGA PRAD -0.062; TCGA THCA -0.055; TCGA STAD -0.136; TCGA UCEC -0.097 |
hsa-miR-223-3p | FAM120C | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.063; TCGA BRCA -0.096; TCGA CESC -0.109; TCGA ESCA -0.227; TCGA HNSC -0.079; TCGA KIRC -0.15; TCGA LGG -0.085; TCGA LIHC -0.085; TCGA PRAD -0.08; TCGA SARC -0.061; TCGA STAD -0.133; TCGA UCEC -0.077 |
hsa-miR-223-3p | ULK2 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.095; TCGA BRCA -0.123; TCGA CESC -0.111; TCGA ESCA -0.179; TCGA HNSC -0.082; TCGA KIRC -0.066; TCGA KIRP -0.059; TCGA PRAD -0.059; TCGA SARC -0.306; TCGA STAD -0.192; TCGA UCEC -0.074 |
hsa-miR-223-3p | YPEL1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; OV; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.238; TCGA CESC -0.219; TCGA COAD -0.129; TCGA ESCA -0.173; TCGA HNSC -0.198; TCGA LGG -0.074; TCGA LIHC -0.192; TCGA LUAD -0.181; TCGA OV -0.084; TCGA SARC -0.294; TCGA STAD -0.134; TCGA UCEC -0.112 |
hsa-miR-223-3p | PARD6B | 9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; OV; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.142; TCGA BRCA -0.437; TCGA KIRC -0.335; TCGA KIRP -0.151; TCGA LUAD -0.109; TCGA OV -0.058; TCGA PRAD -0.126; TCGA SARC -0.361; TCGA THCA -0.065 |
hsa-miR-223-3p | ZFHX3 | 12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.214; TCGA BRCA -0.199; TCGA COAD -0.161; TCGA KIRC -0.121; TCGA KIRP -0.11; TCGA LUAD -0.103; TCGA LUSC -0.116; TCGA OV -0.062; TCGA PRAD -0.151; TCGA SARC -0.206; TCGA THCA -0.064; TCGA STAD -0.2 |
hsa-miR-223-3p | ABI2 | 14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.059; TCGA BRCA -0.067; TCGA CESC -0.098; TCGA HNSC -0.072; TCGA KIRC -0.159; TCGA KIRP -0.14; TCGA LGG -0.086; TCGA LUSC -0.066; TCGA OV -0.07; TCGA PAAD -0.061; TCGA PRAD -0.07; TCGA SARC -0.178; TCGA STAD -0.147; TCGA UCEC -0.066 |
hsa-miR-223-3p | TBC1D17 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.134; TCGA CESC -0.098; TCGA ESCA -0.109; TCGA HNSC -0.087; TCGA KIRC -0.07; TCGA LIHC -0.126; TCGA PAAD -0.139; TCGA SARC -0.081; TCGA THCA -0.088; TCGA STAD -0.118 |
hsa-miR-223-3p | ATP7A | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.133; TCGA BRCA -0.151; TCGA CESC -0.091; TCGA COAD -0.088; TCGA ESCA -0.095; TCGA HNSC -0.093; TCGA KIRC -0.175; TCGA KIRP -0.148; TCGA LUAD -0.098; TCGA LUSC -0.083; TCGA PRAD -0.094; TCGA SARC -0.102; TCGA STAD -0.079; TCGA UCEC -0.056 |
hsa-miR-223-3p | RBM20 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.153; TCGA CESC -0.33; TCGA COAD -0.134; TCGA ESCA -0.217; TCGA HNSC -0.139; TCGA KIRP -0.171; TCGA SARC -0.566; TCGA THCA -0.235; TCGA STAD -0.538; TCGA UCEC -0.143 |
hsa-miR-223-3p | RIBC1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LIHC; OV; PAAD; SARC; THCA | MirTarget | TCGA BLCA -0.156; TCGA BRCA -0.328; TCGA CESC -0.205; TCGA HNSC -0.106; TCGA KIRC -0.086; TCGA LIHC -0.089; TCGA OV -0.098; TCGA PAAD -0.233; TCGA SARC -0.195; TCGA THCA -0.158 |
hsa-miR-223-3p | TMEM143 | 9 cancers: BLCA; ESCA; HNSC; KIRC; LIHC; OV; PAAD; SARC; THCA | MirTarget | TCGA BLCA -0.098; TCGA ESCA -0.133; TCGA HNSC -0.1; TCGA KIRC -0.117; TCGA LIHC -0.151; TCGA OV -0.056; TCGA PAAD -0.106; TCGA SARC -0.079; TCGA THCA -0.103 |
hsa-miR-223-3p | DBT | 13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.077; TCGA BRCA -0.099; TCGA ESCA -0.156; TCGA HNSC -0.07; TCGA KIRC -0.4; TCGA KIRP -0.148; TCGA LIHC -0.079; TCGA LUAD -0.126; TCGA PRAD -0.178; TCGA SARC -0.093; TCGA THCA -0.112; TCGA STAD -0.087; TCGA UCEC -0.066 |
hsa-miR-223-3p | RNF14 | 10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.053; TCGA BRCA -0.133; TCGA COAD -0.059; TCGA KIRC -0.054; TCGA LIHC -0.1; TCGA PAAD -0.053; TCGA PRAD -0.108; TCGA SARC -0.078; TCGA THCA -0.062; TCGA STAD -0.098 |
hsa-miR-223-3p | SARM1 | 9 cancers: BLCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.297; TCGA HNSC -0.273; TCGA LGG -0.212; TCGA LUAD -0.063; TCGA LUSC -0.211; TCGA PAAD -0.15; TCGA SARC -0.265; TCGA STAD -0.089; TCGA UCEC -0.081 |
hsa-miR-223-3p | BTBD7 | 10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.106; TCGA BRCA -0.069; TCGA KIRC -0.098; TCGA KIRP -0.08; TCGA LGG -0.051; TCGA LUAD -0.06; TCGA PRAD -0.083; TCGA SARC -0.148; TCGA THCA -0.06; TCGA STAD -0.06 |
hsa-miR-223-3p | SLC46A1 | 10 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.051; TCGA BRCA -0.187; TCGA HNSC -0.078; TCGA KIRC -0.101; TCGA LIHC -0.21; TCGA LUAD -0.058; TCGA PAAD -0.191; TCGA PRAD -0.134; TCGA STAD -0.095; TCGA UCEC -0.052 |
hsa-miR-223-3p | TNRC6B | 10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.061; TCGA ESCA -0.098; TCGA HNSC -0.085; TCGA KIRC -0.085; TCGA KIRP -0.092; TCGA LGG -0.102; TCGA LUSC -0.098; TCGA PRAD -0.091; TCGA SARC -0.141; TCGA STAD -0.087 |
hsa-miR-223-3p | PGPEP1 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.234; TCGA BRCA -0.085; TCGA COAD -0.107; TCGA HNSC -0.15; TCGA KIRC -0.135; TCGA LIHC -0.166; TCGA PAAD -0.129; TCGA PRAD -0.071; TCGA SARC -0.158; TCGA THCA -0.124; TCGA STAD -0.084 |
hsa-miR-223-3p | RAB11FIP4 | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV | mirMAP | TCGA BLCA -0.121; TCGA BRCA -0.239; TCGA HNSC -0.084; TCGA KIRC -0.513; TCGA KIRP -0.145; TCGA LIHC -0.236; TCGA LUAD -0.063; TCGA LUSC -0.116; TCGA OV -0.118 |
hsa-miR-223-3p | RALGPS1 | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; THCA | mirMAP | TCGA BLCA -0.312; TCGA BRCA -0.241; TCGA CESC -0.128; TCGA COAD -0.1; TCGA HNSC -0.174; TCGA KIRC -0.541; TCGA KIRP -0.163; TCGA LGG -0.083; TCGA LUAD -0.123; TCGA LUSC -0.212; TCGA OV -0.07; TCGA PAAD -0.269; TCGA SARC -0.228; TCGA THCA -0.123 |
hsa-miR-223-3p | MAPK4 | 10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; OV; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.396; TCGA ESCA -0.49; TCGA HNSC -0.19; TCGA KIRC -1.16; TCGA KIRP -0.271; TCGA OV -0.282; TCGA PAAD -0.274; TCGA SARC -1.2; TCGA STAD -0.988; TCGA UCEC -0.29 |
hsa-miR-223-3p | HUNK | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; SARC | mirMAP | TCGA BLCA -0.179; TCGA CESC -0.166; TCGA COAD -0.208; TCGA HNSC -0.272; TCGA KIRC -0.494; TCGA KIRP -0.151; TCGA LGG -0.283; TCGA LUSC -0.26; TCGA SARC -0.551 |
hsa-miR-223-3p | GABRB2 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; STAD; UCEC | mirMAP | TCGA BLCA -0.223; TCGA BRCA -0.309; TCGA CESC -0.304; TCGA ESCA -0.655; TCGA HNSC -0.381; TCGA KIRC -0.748; TCGA KIRP -0.428; TCGA STAD -0.415; TCGA UCEC -0.222 |
hsa-miR-223-3p | AR | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.439; TCGA BRCA -0.552; TCGA CESC -0.204; TCGA ESCA -0.484; TCGA HNSC -0.34; TCGA KIRC -0.34; TCGA KIRP -0.237; TCGA LIHC -0.271; TCGA PRAD -0.206; TCGA SARC -0.696; TCGA STAD -0.495; TCGA UCEC -0.192 |
hsa-miR-223-3p | KSR2 | 14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.673; TCGA BRCA -0.375; TCGA ESCA -0.219; TCGA HNSC -0.344; TCGA KIRC -0.767; TCGA KIRP -0.261; TCGA LGG -0.191; TCGA LUAD -0.175; TCGA LUSC -0.292; TCGA OV -0.134; TCGA PAAD -0.382; TCGA PRAD -0.424; TCGA SARC -0.281; TCGA THCA -0.11 |
hsa-miR-223-3p | SAMD12 | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; THCA | mirMAP | TCGA BLCA -0.335; TCGA BRCA -0.256; TCGA CESC -0.117; TCGA COAD -0.125; TCGA HNSC -0.315; TCGA KIRC -0.42; TCGA LUAD -0.115; TCGA LUSC -0.226; TCGA THCA -0.107 |
hsa-miR-223-3p | ZADH2 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.068; TCGA BRCA -0.07; TCGA CESC -0.058; TCGA ESCA -0.096; TCGA HNSC -0.061; TCGA KIRC -0.259; TCGA KIRP -0.096; TCGA LGG -0.08; TCGA PAAD -0.079; TCGA PRAD -0.076; TCGA SARC -0.054; TCGA THCA -0.092 |
hsa-miR-223-3p | NPTXR | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.312; TCGA BRCA -0.075; TCGA CESC -0.187; TCGA ESCA -0.318; TCGA HNSC -0.245; TCGA LGG -0.087; TCGA LUSC -0.187; TCGA PRAD -0.156; TCGA SARC -0.268; TCGA STAD -0.455; TCGA UCEC -0.195 |
hsa-miR-223-3p | ZNF286B | 10 cancers: BLCA; CESC; KIRC; KIRP; LGG; LUSC; OV; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.12; TCGA CESC -0.075; TCGA KIRC -0.159; TCGA KIRP -0.177; TCGA LGG -0.148; TCGA LUSC -0.189; TCGA OV -0.13; TCGA SARC -0.227; TCGA THCA -0.065; TCGA STAD -0.108 |
hsa-miR-223-3p | IGF1R | 10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUSC; OV; PRAD; SARC; STAD | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BRCA -0.327; TCGA COAD -0.073; TCGA KIRC -0.207; TCGA KIRP -0.146; TCGA LGG -0.106; TCGA LUSC -0.141; TCGA OV -0.161; TCGA PRAD -0.277; TCGA SARC -0.216; TCGA STAD -0.088 |
hsa-miR-223-3p | SP3 | 10 cancers: BRCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA BRCA -0.063; TCGA COAD -0.087; TCGA HNSC -0.07; TCGA KIRP -0.102; TCGA LGG -0.083; TCGA LUAD -0.094; TCGA LUSC -0.107; TCGA PRAD -0.079; TCGA SARC -0.124; TCGA UCEC -0.063 |
hsa-miR-223-3p | RCN2 | 9 cancers: BRCA; KIRC; KIRP; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget | TCGA BRCA -0.068; TCGA KIRC -0.133; TCGA KIRP -0.089; TCGA LUAD -0.089; TCGA LUSC -0.112; TCGA OV -0.086; TCGA PRAD -0.094; TCGA SARC -0.063; TCGA UCEC -0.064 |
hsa-miR-223-3p | HOOK1 | 9 cancers: BRCA; COAD; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BRCA -0.338; TCGA COAD -0.065; TCGA KIRC -0.168; TCGA KIRP -0.185; TCGA LUAD -0.15; TCGA PAAD -0.155; TCGA PRAD -0.091; TCGA SARC -0.322; TCGA THCA -0.125 |
hsa-miR-223-3p | FAM188A | 10 cancers: BRCA; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.065; TCGA ESCA -0.072; TCGA KIRC -0.125; TCGA KIRP -0.069; TCGA LUAD -0.06; TCGA PAAD -0.052; TCGA PRAD -0.1; TCGA SARC -0.064; TCGA STAD -0.119; TCGA UCEC -0.078 |
hsa-miR-223-3p | SSBP2 | 10 cancers: BRCA; CESC; ESCA; HNSC; LUAD; OV; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.115; TCGA CESC -0.324; TCGA ESCA -0.24; TCGA HNSC -0.188; TCGA LUAD -0.077; TCGA OV -0.084; TCGA SARC -0.276; TCGA THCA -0.175; TCGA STAD -0.315; TCGA UCEC -0.084 |
hsa-miR-223-3p | LRIG1 | 9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.189; TCGA CESC -0.149; TCGA ESCA -0.223; TCGA HNSC -0.185; TCGA LGG -0.182; TCGA LUSC -0.08; TCGA SARC -0.284; TCGA STAD -0.237; TCGA UCEC -0.089 |
hsa-miR-223-3p | CXXC4 | 10 cancers: BRCA; COAD; KIRC; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.339; TCGA COAD -0.326; TCGA KIRC -0.23; TCGA LGG -0.327; TCGA LUAD -0.17; TCGA LUSC -0.145; TCGA PAAD -0.345; TCGA SARC -0.272; TCGA THCA -0.298; TCGA STAD -0.408 |
hsa-miR-223-3p | PDS5B | 9 cancers: BRCA; COAD; KIRC; KIRP; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.078; TCGA COAD -0.077; TCGA KIRC -0.152; TCGA KIRP -0.134; TCGA OV -0.06; TCGA PAAD -0.068; TCGA SARC -0.091; TCGA STAD -0.054; TCGA UCEC -0.075 |
hsa-miR-223-3p | MTSS1 | 10 cancers: BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.177; TCGA COAD -0.188; TCGA KIRC -0.219; TCGA KIRP -0.204; TCGA LGG -0.194; TCGA LIHC -0.161; TCGA LUAD -0.097; TCGA THCA -0.157; TCGA STAD -0.231; TCGA UCEC -0.153 |
hsa-miR-223-3p | PAIP1 | 9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; UCEC | MirTarget | TCGA BRCA -0.089; TCGA COAD -0.074; TCGA KIRC -0.079; TCGA KIRP -0.068; TCGA LIHC -0.062; TCGA LUAD -0.088; TCGA LUSC -0.072; TCGA PRAD -0.065; TCGA UCEC -0.058 |
hsa-miR-223-3p | TRIL | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.185; TCGA CESC -0.268; TCGA ESCA -0.211; TCGA HNSC -0.27; TCGA KIRC -0.242; TCGA KIRP -0.115; TCGA LIHC -0.116; TCGA SARC -0.194; TCGA THCA -0.208; TCGA STAD -0.149 |
hsa-miR-223-3p | ZNF772 | 10 cancers: BRCA; KIRC; KIRP; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.128; TCGA KIRC -0.298; TCGA KIRP -0.107; TCGA LUAD -0.097; TCGA OV -0.104; TCGA PRAD -0.194; TCGA SARC -0.145; TCGA THCA -0.119; TCGA STAD -0.165; TCGA UCEC -0.136 |
hsa-miR-223-3p | ARMCX1 | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.07; TCGA CESC -0.203; TCGA ESCA -0.195; TCGA HNSC -0.089; TCGA KIRC -0.101; TCGA LGG -0.108; TCGA SARC -0.091; TCGA THCA -0.069; TCGA STAD -0.354; TCGA UCEC -0.234 |
hsa-miR-223-3p | MPP5 | 9 cancers: BRCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; THCA | MirTarget | TCGA BRCA -0.09; TCGA KIRC -0.392; TCGA KIRP -0.165; TCGA LIHC -0.095; TCGA LUAD -0.067; TCGA OV -0.072; TCGA PAAD -0.085; TCGA PRAD -0.144; TCGA THCA -0.074 |
hsa-miR-223-3p | CBX5 | 12 cancers: BRCA; ESCA; HNSC; KIRC; LGG; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.128; TCGA ESCA -0.105; TCGA HNSC -0.074; TCGA KIRC -0.129; TCGA LGG -0.118; TCGA LUSC -0.092; TCGA OV -0.102; TCGA PAAD -0.073; TCGA PRAD -0.107; TCGA SARC -0.142; TCGA THCA -0.068; TCGA STAD -0.091 |
hsa-miR-223-3p | PTPRT | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; OV; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.415; TCGA CESC -0.339; TCGA COAD -0.229; TCGA ESCA -0.436; TCGA HNSC -0.321; TCGA KIRC -0.725; TCGA LGG -0.281; TCGA LUSC -0.362; TCGA OV -0.313; TCGA PAAD -0.242; TCGA STAD -0.286; TCGA UCEC -0.243 |
hsa-miR-223-3p | NFIX | 9 cancers: CESC; COAD; ESCA; HNSC; LGG; LIHC; SARC; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA CESC -0.148; TCGA COAD -0.061; TCGA ESCA -0.138; TCGA HNSC -0.12; TCGA LGG -0.14; TCGA LIHC -0.181; TCGA SARC -0.262; TCGA STAD -0.153; TCGA UCEC -0.23 |
hsa-miR-223-3p | SLC2A4 | 10 cancers: CESC; COAD; ESCA; HNSC; KIRC; LIHC; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase | TCGA CESC -0.156; TCGA COAD -0.132; TCGA ESCA -0.441; TCGA HNSC -0.164; TCGA KIRC -0.272; TCGA LIHC -0.194; TCGA SARC -0.465; TCGA THCA -0.438; TCGA STAD -0.6; TCGA UCEC -0.285 |
hsa-miR-223-3p | PAX6 | 9 cancers: CESC; COAD; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC | MirTarget | TCGA CESC -0.201; TCGA COAD -0.089; TCGA KIRC -0.091; TCGA KIRP -0.101; TCGA LIHC -0.093; TCGA LUSC -0.401; TCGA PAAD -0.324; TCGA PRAD -0.069; TCGA SARC -0.309 |
hsa-miR-223-3p | DIRAS1 | 10 cancers: CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA CESC -0.326; TCGA ESCA -0.482; TCGA HNSC -0.184; TCGA KIRC -0.635; TCGA LUAD -0.184; TCGA LUSC -0.381; TCGA PAAD -0.209; TCGA SARC -0.761; TCGA STAD -0.498; TCGA UCEC -0.192 |
hsa-miR-223-3p | NFIA | 9 cancers: COAD; ESCA; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA COAD -0.081; TCGA ESCA -0.103; TCGA LIHC -0.099; TCGA OV -0.077; TCGA PRAD -0.06; TCGA SARC -0.231; TCGA THCA -0.174; TCGA STAD -0.286; TCGA UCEC -0.103 |
hsa-miR-223-3p | BRMS1L | 9 cancers: ESCA; KIRC; KIRP; LGG; LUAD; OV; SARC; STAD; UCEC | MirTarget | TCGA ESCA -0.17; TCGA KIRC -0.219; TCGA KIRP -0.13; TCGA LGG -0.098; TCGA LUAD -0.063; TCGA OV -0.07; TCGA SARC -0.112; TCGA STAD -0.105; TCGA UCEC -0.087 |
hsa-miR-223-3p | KLF12 | 11 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; STAD; UCEC | mirMAP | TCGA ESCA -0.163; TCGA HNSC -0.116; TCGA KIRC -0.175; TCGA KIRP -0.119; TCGA LGG -0.215; TCGA LIHC -0.186; TCGA LUSC -0.139; TCGA OV -0.106; TCGA SARC -0.127; TCGA STAD -0.201; TCGA UCEC -0.116 |
hsa-miR-223-3p | KBTBD6 | 12 cancers: KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA KIRC -0.169; TCGA KIRP -0.136; TCGA LGG -0.151; TCGA LIHC -0.053; TCGA LUAD -0.097; TCGA LUSC -0.134; TCGA OV -0.145; TCGA PAAD -0.148; TCGA PRAD -0.122; TCGA SARC -0.061; TCGA THCA -0.123; TCGA UCEC -0.084 |
Enriched cancer pathways of putative targets