microRNA information: hsa-miR-223-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-223-5p | miRbase |
Accession: | MIMAT0004570 | miRbase |
Precursor name: | hsa-mir-223 | miRbase |
Precursor accession: | MI0000300 | miRbase |
Symbol: | MIR223 | HGNC |
RefSeq ID: | NR_029637 | GenBank |
Sequence: | CGUGUAUUUGACAAGCUGAGUU |
Reported expression in cancers: hsa-miR-223-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-223-5p | B cell lymphoma | deregulation | "Expression of microRNA 223 and its clinicopatholog ......" | 22932402 | Microarray; Reverse transcription PCR; qPCR |
hsa-miR-223-5p | T cell leukemia | deregulation | "Specifically miR-150 and miR-223 were up-regulated ......" | 19246560 | |
hsa-miR-223-5p | acute myeloid leukemia | downregulation | "Among them miR-128a and -128b are significantly ov ......" | 18056805 | qPCR |
hsa-miR-223-5p | acute myeloid leukemia | downregulation | "Recent studies show microRNA-223 miR-223 a transcr ......" | 20029046 | |
hsa-miR-223-5p | acute myeloid leukemia | downregulation | "We identified a single case with a hemizygous dele ......" | 24009227 | |
hsa-miR-223-5p | breast cancer | downregulation | "RNA was extracted reverse transcribed and subjecte ......" | 24498016 | Microarray |
hsa-miR-223-5p | breast cancer | downregulation | "MiR-223 reportedly acts as a tumor suppressor in a ......" | 27618431 | |
hsa-miR-223-5p | cervical and endocervical cancer | downregulation | "MiR 223 inhibited cell metastasis of human cervica ......" | 26617846 | |
hsa-miR-223-5p | colon cancer | downregulation | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | Microarray; qPCR |
hsa-miR-223-5p | colorectal cancer | upregulation | "Deregulated level of microRNA-223 miR-223 was scre ......" | 24819398 | qPCR; Microarray |
hsa-miR-223-5p | colorectal cancer | upregulation | "Overexpression of miR 223 correlates with tumor me ......" | 25270282 | qPCR |
hsa-miR-223-5p | colorectal cancer | upregulation | "The functional effects of miR-223 and the effects ......" | 25867276 | |
hsa-miR-223-5p | colorectal cancer | upregulation | "Serum miRNAs were extracted from all subjects to a ......" | 27135244 | |
hsa-miR-223-5p | esophageal cancer | downregulation | "We found that miR-223 expression was significantly ......" | 22108521 | |
hsa-miR-223-5p | esophageal cancer | deregulation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
hsa-miR-223-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
hsa-miR-223-5p | esophageal cancer | upregulation | "Importantly the high ESCC marked-ZD esophagus had ......" | 26918602 | |
hsa-miR-223-5p | gastric cancer | upregulation | "MicroRNA 223 functions as an oncogene in human gas ......" | 22270966 | qPCR |
hsa-miR-223-5p | gastric cancer | upregulation | "In the group of consistently reported microRNAs mi ......" | 24902858 | |
hsa-miR-223-5p | gastric cancer | upregulation | "Increased microRNA 223 in Helicobacter pylori asso ......" | 25036956 | |
hsa-miR-223-5p | head and neck cancer | upregulation | "To explore circulating miRNAs as cancer therapy bi ......" | 25950115 | qPCR; Microarray |
hsa-miR-223-5p | kidney renal cell cancer | upregulation | "Expression of miR 223 in clear cell renal cell car ......" | 25818776 | qPCR |
hsa-miR-223-5p | liver cancer | downregulation | "MicroRNA 223 is commonly repressed in hepatocellul ......" | 18555017 | Microarray |
hsa-miR-223-5p | liver cancer | downregulation | "This study was divided into four phases: I Ten can ......" | 22174818 | qPCR |
hsa-miR-223-5p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
hsa-miR-223-5p | lymphoma | downregulation | "miR 223 regulates cell growth and targets proto on ......" | 24304814 | |
hsa-miR-223-5p | melanoma | deregulation | "Comparative microarray analysis of microRNA expres ......" | 23111773 | Microarray; RNA-Seq; qPCR |
hsa-miR-223-5p | pancreatic cancer | downregulation | "The miR-223 inhibitor was used to determine its ro ......" | 25638153 | |
hsa-miR-223-5p | prostate cancer | upregulation | "The altered expression of miR-223 has been reporte ......" | 25519054 | |
hsa-miR-223-5p | prostate cancer | downregulation | "Tumor suppressive microRNA 223 inhibits cancer cel ......" | 26509963 | |
hsa-miR-223-5p | sarcoma | downregulation | "Similar analysis in mouse metastatic sarcomas reve ......" | 26044957 |
Reported cancer pathway affected by hsa-miR-223-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-223-5p | acute myeloid leukemia | cell cycle pathway | "Cell cycle regulator E2F1 and microRNA 223 compris ......" | 20029046 | |
hsa-miR-223-5p | breast cancer | Apoptosis pathway | "MicroRNA 223 Increases the Sensitivity of Triple N ......" | 27618431 | |
hsa-miR-223-5p | cervical and endocervical cancer | Epithelial mesenchymal transition pathway | "MiR 223 inhibited cell metastasis of human cervica ......" | 26617846 | Cell migration assay |
hsa-miR-223-5p | gastric cancer | Apoptosis pathway | "MicroRNA 223 functions as an oncogene in human gas ......" | 22270966 | Western blot; Flow cytometry; Colony formation; Transwell assay; Luciferase |
hsa-miR-223-5p | gastric cancer | Apoptosis pathway | "We also identified miR-223 which can regulate FBXW ......" | 25159729 | |
hsa-miR-223-5p | gastric cancer | cell cycle pathway | "MiR 223 promotes the cisplatin resistance of human ......" | 25888377 | |
hsa-miR-223-5p | glioblastoma | cell cycle pathway | "microRNA 223 promotes the growth and invasion of g ......" | 23970099 | Luciferase |
hsa-miR-223-5p | kidney renal cell cancer | cell cycle pathway | "Expression of miR 223 in clear cell renal cell car ......" | 25818776 | Flow cytometry |
hsa-miR-223-5p | lymphoma | Apoptosis pathway | "According to the literature and miRNA database the ......" | 22177245 | |
hsa-miR-223-5p | lymphoma | Apoptosis pathway | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
hsa-miR-223-5p | pancreatic cancer | Apoptosis pathway | "Genistein down regulates miR 223 expression in pan ......" | 23834147 | |
hsa-miR-223-5p | pancreatic cancer | Epithelial mesenchymal transition pathway | "Down regulation of miR 223 reverses epithelial mes ......" | 25638153 | Western blot |
hsa-miR-223-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "Heat shock protein 90B1 plays an oncogenic role an ......" | 23208072 | Luciferase; Western blot; MTT assay; Flow cytometry |
hsa-miR-223-5p | sarcoma | cell cycle pathway | "Cell cycle analysis by flow cytometry showed the a ......" | 23601845 | Flow cytometry |
hsa-miR-223-5p | sarcoma | cell cycle pathway | "MicroRNA-223 miR-223 has been demonstrated to be i ......" | 24784921 |
Reported cancer prognosis affected by hsa-miR-223-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-223-5p | B cell lymphoma | worse prognosis; poor survival | "Expression of microRNA 223 and its clinicopatholog ......" | 22932402 | |
hsa-miR-223-5p | acute myeloid leukemia | progression; differentiation | "Cell cycle regulator E2F1 and microRNA 223 compris ......" | 20029046 | |
hsa-miR-223-5p | acute myeloid leukemia | differentiation | "The integrated information gathered from the two m ......" | 25612891 | |
hsa-miR-223-5p | acute myeloid leukemia | differentiation; poor survival | "De Novo Acute Myeloid Leukemia in Adults: Suppress ......" | 25710580 | |
hsa-miR-223-5p | acute myeloid leukemia | differentiation; worse prognosis; staging | "MicroRNA 223 dose levels fine tune proliferation a ......" | 26163797 | |
hsa-miR-223-5p | bladder cancer | tumorigenesis | "miR 223 increases gallbladder cancer cell sensitiv ......" | 27577078 | Flow cytometry; Western blot |
hsa-miR-223-5p | bladder cancer | cell migration | "Ginkgolide B Inhibits Human Bladder Cancer Cell Mi ......" | 27744452 | |
hsa-miR-223-5p | breast cancer | malignant trasformation | "Caprin 1 is a novel microRNA 223 target for regula ......" | 23953883 | |
hsa-miR-223-5p | breast cancer | progression; tumorigenesis; poor survival; drug resistance | "miR 223 is a coordinator of breast cancer progress ......" | 24400121 | |
hsa-miR-223-5p | breast cancer | staging | "Global miRNA analysis was performed on prospective ......" | 25004125 | |
hsa-miR-223-5p | breast cancer | drug resistance; recurrence | "Radiotherapy induced miR 223 prevents relapse of b ......" | 26876200 | |
hsa-miR-223-5p | cervical and endocervical cancer | metastasis; cell migration | "MiR 223 inhibited cell metastasis of human cervica ......" | 26617846 | Cell migration assay |
hsa-miR-223-5p | colon cancer | staging | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | |
hsa-miR-223-5p | colorectal cancer | cell migration; staging | "MicroRNA 223 functions as an oncogene in human col ......" | 24819398 | Colony formation; Transwell assay |
hsa-miR-223-5p | colorectal cancer | metastasis; worse prognosis; tumorigenesis; staging; poor survival; differentiation; tumor size; progression | "Overexpression of miR 223 correlates with tumor me ......" | 25270282 | |
hsa-miR-223-5p | esophageal cancer | cell migration; metastasis | "miR 223 regulates migration and invasion by target ......" | 21453483 | Western blot; Wound Healing Assay; Luciferase |
hsa-miR-223-5p | esophageal cancer | worse prognosis; poor survival | "Overexpression of microRNA 223 regulates the ubiqu ......" | 22108521 | |
hsa-miR-223-5p | esophageal cancer | poor survival | "Clinical significance of serum miR 223 miR 25 and ......" | 24390317 | |
hsa-miR-223-5p | gastric cancer | poor survival | "Several microarray studies have reported microRNA ......" | 19951901 | |
hsa-miR-223-5p | gastric cancer | metastasis; poor survival | "In this study we evaluated the miRNA expression pa ......" | 21628394 | |
hsa-miR-223-5p | gastric cancer | motility; staging; metastasis | "MicroRNA 223 functions as an oncogene in human gas ......" | 22270966 | Western blot; Flow cytometry; Colony formation; Transwell assay; Luciferase |
hsa-miR-223-5p | gastric cancer | metastasis; tumorigenesis; staging | "Plasma microRNAs miR 223 miR 21 and miR 218 as nov ......" | 22860003 | |
hsa-miR-223-5p | gastric cancer | worse prognosis | "Increased microRNA 223 in Helicobacter pylori asso ......" | 25036956 | Colony formation |
hsa-miR-223-5p | gastric cancer | drug resistance | "We also identified miR-223 which can regulate FBXW ......" | 25159729 | |
hsa-miR-223-5p | gastric cancer | drug resistance | "MiR 223 promotes the cisplatin resistance of human ......" | 25888377 | |
hsa-miR-223-5p | kidney renal cell cancer | tumor size; cell migration | "Expression of miR 223 in clear cell renal cell car ......" | 25818776 | Flow cytometry |
hsa-miR-223-5p | liver cancer | tumorigenesis | "Role of microRNA 223 and its target gene oncogene ......" | 21492514 | Western blot |
hsa-miR-223-5p | liver cancer | recurrence | "18 miRNAs including 6 up-regulated and 12 down-reg ......" | 22552153 | |
hsa-miR-223-5p | liver cancer | drug resistance | "MiR 223 modulates multidrug resistance via downreg ......" | 23925649 | Western blot |
hsa-miR-223-5p | liver cancer | metastasis; cell migration | "Sulfatide epigenetically regulates miR 223 and pro ......" | 24333181 | |
hsa-miR-223-5p | lung squamous cell cancer | poor survival | "Five selected miRNAs let-7f miR-20b miR-30e-3p miR ......" | 20595154 | |
hsa-miR-223-5p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
hsa-miR-223-5p | lung squamous cell cancer | drug resistance | "miR 223 enhances the sensitivity of non small cell ......" | 27177336 | Western blot |
hsa-miR-223-5p | lymphoma | staging; progression | "miR 223 regulates cell growth and targets proto on ......" | 24304814 | |
hsa-miR-223-5p | lymphoma | differentiation | "Aberrant expression of oncogenic miRNAs including ......" | 24479800 | |
hsa-miR-223-5p | lymphoma | poor survival | "Studies using miRNA arrays and subsequent real-tim ......" | 24745613 | |
hsa-miR-223-5p | lymphoma | worse prognosis; drug resistance | "Presence of certain miRs miRNA-16 -21 -24 -29b -12 ......" | 25388103 | |
hsa-miR-223-5p | melanoma | metastasis; malignant trasformation | "Comparative microarray analysis of microRNA expres ......" | 23111773 | |
hsa-miR-223-5p | pancreatic cancer | staging | "In addition from 10 to 50 weeks of age stage-speci ......" | 26516699 | |
hsa-miR-223-5p | pancreatic cancer | staging | "Using Affymetrix microarrays we established a glob ......" | 26807325 | |
hsa-miR-223-5p | pancreatic cancer | motility | "Synergistic reversal effect of epithelial to mesen ......" | 27429851 | |
hsa-miR-223-5p | prostate cancer | cell migration | "Tumor suppressive microRNA 223 inhibits cancer cel ......" | 26509963 | |
hsa-miR-223-5p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
hsa-miR-223-5p | sarcoma | progression | "Cell cycle analysis by flow cytometry showed the a ......" | 23601845 | Flow cytometry |
hsa-miR-223-5p | sarcoma | progression; metastasis; recurrence; drug resistance; worse prognosis | "MicroRNA-223 miR-223 has been demonstrated to be i ......" | 24784921 | |
hsa-miR-223-5p | sarcoma | poor survival; cell migration; staging; metastasis | "MicroRNA-223 miR-223 has been shown to be a potent ......" | 27335775 |
Reported gene related to hsa-miR-223-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-223-5p | esophageal cancer | FBXW7 | "Overexpression of microRNA 223 regulates the ubiqu ......" | 22108521 |
hsa-miR-223-5p | gastric cancer | FBXW7 | "MiR 223 promotes the cisplatin resistance of human ......" | 25888377 |
hsa-miR-223-5p | gastric cancer | FBXW7 | "We also identified miR-223 which can regulate FBXW ......" | 25159729 |
hsa-miR-223-5p | gastric cancer | FBXW7 | "FBXW7/hCdc4 protein FBW7 levels in gastric cancer ......" | 22270966 |
hsa-miR-223-5p | lung squamous cell cancer | FBXW7 | "In addition FBW7 was identified as a functional ta ......" | 27398136 |
hsa-miR-223-5p | pancreatic cancer | FBXW7 | "We found that genistein treatment significantly in ......" | 23834147 |
hsa-miR-223-5p | pancreatic cancer | FBXW7 | "More importantly miR-223 governs GR-induced EMT in ......" | 25638153 |
hsa-miR-223-5p | bladder cancer | STMN1 | "miR 223 increases gallbladder cancer cell sensitiv ......" | 27577078 |
hsa-miR-223-5p | gastric cancer | STMN1 | "We also explored the regulation of STMN1 expressio ......" | 22470493 |
hsa-miR-223-5p | liver cancer | STMN1 | "A strong inverse relationship between STMN1 mRNA a ......" | 18555017 |
hsa-miR-223-5p | sarcoma | ECT2 | "MicroRNA-223 miR-223 has been demonstrated to be i ......" | 24784921 |
hsa-miR-223-5p | sarcoma | ECT2 | "Further mechanistic study indicated that Ect2 was ......" | 23601845 |
hsa-miR-223-5p | gastric cancer | EPB41L3 | "Mechanistically miR-223 induced by the transcripti ......" | 21628394 |
hsa-miR-223-5p | lung cancer | EPB41L3 | "MicroRNA 223 delivered by platelet derived microve ......" | 25881295 |
hsa-miR-223-5p | B cell lymphoma | LMO2 | "We provide experimental evidence that these change ......" | 19047678 |
hsa-miR-223-5p | acute myeloid leukemia | LMO2 | "De Novo Acute Myeloid Leukemia in Adults: Suppress ......" | 25710580 |
hsa-miR-223-5p | liver cancer | ABCB1 | "MiR 223 modulates multidrug resistance via downreg ......" | 23925649 |
hsa-miR-223-5p | esophageal cancer | ARTN | "miR 223 regulates migration and invasion by target ......" | 21453483 |
hsa-miR-223-5p | breast cancer | CAPRIN1 | "Caprin 1 is a novel microRNA 223 target for regula ......" | 23953883 |
hsa-miR-223-5p | lung cancer | CASP3 | "miR-223 transfection in the LLC cells was observed ......" | 24137330 |
hsa-miR-223-5p | breast cancer | CASZ1 | "The analysis of miR-223 predicted targets revealed ......" | 24400121 |
hsa-miR-223-5p | cervical and endocervical cancer | CDH1 | "In terms of mechanism miR-223 influenced the expre ......" | 26617846 |
hsa-miR-223-5p | lung cancer | CDK2 | "Using a luciferase activity assay and western blot ......" | 24137330 |
hsa-miR-223-5p | acute myeloid leukemia | CORD1 | "MicroRNA 223 dose levels fine tune proliferation a ......" | 26163797 |
hsa-miR-223-5p | acute myeloid leukemia | E2F1 | "Cell cycle regulator E2F1 and microRNA 223 compris ......" | 20029046 |
hsa-miR-223-5p | breast cancer | EGF | "Radiotherapy induced miR 223 prevents relapse of b ......" | 26876200 |
hsa-miR-223-5p | breast cancer | EGFR | "Accordingly both RT-induced miR-223 and peri-opera ......" | 26876200 |
hsa-miR-223-5p | acute myeloid leukemia | FANCB | "In AML not otherwise specified category AML with m ......" | 25710580 |
hsa-miR-223-5p | liver cancer | GAL3ST1 | "Orthotopic growth and intrahepatic and pulmonary m ......" | 24333181 |
hsa-miR-223-5p | B cell lymphoma | GBA | "The expression levels of miR-223 measured by real- ......" | 22932402 |
hsa-miR-223-5p | breast cancer | HAX1 | "MicroRNA 223 Increases the Sensitivity of Triple N ......" | 27618431 |
hsa-miR-223-5p | liver cancer | HDAC10 | "The expression of histone deacetylases HDAC9 and H ......" | 24333181 |
hsa-miR-223-5p | liver cancer | HDAC9 | "The expression of histone deacetylases HDAC9 and H ......" | 24333181 |
hsa-miR-223-5p | sarcoma | HSP90B1 | "Co-transfection of miR-223 expression vector with ......" | 23208072 |
hsa-miR-223-5p | B cell lymphoma | IRF4 | "We provide experimental evidence that these change ......" | 19047678 |
hsa-miR-223-5p | prostate cancer | ITGA3 | "In silico database and genome-wide gene expression ......" | 26509963 |
hsa-miR-223-5p | liver cancer | ITGA9 | "Our aim was to investigate miR-223 regulation in H ......" | 24333181 |
hsa-miR-223-5p | prostate cancer | ITGB1 | "In silico database and genome-wide gene expression ......" | 26509963 |
hsa-miR-223-5p | liver cancer | KAT6A | "Intriguingly miR-223 expression was suppressed by ......" | 24333181 |
hsa-miR-223-5p | gastric cancer | MMRN1 | "Gastric cancer cell line SGC7901 transfected with ......" | 22270966 |
hsa-miR-223-5p | liver cancer | MYC | "Role of microRNA 223 and its target gene oncogene ......" | 21492514 |
hsa-miR-223-5p | pancreatic cancer | NOTCH1 | "More importantly miR-223 governs GR-induced EMT in ......" | 25638153 |
hsa-miR-223-5p | acute myeloid leukemia | NR4A3 | "This also explains the complex yet minor role of m ......" | 26163797 |
hsa-miR-223-5p | glioblastoma | PAX6 | "microRNA 223 promotes the growth and invasion of g ......" | 23970099 |
hsa-miR-223-5p | lung cancer | PCNA | "miR 223 functions as a potent tumor suppressor of ......" | 24137330 |
hsa-miR-223-5p | lymphoma | PRDM1 | "Luciferase assays were performed to verify the dir ......" | 24438193 |
hsa-miR-223-5p | colorectal cancer | RASA1 | "C/EBP β activated microRNA 223 promotes tumour gr ......" | 25867276 |
hsa-miR-223-5p | acute myeloid leukemia | RUNX1 | "The integrated information gathered from the two m ......" | 25612891 |
hsa-miR-223-5p | prostate cancer | SEPT6 | "MiR 223 3p targeting SEPT6 promotes the biological ......" | 25519054 |
hsa-miR-223-5p | breast cancer | STAT5A | "In addition we proved that STAT5A is a direct miR- ......" | 24400121 |
hsa-miR-223-5p | lymphoma | TCF3 | "Taken together aberrant E2A expression is a diagno ......" | 20802470 |
hsa-miR-223-5p | gastric cancer | TIMM8A | "Furthermore miR-223 was found to be significantly ......" | 25888377 |
hsa-miR-223-5p | lymphoma | TOX | "In addition we showed that the 3'-UTR of TOX mRNA ......" | 24304814 |
hsa-miR-223-5p | lymphoma | TSPYL2 | "CTCL peripheral blood mononuclear cells and cell l ......" | 24304814 |
hsa-miR-223-5p | gastric cancer | TWIST1 | "Mechanistically miR-223 induced by the transcripti ......" | 21628394 |
hsa-miR-223-5p | cervical and endocervical cancer | VIM | "In terms of mechanism miR-223 influenced the expre ......" | 26617846 |
Expression profile in cancer corhorts: