microRNA information: hsa-miR-224-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-224-3p | miRbase |
| Accession: | MIMAT0009198 | miRbase |
| Precursor name: | hsa-mir-224 | miRbase |
| Precursor accession: | MI0000301 | miRbase |
| Symbol: | MIR224 | HGNC |
| RefSeq ID: | NR_029638 | GenBank |
| Sequence: | AAAAUGGUGCCCUAGUGACUACA |
Reported expression in cancers: hsa-miR-224-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-224-3p | B cell lymphoma | downregulation | "In this study we analyzed the expression of miR-22 ......" | 25146331 | |
| hsa-miR-224-3p | B cell lymphoma | downregulation | "To investigate the expression and prognostic value ......" | 26301883 | |
| hsa-miR-224-3p | breast cancer | downregulation | "Moreover metastasis as assayed by Transwell migrat ......" | 22809510 | |
| hsa-miR-224-3p | cervical and endocervical cancer | upregulation | "Upregulation of microRNA 224 is associated with ag ......" | 23631806 | Microarray; qPCR |
| hsa-miR-224-3p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
| hsa-miR-224-3p | cervical and endocervical cancer | upregulation | "In the current study we demonstrated by real-time ......" | 27626930 | qPCR |
| hsa-miR-224-3p | colorectal cancer | upregulation | "Up regulation of miR 224 promotes cancer cell prol ......" | 24152489 | qPCR |
| hsa-miR-224-3p | colorectal cancer | upregulation | "miR 224 overexpression is a strong and independent ......" | 25420464 | qPCR |
| hsa-miR-224-3p | colorectal cancer | upregulation | "In order to clarify the miRNA profile in CRC tissu ......" | 25421755 | Microarray |
| hsa-miR-224-3p | colorectal cancer | upregulation | "MicroRNA 224 sustains Wnt/β catenin signaling and ......" | 26822534 | qPCR |
| hsa-miR-224-3p | gastric cancer | upregulation | "From the set of the 29 microRNAs of interest we fo ......" | 27081844 | |
| hsa-miR-224-3p | liver cancer | upregulation | "Role of miR 224 in hepatocellular carcinoma: a too ......" | 22122284 | |
| hsa-miR-224-3p | liver cancer | upregulation | "MicroRNA 224 is up regulated in hepatocellular car ......" | 22459148 | |
| hsa-miR-224-3p | liver cancer | upregulation | "MicroRNA 224 upregulation and AKT activation syner ......" | 24923856 | in situ hybridization |
| hsa-miR-224-3p | liver cancer | upregulation | "MicroRNA 224 Induces G1/S Checkpoint Release in Li ......" | 26343737 | Microarray |
| hsa-miR-224-3p | lung cancer | upregulation | "By examining the expression of 22 HCC-related miRN ......" | 22392644 | |
| hsa-miR-224-3p | lung cancer | upregulation | "We recently reported that miR-224 was significantl ......" | 26307684 | |
| hsa-miR-224-3p | lung squamous cell cancer | downregulation | "Decreased microRNA 224 and its clinical significan ......" | 25410592 | qPCR |
| hsa-miR-224-3p | lung squamous cell cancer | downregulation | "Quantitative real-time PCR assay was employed to c ......" | 27073334 | qPCR |
| hsa-miR-224-3p | prostate cancer | downregulation | "Downregulation and prognostic performance of micro ......" | 23136246 | qPCR |
| hsa-miR-224-3p | prostate cancer | downregulation | "Our previous microarray data showed that microRNA- ......" | 24382668 | Microarray |
| hsa-miR-224-3p | prostate cancer | downregulation | "Our recent study of the microRNA expression signat ......" | 24768995 | |
| hsa-miR-224-3p | prostate cancer | downregulation | "Our previous study revealed that microRNA miR-224 ......" | 25532941 | |
| hsa-miR-224-3p | thyroid cancer | upregulation | "We analyzed the expression of nine miRNAs miR-21 m ......" | 22747440 | qPCR |
Reported cancer pathway affected by hsa-miR-224-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-224-3p | breast cancer | Apoptosis pathway | "Epigenetic changes and nuclear factor κB activati ......" | 26788213 | Western blot; Flow cytometry |
| hsa-miR-224-3p | colorectal cancer | PI3K/Akt signaling pathway | "microRNA 224 promotes cell proliferation and tumor ......" | 23846336 | Luciferase |
| hsa-miR-224-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "MicroRNA 224 is associated with colorectal cancer ......" | 25919696 | |
| hsa-miR-224-3p | esophageal cancer | Apoptosis pathway | "Aberrant expression of miR-224 is associated with ......" | 26245343 | Western blot; Colony formation; Luciferase |
| hsa-miR-224-3p | gastric cancer | Apoptosis pathway | "Effect of antisense miR 224 on gastric cancer cell ......" | 24796455 | Flow cytometry; MTT assay |
| hsa-miR-224-3p | gastric cancer | Apoptosis pathway | "RKIP suppresses gastric cancer cell proliferation ......" | 25017365 | Western blot; MTT assay; Flow cytometry; Cell migration assay; Luciferase |
| hsa-miR-224-3p | gastric cancer | Apoptosis pathway | "MicroRNA 224 aggrevates tumor growth and progressi ......" | 27315344 | Luciferase |
| hsa-miR-224-3p | liver cancer | Apoptosis pathway | "Profiling microRNA expression in hepatocellular ca ......" | 18319255 | |
| hsa-miR-224-3p | liver cancer | Apoptosis pathway | "MicroRNA 224 is up regulated in hepatocellular car ......" | 22459148 | |
| hsa-miR-224-3p | liver cancer | Apoptosis pathway | "Involvement of microRNA 224 in cell proliferation ......" | 22989374 | Western blot |
| hsa-miR-224-3p | liver cancer | PI3K/Akt signaling pathway | "miR 224 functions as an onco miRNA in hepatocellul ......" | 23741247 | Western blot; Luciferase |
| hsa-miR-224-3p | liver cancer | PI3K/Akt signaling pathway | "MicroRNA 224 upregulation and AKT activation syner ......" | 24923856 | |
| hsa-miR-224-3p | liver cancer | cell cycle pathway | "MicroRNA 224 Induces G1/S Checkpoint Release in Li ......" | 26343737 | |
| hsa-miR-224-3p | lung cancer | Apoptosis pathway; cell cycle pathway | "MiR 224 promotes the chemoresistance of human lung ......" | 24921914 | |
| hsa-miR-224-3p | lung cancer | Apoptosis pathway | "MicroRNA 224 is implicated in lung cancer pathogen ......" | 26307684 | |
| hsa-miR-224-3p | lung squamous cell cancer | Apoptosis pathway | "Decreased microRNA 224 and its clinical significan ......" | 25410592 | Cell migration assay |
| hsa-miR-224-3p | lung squamous cell cancer | Apoptosis pathway | "Quantitative real-time PCR assay was employed to c ......" | 27073334 | Flow cytometry; Wound Healing Assay |
| hsa-miR-224-3p | ovarian cancer | Apoptosis pathway | "Upregulated microRNA 224 promotes ovarian cancer c ......" | 27663866 | |
| hsa-miR-224-3p | prostate cancer | Apoptosis pathway | "MicroRNA 224 inhibits progression of human prostat ......" | 24382668 | |
| hsa-miR-224-3p | prostate cancer | cell cycle pathway | "GABRE∼miR-452∼miR-224 promoter methylation was ......" | 24737792 | |
| hsa-miR-224-3p | prostate cancer | cell cycle pathway | "MicroRNA 224 and its target CAMKK2 synergistically ......" | 25394900 |
Reported cancer prognosis affected by hsa-miR-224-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-224-3p | B cell lymphoma | staging; drug resistance | "In the discovery phase real-time polymerase chain ......" | 24858372 | |
| hsa-miR-224-3p | B cell lymphoma | worse prognosis; staging; progression | "Expression of miR 224 in diffuse large B cell lymp ......" | 25052605 | |
| hsa-miR-224-3p | B cell lymphoma | progression; poor survival; drug resistance | "Deregulated expression of miR 224 and its target g ......" | 25146331 | Luciferase |
| hsa-miR-224-3p | bladder cancer | poor survival | "Uncovering the clinical utility of miR 143 miR 145 ......" | 25804644 | |
| hsa-miR-224-3p | breast cancer | metastasis; drug resistance | "MicroRNA 224 targets RKIP to control cell invasion ......" | 22809510 | |
| hsa-miR-224-3p | breast cancer | drug resistance | "Increased fucosylation has a pivotal role in multi ......" | 26701615 | Luciferase |
| hsa-miR-224-3p | cervical and endocervical cancer | progression; worse prognosis; metastasis; poor survival | "Upregulation of microRNA 224 is associated with ag ......" | 23631806 | |
| hsa-miR-224-3p | cervical and endocervical cancer | progression; staging; metastasis; tumor size | "Over Expressed miR 224 Promotes the Progression of ......" | 27626930 | Western blot; Luciferase; RNAi |
| hsa-miR-224-3p | colon cancer | drug resistance | "Underexpression of miR 224 in methotrexate resista ......" | 21864507 | |
| hsa-miR-224-3p | colorectal cancer | progression | "Furthermore several of these miRNAs were associate ......" | 19843336 | |
| hsa-miR-224-3p | colorectal cancer | staging | "Genome-wide microarray analysis of miRNA expressio ......" | 23673725 | |
| hsa-miR-224-3p | colorectal cancer | metastasis; staging; poor survival; motility; progression | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 | |
| hsa-miR-224-3p | colorectal cancer | poor survival; worse prognosis | "microRNA 224 promotes cell proliferation and tumor ......" | 23846336 | Luciferase |
| hsa-miR-224-3p | colorectal cancer | poor survival | "Up regulation of miR 224 promotes cancer cell prol ......" | 24152489 | Western blot; Luciferase |
| hsa-miR-224-3p | colorectal cancer | cell migration; progression | "MicroRNA 224 suppresses colorectal cancer cell mig ......" | 24817781 | |
| hsa-miR-224-3p | colorectal cancer | poor survival; malignant trasformation | "miR 224 overexpression is a strong and independent ......" | 25420464 | |
| hsa-miR-224-3p | colorectal cancer | metastasis; poor survival | "The clinical and biological significance of MIR 22 ......" | 25804630 | Western blot; Luciferase |
| hsa-miR-224-3p | colorectal cancer | progression; drug resistance | "MicroRNA 224 is associated with colorectal cancer ......" | 25919696 | |
| hsa-miR-224-3p | colorectal cancer | metastasis | "MicroRNA 224 sustains Wnt/β catenin signaling and ......" | 26822534 | Luciferase; Western blot |
| hsa-miR-224-3p | esophageal cancer | progression; staging | "Aberrant expression of miR-224 is associated with ......" | 26245343 | Western blot; Colony formation; Luciferase |
| hsa-miR-224-3p | gastric cancer | poor survival | "Effect of antisense miR 224 on gastric cancer cell ......" | 24796455 | Flow cytometry; MTT assay |
| hsa-miR-224-3p | gastric cancer | progression; metastasis | "MicroRNA 224 aggrevates tumor growth and progressi ......" | 27315344 | Luciferase |
| hsa-miR-224-3p | glioblastoma | poor survival | "MiR 224 expression increases radiation sensitivity ......" | 24785373 | |
| hsa-miR-224-3p | kidney renal cell cancer | metastasis; malignant trasformation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
| hsa-miR-224-3p | liver cancer | tumorigenesis | "Profiling microRNA expression in hepatocellular ca ......" | 18319255 | |
| hsa-miR-224-3p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
| hsa-miR-224-3p | liver cancer | tumorigenesis; progression | "Involvement of microRNA 224 in cell proliferation ......" | 22989374 | Western blot |
| hsa-miR-224-3p | liver cancer | tumorigenesis; progression; cell migration | "Autophagy suppresses tumorigenesis of hepatitis B ......" | 23913306 | |
| hsa-miR-224-3p | liver cancer | cell migration | "miR 224 promotion of cell migration and invasion b ......" | 24219032 | Luciferase; Western blot |
| hsa-miR-224-3p | liver cancer | worse prognosis; staging; poor survival; progression | "MicroRNA 224 upregulation and AKT activation syner ......" | 24923856 | |
| hsa-miR-224-3p | liver cancer | staging; poor survival; metastasis | "Serum miR 224 reflects stage of hepatocellular car ......" | 25688365 | |
| hsa-miR-224-3p | liver cancer | progression | "MicroRNA 224 Induces G1/S Checkpoint Release in Li ......" | 26343737 | |
| hsa-miR-224-3p | liver cancer | malignant trasformation | "Using gene expression microarrays and high-through ......" | 26646011 | |
| hsa-miR-224-3p | lung cancer | staging | "By examining the expression of 22 HCC-related miRN ......" | 22392644 | |
| hsa-miR-224-3p | lung cancer | drug resistance; poor survival | "MiR 224 promotes the chemoresistance of human lung ......" | 24921914 | |
| hsa-miR-224-3p | lung cancer | metastasis; progression | "MicroRNA 224 is implicated in lung cancer pathogen ......" | 26307684 | |
| hsa-miR-224-3p | lung squamous cell cancer | progression; tumorigenesis; worse prognosis; staging; metastasis; poor survival | "Decreased microRNA 224 and its clinical significan ......" | 25410592 | Cell migration assay |
| hsa-miR-224-3p | lung squamous cell cancer | progression; metastasis; cell migration | "MicroRNA 224 promotes tumor progression in nonsmal ......" | 26187928 | |
| hsa-miR-224-3p | ovarian cancer | metastasis; poor survival | "Upregulated microRNA 224 promotes ovarian cancer c ......" | 27663866 | |
| hsa-miR-224-3p | prostate cancer | malignant trasformation; staging; progression; poor survival; worse prognosis | "Downregulation and prognostic performance of micro ......" | 23136246 | |
| hsa-miR-224-3p | prostate cancer | progression; staging; metastasis; poor survival; recurrence; worse prognosis | "MicroRNA 224 inhibits progression of human prostat ......" | 24382668 | |
| hsa-miR-224-3p | prostate cancer | malignant trasformation; motility | "GABRE∼miR-452∼miR-224 promoter methylation was ......" | 24737792 | |
| hsa-miR-224-3p | prostate cancer | cell migration | "Tumour suppressive microRNA 224 inhibits cancer ce ......" | 24768995 | |
| hsa-miR-224-3p | prostate cancer | progression; worse prognosis; staging; malignant trasformation | "MicroRNA 224 and its target CAMKK2 synergistically ......" | 25394900 | |
| hsa-miR-224-3p | prostate cancer | progression; poor survival; recurrence; staging; metastasis | "Our previous study revealed that microRNA miR-224 ......" | 25532941 | |
| hsa-miR-224-3p | sarcoma | progression; poor survival | "MicroRNA 224 promotes the sensitivity of osteosarc ......" | 27222381 | |
| hsa-miR-224-3p | thyroid cancer | staging; metastasis | "We analyzed the expression of nine miRNAs miR-21 m ......" | 22747440 | |
| hsa-miR-224-3p | thyroid cancer | malignant trasformation | "A limited set of miRNA have been assessed as part ......" | 22771635 |
Reported gene related to hsa-miR-224-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-224-3p | colorectal cancer | SMAD4 | "Increased miR-224 diminished Cdc42 and SMAD4 expre ......" | 24817781 |
| hsa-miR-224-3p | colorectal cancer | SMAD4 | "In addition the regulation of SMAD4 by miR-224 was ......" | 24152489 |
| hsa-miR-224-3p | colorectal cancer | SMAD4 | "We identified SMAD4 as a miR-224 target and observ ......" | 25804630 |
| hsa-miR-224-3p | liver cancer | SMAD4 | "Our in vitro study demonstrated that miR-224 playe ......" | 23913306 |
| hsa-miR-224-3p | lung cancer | SMAD4 | "We further demonstrated that miR-224 functions as ......" | 26307684 |
| hsa-miR-224-3p | lung squamous cell cancer | SMAD4 | "Increased miR-224 expression promotes cell migrati ......" | 26187928 |
| hsa-miR-224-3p | breast cancer | PEBP1 | "MicroRNA 224 targets RKIP to control cell invasion ......" | 22809510 |
| hsa-miR-224-3p | breast cancer | PEBP1 | "Bisulphite modification methylation specific-polym ......" | 26788213 |
| hsa-miR-224-3p | gastric cancer | PEBP1 | "RKIP suppresses gastric cancer cell proliferation ......" | 25017365 |
| hsa-miR-224-3p | liver cancer | AFP | "In addition the combined upregulation of miR-224 a ......" | 24923856 |
| hsa-miR-224-3p | liver cancer | AFP | "Serum levels of miR-224 showed significant relatio ......" | 25688365 |
| hsa-miR-224-3p | glioblastoma | API5 | "MiR-224 expression in glioblastoma cells resulted ......" | 24785373 |
| hsa-miR-224-3p | liver cancer | API5 | "Profiling microRNA expression in hepatocellular ca ......" | 18319255 |
| hsa-miR-224-3p | liver cancer | MMP9 | "We also performed real-time PCR to measure miR-224 ......" | 23988648 |
| hsa-miR-224-3p | liver cancer | MMP9 | "iii miR-224 promoted expression of the tumor invas ......" | 24219032 |
| hsa-miR-224-3p | colorectal cancer | PHLPP1 | "microRNA 224 promotes cell proliferation and tumor ......" | 23846336 |
| hsa-miR-224-3p | esophageal cancer | PHLPP1 | "miR-224 expression was associated with advanced cl ......" | 26245343 |
| hsa-miR-224-3p | colorectal cancer | PHLPP2 | "microRNA 224 promotes cell proliferation and tumor ......" | 23846336 |
| hsa-miR-224-3p | esophageal cancer | PHLPP2 | "miR-224 expression was associated with advanced cl ......" | 26245343 |
| hsa-miR-224-3p | lung cancer | TNFAIP1 | "We further demonstrated that miR-224 functions as ......" | 26307684 |
| hsa-miR-224-3p | lung squamous cell cancer | TNFAIP1 | "Increased miR-224 expression promotes cell migrati ......" | 26187928 |
| hsa-miR-224-3p | prostate cancer | TPD52 | "miR-224 functions as a tumour suppressor by target ......" | 27070713 |
| hsa-miR-224-3p | prostate cancer | TPD52 | "Tumour suppressive microRNA 224 inhibits cancer ce ......" | 24768995 |
| hsa-miR-224-3p | prostate cancer | APLN | "In the current study apelin APLN was identified as ......" | 25532941 |
| hsa-miR-224-3p | gastric cancer | BCL2 | "In addition the expressions of Bcl2 mRNA and prote ......" | 24796455 |
| hsa-miR-224-3p | colorectal cancer | BRAF | "5-FU chemosensitivity was significantly increased ......" | 25919696 |
| hsa-miR-224-3p | prostate cancer | CAMKK2 | "MicroRNA 224 and its target CAMKK2 synergistically ......" | 25394900 |
| hsa-miR-224-3p | lung cancer | CASP3 | "MicroRNA 224 is implicated in lung cancer pathogen ......" | 26307684 |
| hsa-miR-224-3p | lung cancer | CASP7 | "MicroRNA 224 is implicated in lung cancer pathogen ......" | 26307684 |
| hsa-miR-224-3p | liver cancer | CCNE1 | "We next identified p21 p15 and CCNE1 as downstream ......" | 26343737 |
| hsa-miR-224-3p | B cell lymphoma | CD59 | "Deregulated expression of miR 224 and its target g ......" | 25146331 |
| hsa-miR-224-3p | colorectal cancer | CDC42 | "MicroRNA 224 suppresses colorectal cancer cell mig ......" | 24817781 |
| hsa-miR-224-3p | colorectal cancer | CDKN1A | "Interestingly cell-unique downregulation of miR-22 ......" | 26634414 |
| hsa-miR-224-3p | lung cancer | CDKN3 | "p21WAF1/CIP1 a potent cyclin-dependent kinase inhi ......" | 24921914 |
| hsa-miR-224-3p | liver cancer | CHRFAM7A | "miR 224 promotion of cell migration and invasion b ......" | 24219032 |
| hsa-miR-224-3p | B cell lymphoma | DDIT3 | "Deregulated expression of miR 224 and its target g ......" | 25146331 |
| hsa-miR-224-3p | liver cancer | DLL1 | "2-Delta Delta CT method was used for quantitative ......" | 19403413 |
| hsa-miR-224-3p | liver cancer | EP300 | "Notably in HCC tumors that significantly overexpre ......" | 22459148 |
| hsa-miR-224-3p | breast cancer | FUT4 | "Increased fucosylation has a pivotal role in multi ......" | 26701615 |
| hsa-miR-224-3p | breast cancer | FZD1 | "Collectively these data indicated that miR-224 dow ......" | 27323393 |
| hsa-miR-224-3p | breast cancer | FZD5 | "Collectively these data indicated that miR-224 dow ......" | 27323393 |
| hsa-miR-224-3p | liver cancer | HOXD10 | "A luciferase reporter assay was used to confirm th ......" | 24219032 |
| hsa-miR-224-3p | kidney renal cell cancer | KLK1 | "Transfection of miR-224 into HEK-293 cells resulte ......" | 20180642 |
| hsa-miR-224-3p | ovarian cancer | KLK10 | "When we co-transfected cells with pMIR-KLK10 and e ......" | 20354523 |
| hsa-miR-224-3p | ovarian cancer | KLLN | "Upregulated microRNA 224 promotes ovarian cancer c ......" | 27663866 |
| hsa-miR-224-3p | colorectal cancer | KRAS | "MicroRNA 224 is associated with colorectal cancer ......" | 25919696 |
| hsa-miR-224-3p | colorectal cancer | MBD2 | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 |
| hsa-miR-224-3p | liver cancer | MMP2 | "We also performed real-time PCR to measure miR-224 ......" | 23988648 |
| hsa-miR-224-3p | gastric cancer | MTOR | "MicroRNA 224 aggrevates tumor growth and progressi ......" | 27315344 |
| hsa-miR-224-3p | colon cancer | MTX1 | "The underexpression of miR-224 was also observed i ......" | 21864507 |
| hsa-miR-224-3p | lung cancer | PARP1 | "In addition miR-224 attenuated TNF-α induced apop ......" | 26307684 |
| hsa-miR-224-3p | liver cancer | PPP2R1B | "These data suggest that miR-224 plays a significan ......" | 23741247 |
| hsa-miR-224-3p | cervical and endocervical cancer | PTGIS | "Bioinformatic analysis indicated that RASSF8 RAS-a ......" | 27626930 |
| hsa-miR-224-3p | cervical and endocervical cancer | PTK2 | "In addition we found that miR-224-3p directly inhi ......" | 27615604 |
| hsa-miR-224-3p | sarcoma | RAC1 | "MicroRNA 224 promotes the sensitivity of osteosarc ......" | 27222381 |
| hsa-miR-224-3p | breast cancer | RAF1 | "Epigenetic changes and nuclear factor κB activati ......" | 26788213 |
| hsa-miR-224-3p | cervical and endocervical cancer | RASSF8 | "Over Expressed miR 224 Promotes the Progression of ......" | 27626930 |
| hsa-miR-224-3p | cervical and endocervical cancer | RB1CC1 | "miR 224 3p inhibits autophagy in cervical cancer c ......" | 27615604 |
| hsa-miR-224-3p | colorectal cancer | SERPINB5 | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 |
| hsa-miR-224-3p | colorectal cancer | SFRP2 | "Bioinformatics analysis combined with in vivo and ......" | 26822534 |
| hsa-miR-224-3p | lung cancer | SSB | "The aim of our study was to investigate the roles ......" | 24921914 |
| hsa-miR-224-3p | lung cancer | TIMM8A | "Here we showed that miR-224 could promote the in v ......" | 24921914 |
| hsa-miR-224-3p | prostate cancer | TRIB1 | "MicroRNA 224 inhibits progression of human prostat ......" | 24382668 |
| hsa-miR-224-3p | kidney renal cell cancer | VHL | "Importantly both VHL and the hypoxia-inducible fac ......" | 22326755 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-224-3p | PGR | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; THCA | mirMAP | TCGA BLCA -0.21; TCGA CESC -0.246; TCGA COAD -0.219; TCGA ESCA -0.262; TCGA HNSC -0.346; TCGA KIRC -0.163; TCGA LIHC -0.151; TCGA LUSC -0.24; TCGA PAAD -0.361; TCGA THCA -0.131 |
hsa-miR-224-3p | PDE4D | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD | mirMAP | TCGA BLCA -0.115; TCGA CESC -0.228; TCGA COAD -0.218; TCGA ESCA -0.169; TCGA HNSC -0.159; TCGA KIRC -0.065; TCGA LIHC -0.103; TCGA LUAD -0.252; TCGA LUSC -0.074; TCGA PAAD -0.109 |
hsa-miR-224-3p | PRICKLE2 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; THCA | mirMAP | TCGA BLCA -0.097; TCGA CESC -0.117; TCGA COAD -0.163; TCGA ESCA -0.13; TCGA HNSC -0.168; TCGA LIHC -0.194; TCGA LUSC -0.101; TCGA PAAD -0.171; TCGA THCA -0.151 |
hsa-miR-224-3p | DENND5B | 9 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA | mirMAP | TCGA BLCA -0.256; TCGA CESC -0.281; TCGA ESCA -0.453; TCGA HNSC -0.302; TCGA LIHC -0.072; TCGA LUAD -0.119; TCGA LUSC -0.126; TCGA PAAD -0.155; TCGA THCA -0.088 |
hsa-miR-224-3p | PNMA2 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; THCA | mirMAP | TCGA BLCA -0.311; TCGA CESC -0.364; TCGA COAD -0.367; TCGA ESCA -0.677; TCGA HNSC -0.3; TCGA LIHC -0.129; TCGA LUSC -0.352; TCGA PAAD -0.336; TCGA THCA -0.146 |
Enriched cancer pathways of putative targets