microRNA information: hsa-miR-23a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-23a-5p | miRbase |
| Accession: | MIMAT0004496 | miRbase |
| Precursor name: | hsa-mir-23a | miRbase |
| Precursor accession: | MI0000079 | miRbase |
| Symbol: | MIR23A | HGNC |
| RefSeq ID: | NR_029495 | GenBank |
| Sequence: | GGGGUUCCUGGGGAUGGGAUUU |
Reported expression in cancers: hsa-miR-23a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-23a-5p | B cell lymphoma | upregulation | "MicroRNA 23a expression in paraffin embedded speci ......" | 24659264 | Reverse transcription PCR |
| hsa-miR-23a-5p | breast cancer | upregulation | "Among methods for profiling levels of miRNAs next- ......" | 22387599 | RNA-Seq; qPCR; Northern blot |
| hsa-miR-23a-5p | colon cancer | downregulation | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | Microarray; qPCR |
| hsa-miR-23a-5p | colorectal cancer | upregulation | "miR 23a promotes the transition from indolent to i ......" | 22628407 | Microarray |
| hsa-miR-23a-5p | gastric cancer | upregulation | "By integrating CNV and miRNA profiles in the same ......" | 23553990 | qPCR; in situ hybridization |
| hsa-miR-23a-5p | liver cancer | upregulation | "Finally this study showed that the activation of i ......" | 22318941 | |
| hsa-miR-23a-5p | liver cancer | upregulation | "The microarray results were validated by quantitat ......" | 22977465 | qPCR; Microarray |
| hsa-miR-23a-5p | liver cancer | upregulation | "The biogenesis of miR-23a upon berberine treatment ......" | 24942805 | |
| hsa-miR-23a-5p | lung squamous cell cancer | upregulation | "Clinical value of microRNA 23a upregulation in non ......" | 26550300 | qPCR |
| hsa-miR-23a-5p | lymphoma | upregulation | "However the expression level of miR-23 in radiatio ......" | 24356489 | qPCR |
| hsa-miR-23a-5p | pancreatic cancer | upregulation | "We identified hsa-miR-21 hsa-miR-23a hsa-miR-23b a ......" | 26121640 | |
| hsa-miR-23a-5p | prostate cancer | downregulation | "Genes involved in these pathways were analyzed wit ......" | 25604141 | |
| hsa-miR-23a-5p | sarcoma | upregulation | "The miRNA cluster miR-23a~27a~24-2 particularly mi ......" | 26191074 |
Reported cancer pathway affected by hsa-miR-23a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-23a-5p | colorectal cancer | Apoptosis pathway | "MicroRNA 23a antisense enhances 5 fluorouracil che ......" | 24249161 | Luciferase |
| hsa-miR-23a-5p | colorectal cancer | Apoptosis pathway | "In the present study the role of miR-23a in the ca ......" | 24992592 | Luciferase; Western blot |
| hsa-miR-23a-5p | colorectal cancer | Apoptosis pathway | "Elevated microRNA 23a Expression Enhances the Chem ......" | 25929864 | |
| hsa-miR-23a-5p | gastric cancer | Apoptosis pathway | "Downregulation of PPP2R5E expression by miR 23a su ......" | 24997345 | |
| hsa-miR-23a-5p | liver cancer | cell cycle pathway | "Berberine induced tumor suppressor p53 up regulati ......" | 24942805 | |
| hsa-miR-23a-5p | liver cancer | Apoptosis pathway | "Among these miRNAs we found expression of miR-23a ......" | 26439986 | |
| hsa-miR-23a-5p | lung cancer | Epithelial mesenchymal transition pathway | "MiR 23a regulates TGF β induced epithelial mesenc ......" | 22752005 | |
| hsa-miR-23a-5p | ovarian cancer | cell cycle pathway | "Inhibition of microRNA 23a increases cisplatin sen ......" | 25613625 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-23a-5p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "miR 23a promotes IKKα expression but suppresses S ......" | 27537390 | Western blot; Flow cytometry; Colony formation |
Reported cancer prognosis affected by hsa-miR-23a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-23a-5p | B cell lymphoma | poor survival; staging | "MicroRNA 23a expression in paraffin embedded speci ......" | 24659264 | |
| hsa-miR-23a-5p | breast cancer | progression | "Breast tissue based microRNA panel highlights micr ......" | 25445205 | |
| hsa-miR-23a-5p | colon cancer | metastasis; staging; malignant trasformation | "Expression and clinical significance of miR 23a an ......" | 22455847 | Luciferase |
| hsa-miR-23a-5p | colon cancer | staging | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | |
| hsa-miR-23a-5p | colorectal cancer | staging; metastasis | "miR 23a promotes the transition from indolent to i ......" | 22628407 | |
| hsa-miR-23a-5p | colorectal cancer | metastasis; progression | "miR 23a a critical regulator of "migR"ation and me ......" | 22684455 | |
| hsa-miR-23a-5p | colorectal cancer | drug resistance | "MicroRNA 23a antisense enhances 5 fluorouracil che ......" | 24249161 | Luciferase |
| hsa-miR-23a-5p | colorectal cancer | tumorigenesis; drug resistance | "In the present study the role of miR-23a in the ca ......" | 24992592 | Luciferase; Western blot |
| hsa-miR-23a-5p | colorectal cancer | drug resistance; poor survival | "Elevated microRNA 23a Expression Enhances the Chem ......" | 25929864 | |
| hsa-miR-23a-5p | gastric cancer | worse prognosis; staging; metastasis; progression | "To investigate the clinical significance of microR ......" | 25674252 | |
| hsa-miR-23a-5p | liver cancer | drug resistance; staging | "Upregulation of miR 23a approximately 27a approxim ......" | 18508316 | RNAi |
| hsa-miR-23a-5p | liver cancer | drug resistance | "MiR 23a mediated inhibition of topoisomerase 1 exp ......" | 24103454 | |
| hsa-miR-23a-5p | liver cancer | staging; malignant trasformation; tumor size; poor survival; recurrence | "Correlation between miR 23a and onset of hepatocel ......" | 24417970 | |
| hsa-miR-23a-5p | lung squamous cell cancer | staging; metastasis; differentiation; tumor size; poor survival | "Clinical value of microRNA 23a upregulation in non ......" | 26550300 | |
| hsa-miR-23a-5p | lung squamous cell cancer | metastasis | "In this study five NSCLC cases with LN metastasis ......" | 26618049 | |
| hsa-miR-23a-5p | lymphoma | tumorigenesis | "However the expression level of miR-23 in radiatio ......" | 24356489 | Luciferase |
| hsa-miR-23a-5p | ovarian cancer | progression | "miR 23a promotes IKKα expression but suppresses S ......" | 27537390 | Western blot; Flow cytometry; Colony formation |
| hsa-miR-23a-5p | pancreatic cancer | poor survival | "We identified 3 miRNAs MIR21 MIR23A and MIR27A tha ......" | 24120476 | |
| hsa-miR-23a-5p | pancreatic cancer | poor survival | "We identified three miRNAs miR-21 miR-23a and miR- ......" | 26312859 | |
| hsa-miR-23a-5p | prostate cancer | metastasis; motility | "Downregulation of microRNA 23a suppresses prostate ......" | 25714010 | |
| hsa-miR-23a-5p | sarcoma | progression; poor survival | "miRNA expression was investigated in 49 primary EW ......" | 21960059 | |
| hsa-miR-23a-5p | sarcoma | progression | "MiR 23a functions as a tumor suppressor in osteosa ......" | 25322765 | Wound Healing Assay; Western blot; Luciferase |
| hsa-miR-23a-5p | sarcoma | differentiation | "miR 23a impairs bone differentiation in osteosarco ......" | 26191074 | Luciferase |
Reported gene related to hsa-miR-23a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-23a-5p | liver cancer | TP53 | "MiR-23a was up-regulated during DNA damage in canc ......" | 24103454 |
| hsa-miR-23a-5p | liver cancer | TP53 | "Among these miRNAs we found expression of miR-23a ......" | 26439986 |
| hsa-miR-23a-5p | liver cancer | TP53 | "Berberine induced tumor suppressor p53 up regulati ......" | 24942805 |
| hsa-miR-23a-5p | ovarian cancer | ABCB1 | "The inhibition of miR-23a expression could signifi ......" | 26550261 |
| hsa-miR-23a-5p | ovarian cancer | ABCB1 | "Inhibition of miR-23a expression increases the sen ......" | 25613625 |
| hsa-miR-23a-5p | colorectal cancer | APAF1 | "Luciferase assay was performed to verify a putativ ......" | 24992592 |
| hsa-miR-23a-5p | colorectal cancer | APAF1 | "We found that the expression of miR-23a was increa ......" | 24249161 |
| hsa-miR-23a-5p | colon cancer | MTSS1 | "Expression and clinical significance of miR 23a an ......" | 22455847 |
| hsa-miR-23a-5p | colorectal cancer | MTSS1 | "Jahid and colleagues have shown that miR-23a promo ......" | 22684455 |
| hsa-miR-23a-5p | head and neck cancer | PTEN | "Taken together our findings suggest that ACA might ......" | 24317043 |
| hsa-miR-23a-5p | sarcoma | PTEN | "MicroRNA 23a enhances migration and invasion throu ......" | 26160225 |
| hsa-miR-23a-5p | colorectal cancer | ABCF1 | "Elevated microRNA 23a Expression Enhances the Chem ......" | 25929864 |
| hsa-miR-23a-5p | liver cancer | AFP | "High miR-23a vascular invasion tumor size≥7cm tu ......" | 24417970 |
| hsa-miR-23a-5p | colorectal cancer | CASP9 | "APAF-1 as a target gene of miR-23a was identified ......" | 24249161 |
| hsa-miR-23a-5p | lung cancer | CDH1 | "MiR 23a regulates TGF β induced epithelial mesenc ......" | 22752005 |
| hsa-miR-23a-5p | sarcoma | CXCL12 | "MiR-23a suppressed the transcription of RUNX2 and ......" | 25322765 |
| hsa-miR-23a-5p | colorectal cancer | ERVK-10 | "Luciferase assay was performed to verify a putativ ......" | 24992592 |
| hsa-miR-23a-5p | lymphoma | FAS | "Moreover over-expression of Fas rescued the pro-pr ......" | 24356489 |
| hsa-miR-23a-5p | sarcoma | FBXW11 | "To better understand the relationship between miR- ......" | 26191074 |
| hsa-miR-23a-5p | breast cancer | FOXM1 | "The overall concordance rates between miR-23a with ......" | 25445205 |
| hsa-miR-23a-5p | liver cancer | G6PC | "Stat3 mediated activation of microRNA 23a suppress ......" | 22318941 |
| hsa-miR-23a-5p | sarcoma | GJA1 | "miR 23a impairs bone differentiation in osteosarco ......" | 26191074 |
| hsa-miR-23a-5p | lung cancer | HMGN2 | "Combined with in silico approaches we determined H ......" | 23437179 |
| hsa-miR-23a-5p | breast cancer | HRG | "miR-23a HRG messenger RNA and FOX messenger RNA we ......" | 25445205 |
| hsa-miR-23a-5p | lung squamous cell cancer | IARS | "MiR 23a mediated migration/invasion is rescued by ......" | 24898878 |
| hsa-miR-23a-5p | lung squamous cell cancer | IRS1 | "MiR 23a mediated migration/invasion is rescued by ......" | 24898878 |
| hsa-miR-23a-5p | prostate cancer | LIMK1 | "Downregulation of microRNA 23a suppresses prostate ......" | 25714010 |
| hsa-miR-23a-5p | sarcoma | MBD2 | "The promoter region of the miR-23a gene was hyperm ......" | 25322765 |
| hsa-miR-23a-5p | gastric cancer | MT2A | "MiR 23a in amplified 19p13.13 loci targets metallo ......" | 23553990 |
| hsa-miR-23a-5p | head and neck cancer | MTRNR2L4 | "Further studies indicated that ACA downregulated t ......" | 24317043 |
| hsa-miR-23a-5p | liver cancer | NEK6 | "Target prediction and experimental validation demo ......" | 24942805 |
| hsa-miR-23a-5p | prostate cancer | PAK6 | "Downregulation of microRNA 23a suppresses prostate ......" | 25714010 |
| hsa-miR-23a-5p | prostate cancer | PDLIM5 | "Expression of miR-23a inhibited phosphorylation of ......" | 25714010 |
| hsa-miR-23a-5p | gastric cancer | PPP2R5E | "Downregulation of PPP2R5E expression by miR 23a su ......" | 24997345 |
| hsa-miR-23a-5p | sarcoma | RUNX2 | "MiR-23a suppressed the transcription of RUNX2 and ......" | 25322765 |
| hsa-miR-23a-5p | sarcoma | SATB1 | "miR 23a suppresses proliferation of osteosarcoma c ......" | 25619478 |
| hsa-miR-23a-5p | prostate cancer | SNAI1 | "By inhibiting snail signaling and miR 23a 3p ostho ......" | 26110567 |
| hsa-miR-23a-5p | ovarian cancer | ST7L | "miR 23a promotes IKKα expression but suppresses S ......" | 27537390 |
| hsa-miR-23a-5p | liver cancer | STAT3 | "Stat3 mediated activation of microRNA 23a suppress ......" | 22318941 |
| hsa-miR-23a-5p | liver cancer | TOP1 | "MiR-23a could directly bind to 3'untranslated regi ......" | 24103454 |
| hsa-miR-23a-5p | liver cancer | TOP2A | "The aim of this study is to investigate the role a ......" | 24103454 |
| hsa-miR-23a-5p | liver cancer | XIAP | "Moreover miR-23a expression correlated inversely w ......" | 26439986 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-23a-5p | GIPC3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.074; TCGA CESC -0.201; TCGA COAD -0.153; TCGA ESCA -0.182; TCGA HNSC -0.094; TCGA LUSC -0.163; TCGA THCA -0.19; TCGA STAD -0.071; TCGA UCEC -0.179 |
hsa-miR-23a-5p | PYGM | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.636; TCGA CESC -0.228; TCGA COAD -0.364; TCGA ESCA -0.559; TCGA HNSC -0.634; TCGA LUSC -0.222; TCGA THCA -0.207; TCGA STAD -0.545; TCGA UCEC -0.292 |
hsa-miR-23a-5p | CLIP3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.473; TCGA CESC -0.337; TCGA COAD -0.229; TCGA ESCA -0.395; TCGA HNSC -0.255; TCGA KIRC -0.086; TCGA LUSC -0.192; TCGA STAD -0.383; TCGA UCEC -0.171 |
Enriched cancer pathways of putative targets