microRNA information: hsa-miR-23b-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-23b-5p | miRbase |
Accession: | MIMAT0004587 | miRbase |
Precursor name: | hsa-mir-23b | miRbase |
Precursor accession: | MI0000439 | miRbase |
Symbol: | MIR23B | HGNC |
RefSeq ID: | NR_029664 | GenBank |
Sequence: | UGGGUUCCUGGCAUGCUGAUUU |
Reported expression in cancers: hsa-miR-23b-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-23b-5p | bladder cancer | downregulation | "In this study we show that miRNA-23b miR-23b acts ......" | 23844063 | qPCR |
hsa-miR-23b-5p | breast cancer | upregulation | "Among methods for profiling levels of miRNAs next- ......" | 22387599 | RNA-Seq; qPCR; Northern blot |
hsa-miR-23b-5p | breast cancer | upregulation | "We identified miR-23b and miR-27b as miRNAs that a ......" | 23338610 | |
hsa-miR-23b-5p | breast cancer | upregulation | "miR-23b was found to be up-regulated 56.69 fold fo ......" | 26199568 | |
hsa-miR-23b-5p | cervical and endocervical cancer | downregulation | "miR-23b is often downregulated in HPV-associated c ......" | 21242962 | |
hsa-miR-23b-5p | esophageal cancer | deregulation | "Differentially-expressed miRNAs were analyzed usin ......" | 23534712 | Reverse transcription PCR |
hsa-miR-23b-5p | gastric cancer | upregulation | "Up Regulation of Plasma miR 23b is Associated with ......" | 26835790 | qPCR |
hsa-miR-23b-5p | glioblastoma | deregulation | "Among the down-regulated miRNAs miR-23b has been r ......" | 22745829 | |
hsa-miR-23b-5p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-23b-5p | lung squamous cell cancer | deregulation | "Recently miR-23b has emerged as a promising new ca ......" | 27268921 | |
hsa-miR-23b-5p | lymphoma | upregulation | "However the expression level of miR-23 in radiatio ......" | 24356489 | qPCR |
hsa-miR-23b-5p | ovarian cancer | downregulation | "Furthermore the down-regulation of miR-23b was sig ......" | 24613919 | |
hsa-miR-23b-5p | pancreatic cancer | upregulation | "We identified hsa-miR-21 hsa-miR-23a hsa-miR-23b a ......" | 26121640 | |
hsa-miR-23b-5p | prostate cancer | downregulation | "Five miRNAs miR-23b -100 -145 -221 and -222 were s ......" | 18949015 | Microarray; qPCR |
hsa-miR-23b-5p | prostate cancer | downregulation | "The expression of miR-23b and miR-27b which are en ......" | 23300597 | |
hsa-miR-23b-5p | prostate cancer | downregulation | "Genes involved in these pathways were analyzed wit ......" | 25604141 | |
hsa-miR-23b-5p | prostate cancer | downregulation | "miR-23b and -27b encoded in the same miR cluster m ......" | 26898757 |
Reported cancer pathway affected by hsa-miR-23b-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-23b-5p | bladder cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 23b functions as a tumor suppressor by re ......" | 23844063 | Colony formation; Luciferase |
hsa-miR-23b-5p | ovarian cancer | cell cycle pathway | "The cell inhibition rates after the treatments wer ......" | 25613625 | Flow cytometry; MTT assay; Western blot |
hsa-miR-23b-5p | ovarian cancer | Apoptosis pathway | "MiR 23b targets cyclin G1 and suppresses ovarian c ......" | 26872615 | Luciferase |
hsa-miR-23b-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "miR 23b represses proto oncogene Src kinase and fu ......" | 23074286 | Colony formation; RNAi |
Reported cancer prognosis affected by hsa-miR-23b-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-23b-5p | bladder cancer | malignant trasformation; poor survival; cell migration | "MicroRNA 23b functions as a tumor suppressor by re ......" | 23844063 | Colony formation; Luciferase |
hsa-miR-23b-5p | bladder cancer | staging | "Deregulation of seven CpG island harboring miRNAs ......" | 27064870 | |
hsa-miR-23b-5p | breast cancer | motility | "Among various microRNAs miRNAs increased in BM-MSC ......" | 24985346 | |
hsa-miR-23b-5p | breast cancer | drug resistance | "Genistein induced mir 23b expression inhibits the ......" | 26199568 | |
hsa-miR-23b-5p | cervical and endocervical cancer | progression; staging; malignant trasformation | "miR 23b as a potential tumor suppressor and its re ......" | 26622315 | |
hsa-miR-23b-5p | colorectal cancer | worse prognosis | "Three miRNAs including hsa-mir-23b hsa-mir-365-1 a ......" | 26269151 | |
hsa-miR-23b-5p | gastric cancer | worse prognosis; staging; metastasis; progression | "To investigate the clinical significance of microR ......" | 25674252 | |
hsa-miR-23b-5p | gastric cancer | drug resistance | "miR 23b 3p regulates the chemoresistance of gastri ......" | 25996293 | |
hsa-miR-23b-5p | gastric cancer | worse prognosis; poor survival; staging; metastasis; differentiation | "Up Regulation of Plasma miR 23b is Associated with ......" | 26835790 | |
hsa-miR-23b-5p | glioblastoma | cell migration | "miRNA expression profiling in migrating glioblasto ......" | 22745829 | |
hsa-miR-23b-5p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-23b-5p | liver cancer | cell migration | "MicroRNA 23b mediates urokinase and c met downmodu ......" | 19490101 | Luciferase |
hsa-miR-23b-5p | lung squamous cell cancer | poor survival; recurrence; staging | "An integrated genome wide approach to discover der ......" | 26314549 | |
hsa-miR-23b-5p | lung squamous cell cancer | progression; poor survival | "Prognostic significance of miR 23b in combination ......" | 27268921 | |
hsa-miR-23b-5p | lymphoma | tumorigenesis | "However the expression level of miR-23 in radiatio ......" | 24356489 | Luciferase |
hsa-miR-23b-5p | ovarian cancer | progression; worse prognosis | "MicroRNA 23b is an independent prognostic marker a ......" | 24613919 | |
hsa-miR-23b-5p | ovarian cancer | progression; tumorigenesis | "MiR 23b targets cyclin G1 and suppresses ovarian c ......" | 26872615 | Luciferase |
hsa-miR-23b-5p | pancreatic cancer | drug resistance | "MicroRNA 23b regulates autophagy associated with r ......" | 23916944 | Luciferase |
hsa-miR-23b-5p | prostate cancer | malignant trasformation | "Five miRNAs miR-23b -100 -145 -221 and -222 were s ......" | 18949015 | |
hsa-miR-23b-5p | prostate cancer | drug resistance | "However the expression of miR-23b -27b -15a and -1 ......" | 22127852 | |
hsa-miR-23b-5p | prostate cancer | progression; drug resistance | "MicroRNA 23b downregulates peroxiredoxin III in hu ......" | 22710126 | |
hsa-miR-23b-5p | prostate cancer | poor survival; recurrence | "miR 23b represses proto oncogene Src kinase and fu ......" | 23074286 | Colony formation; RNAi |
hsa-miR-23b-5p | prostate cancer | progression; poor survival | "The expression of miR-23b and miR-27b which are en ......" | 23300597 | Colony formation |
Reported gene related to hsa-miR-23b-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-23b-5p | gastric cancer | ATG12 | "miR 23b 3p regulates the chemoresistance of gastri ......" | 25996293 |
hsa-miR-23b-5p | pancreatic cancer | ATG12 | "MIR23B targets the 3?UTR of the autophagy-related ......" | 24145177 |
hsa-miR-23b-5p | pancreatic cancer | ATG12 | "The target of miR-23b ATG12 was overexpressed in r ......" | 23916944 |
hsa-miR-23b-5p | cervical and endocervical cancer | PLAU | "Thus the importance of miR-23b and uPA in HPV-asso ......" | 21242962 |
hsa-miR-23b-5p | liver cancer | PLAU | "In the present study to understand whether the exp ......" | 19490101 |
hsa-miR-23b-5p | acute myeloid leukemia | PRDX3 | "MicroRNA 26a 5p and microRNA 23b 3p up regulate pe ......" | 24828865 |
hsa-miR-23b-5p | prostate cancer | PRDX3 | "MicroRNA 23b downregulates peroxiredoxin III in hu ......" | 22710126 |
hsa-miR-23b-5p | lung squamous cell cancer | ABCB1 | "Prognostic significance of miR 23b in combination ......" | 27268921 |
hsa-miR-23b-5p | ovarian cancer | CCNG1 | "MiR 23b targets cyclin G1 and suppresses ovarian c ......" | 26872615 |
hsa-miR-23b-5p | breast cancer | EGF | "Prooncogenic factors miR 23b and miR 27b are regul ......" | 23338610 |
hsa-miR-23b-5p | lymphoma | FAS | "Moreover over-expression of Fas rescued the pro-pr ......" | 24356489 |
hsa-miR-23b-5p | thyroid cancer | FLNA | "Kaplan-Meier and multivariate analysis showed a si ......" | 24443580 |
hsa-miR-23b-5p | gastric cancer | HMGB2 | "miR 23b 3p regulates the chemoresistance of gastri ......" | 25996293 |
hsa-miR-23b-5p | ovarian cancer | HNF1B | "MicroRNA 23b is an independent prognostic marker a ......" | 24613919 |
hsa-miR-23b-5p | breast cancer | MARCKS | "Among various microRNAs miRNAs increased in BM-MSC ......" | 24985346 |
hsa-miR-23b-5p | liver cancer | MET | "MicroRNA 23b mediates urokinase and c met downmodu ......" | 19490101 |
hsa-miR-23b-5p | breast cancer | NISCH | "Nischarin NISCH expression was augmented by knockd ......" | 23338610 |
hsa-miR-23b-5p | ovarian cancer | PCNA | "MiR 23b targets cyclin G1 and suppresses ovarian c ......" | 26872615 |
hsa-miR-23b-5p | glioblastoma | PTK2 | "Increased expression of miR-23b reduced the protei ......" | 22745829 |
hsa-miR-23b-5p | glioblastoma | PTK2B | "miRNA expression profiling in migrating glioblasto ......" | 22745829 |
hsa-miR-23b-5p | ovarian cancer | RUNX2 | "Then ectopic expression of miR-23b significantly i ......" | 24613919 |
hsa-miR-23b-5p | prostate cancer | SRC | "miR 23b represses proto oncogene Src kinase and fu ......" | 23074286 |
hsa-miR-23b-5p | breast cancer | TNF | "Prooncogenic factors miR 23b and miR 27b are regul ......" | 23338610 |
hsa-miR-23b-5p | cervical and endocervical cancer | TP53 | "A consensus p53 binding site is detected in the pr ......" | 21242962 |
hsa-miR-23b-5p | gastric cancer | TUSC7 | "Reciprocal repression between TUSC7 and miR 23b in ......" | 25765901 |
hsa-miR-23b-5p | bladder cancer | ZEB1 | "MicroRNA 23b functions as a tumor suppressor by re ......" | 23844063 |
Expression profile in cancer corhorts: