microRNA information: hsa-miR-26b-3p

SectionIDlink
Mature name: hsa-miR-26b-3pmiRbase
Accession: MIMAT0004500miRbase
Precursor name: hsa-mir-26b miRbase
Precursor accession: MI0000084miRbase
Symbol: MIR26BHGNC
RefSeq ID: NR_029500GenBank
Sequence: CCUGUUCUCCAUUACUUGGCUC



Reported expression in cancers: hsa-miR-26b-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-26b-3p

breast cancerdownregulation"Here we show that miR-26b which is down-regulated ......"21510944
hsa-miR-26b-3p

breast cancerdownregulation"MiR 26b is down regulated in carcinoma associated ......"23939832qPCR
hsa-miR-26b-3p

breast cancerdownregulation"MicroRNA-26b miR-26b has been reported to be down- ......"24753748Reverse transcription PCR
hsa-miR-26b-3p

cervical and endocervical cancerdownregulation"Aberrant expression of microRNA 26b and its progno ......"26191262qPCR
hsa-miR-26b-3p

esophageal cancerupregulation"In this study we examined the regulatory effects o ......"27347306
hsa-miR-26b-3p

gastric cancerupregulation"In the analysis by real-time PCR-based miRNA array ......"22407237qPCR; Microarray
hsa-miR-26b-3p

gastric cancerdownregulation"Previously we identified miR-26b as a significantl ......"27078844qPCR
hsa-miR-26b-3p

head and neck cancerderegulation"MicroRNA alterations that consistently identified ......"19753298
hsa-miR-26b-3p

kidney renal cell cancerdownregulation"Our recent studies of microRNA miRNA expression si ......"26983694
hsa-miR-26b-3p

liver cancerdownregulation"miR-26 family members have been shown to be freque ......"24565101
hsa-miR-26b-3p

lung cancerupregulation"Herein we found that over-expression of miR-26b si ......"26744864
hsa-miR-26b-3p

lung squamous cell cancerdownregulation"To explore the effect of microRNA-26b miR-26b in n ......"26068649
hsa-miR-26b-3p

lung squamous cell cancerdownregulation"MiR-26b was reported to be significantly downregul ......"26827826
hsa-miR-26b-3p

lung squamous cell cancerdownregulation"To investigate the correlation between miR-26b and ......"27033050qPCR
hsa-miR-26b-3p

lymphomaupregulation"The major findings were: the detection of a panel ......"19945163
hsa-miR-26b-3p

lymphomadownregulation"Clinical and epidemiological data suggest that chr ......"22307176Reverse transcription PCR; in situ hybridization
hsa-miR-26b-3p

melanomadownregulation"Alterations in microRNA-26b miR-26b expression hav ......"26872428
hsa-miR-26b-3p

ovarian cancerdownregulation"Low expression of miR-26b was associated with adva ......"26204489
hsa-miR-26b-3p

prostate cancerdownregulation"Our past studies of microRNA miRNA expression sign ......"26063484
hsa-miR-26b-3p

sarcomadownregulation"miR-26b was reported to be downregulated in OS tis ......"25672572



Reported cancer pathway affected by hsa-miR-26b-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-26b-3p

breast cancerApoptosis pathway"MicroRNA 26b is underexpressed in human breast can ......"21510944
hsa-miR-26b-3p

breast cancercell cycle pathway"MicroRNA-26b miR-26b has been reported to be down- ......"24753748Colony formation; Western blot; Luciferase
hsa-miR-26b-3p

colon cancerApoptosis pathway"MicroRNA 26b represses colon cancer cell prolifera ......"24785257
hsa-miR-26b-3p

colorectal cancerApoptosis pathway"Human embryonic stem cells and metastatic colorect ......"20831567
hsa-miR-26b-3p

esophageal cancercell cycle pathway"MicroRNA 26b regulates cancer proliferation migrat ......"27347306Luciferase
hsa-miR-26b-3p

gastric cancercell cycle pathway"Similar to the restoring miR-26 expression SOCS2 d ......"25561270
hsa-miR-26b-3p

gastric cancerApoptosis pathway"We used the quantitative reverse transcription pol ......"27529338Colony formation
hsa-miR-26b-3p

liver cancerApoptosis pathway"MicroRNA 26b suppresses the NF κB signaling and e ......"24565101
hsa-miR-26b-3p

liver cancerEpithelial mesenchymal transition pathway"MicroRNA 26b inhibits epithelial mesenchymal trans ......"24890815
hsa-miR-26b-3p

liver cancerApoptosis pathway"MicroRNA 26b Enhances the Radiosensitivity of Hepa ......"26843134Western blot; Luciferase
hsa-miR-26b-3p

liver cancerApoptosis pathway"Regulation of proliferation angiogenesis and apopt ......"26891666
hsa-miR-26b-3p

liver cancerEpithelial mesenchymal transition pathway"Twist1 related miR 26b 5p suppresses epithelial me ......"27027434
hsa-miR-26b-3p

lung cancerMAPK signaling pathway"Coordinated regulation of ATF2 by miR 26b in γ ir ......"21901137
hsa-miR-26b-3p

melanomaApoptosis pathway; MAPK signaling pathway"MiR 26b inhibits melanoma cell proliferation and e ......"26872428Colony formation; MTT assay; Luciferase
hsa-miR-26b-3p

sarcomaApoptosis pathway; cell cycle pathway"miR 26b inhibits proliferation migration invasion ......"25672572



Reported cancer prognosis affected by hsa-miR-26b-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-26b-3p

breast cancermalignant trasformation"Real-time quantitative PCR RQ-PCR is a sensitive a ......"18718003
hsa-miR-26b-3p

breast cancercell migration; recurrence"MiR 26b is down regulated in carcinoma associated ......"23939832
hsa-miR-26b-3p

breast cancermalignant trasformation; tumorigenesis"MicroRNA-26b miR-26b has been reported to be down- ......"24753748Colony formation; Western blot; Luciferase
hsa-miR-26b-3p

breast cancerdrug resistance"The few available studies investigating microRNA i ......"26473850
hsa-miR-26b-3p

cervical and endocervical cancerprogression; staging; metastasis; recurrence; worse prognosis"Aberrant expression of microRNA 26b and its progno ......"26191262
hsa-miR-26b-3p

colorectal cancermetastasis"Human embryonic stem cells and metastatic colorect ......"20831567
hsa-miR-26b-3p

colorectal cancerpoor survival"Nicotinamide phosphoribosyl transferase Nampt is a ......"23922874
hsa-miR-26b-3p

colorectal cancerprogression"Downloading from GEO Gene Expression Omnibus datab ......"25755742
hsa-miR-26b-3p

gastric cancerprogression"Similar to the restoring miR-26 expression SOCS2 d ......"25561270
hsa-miR-26b-3p

gastric cancermetastasis; progression; staging; poor survival; cell migration"MicroRNA 26b inhibits tumor metastasis by targetin ......"27078844Luciferase
hsa-miR-26b-3p

head and neck cancerworse prognosis"In this present study the expression profiles of t ......"22811001
hsa-miR-26b-3p

kidney renal cell cancermetastasis; cell migration"Our recent studies of microRNA miRNA expression si ......"26983694Luciferase
hsa-miR-26b-3p

liver cancerpoor survival; drug resistance"In patients with hepatocellular carcinoma the expr ......"19812400
hsa-miR-26b-3p

liver cancerpoor survival; drug resistance"Development of a miR 26 companion diagnostic test ......"23569435
hsa-miR-26b-3p

liver cancerpoor survival"MicroRNA 26b suppresses the NF κB signaling and e ......"24565101
hsa-miR-26b-3p

liver cancercell migration"MicroRNA 26b inhibits epithelial mesenchymal trans ......"24890815
hsa-miR-26b-3p

liver cancerprogression"MiR 26b inhibits hepatocellular carcinoma cell pro ......"26191168Luciferase
hsa-miR-26b-3p

liver cancerdrug resistance"MicroRNA 26b Enhances the Radiosensitivity of Hepa ......"26843134Western blot; Luciferase
hsa-miR-26b-3p

liver cancertumorigenesis; differentiation"Regulation of proliferation angiogenesis and apopt ......"26891666
hsa-miR-26b-3p

lung cancertumorigenesis"Other significantly differentiated miR families in ......"23035181
hsa-miR-26b-3p

lung squamous cell cancerdrug resistance; cell migration"Down regulation of microRNA 26b modulates non smal ......"26068649Luciferase
hsa-miR-26b-3p

lung squamous cell cancermetastasis; progression"MicroRNA 26b suppresses the metastasis of non smal ......"26827826Luciferase; Wound Healing Assay
hsa-miR-26b-3p

lung squamous cell cancerworse prognosis"To investigate the correlation between miR-26b and ......"27033050
hsa-miR-26b-3p

melanomamalignant trasformation; progression"MiR 26b inhibits melanoma cell proliferation and e ......"26872428Colony formation; MTT assay; Luciferase
hsa-miR-26b-3p

ovarian cancerstaging; metastasis; differentiation; recurrence; poor survival; progression; tumorigenesis"Our results showed that miR-26b was downregulated ......"26204489
hsa-miR-26b-3p

pancreatic cancerstaging"In addition from 10 to 50 weeks of age stage-speci ......"26516699
hsa-miR-26b-3p

prostate cancerstaging"MiR 26b inhibits autophagy by targeting ULK2 in pr ......"26920049Luciferase; Western blot
hsa-miR-26b-3p

sarcomaprogression"miR 26b inhibits proliferation migration invasion ......"25672572
hsa-miR-26b-3p

sarcomametastasis"MicroRNA 26b inhibits metastasis of osteosarcoma v ......"25761878Luciferase; RNAi
hsa-miR-26b-3p

sarcomacell migration"MicroRNA 26b inhibits osteosarcoma cell migration ......"26681033MTT assay; Western blot



Reported gene related to hsa-miR-26b-3p

miRNAcancergenereportingPUBMED
hsa-miR-26b-3p

liver cancerEPHA2"MiR 26b inhibits hepatocellular carcinoma cell pro ......"26191168
hsa-miR-26b-3p

liver cancerEPHA2"MicroRNA 26b Enhances the Radiosensitivity of Hepa ......"26843134
hsa-miR-26b-3p

gastric cancerJUN"MicroRNA 26b inhibits tumor metastasis by targetin ......"27078844
hsa-miR-26b-3p

lung cancerJUN"When c-Jun N-terminal kinase activity was inhibite ......"21901137
hsa-miR-26b-3p

gastric cancerKPNA2"Additionally miR-26b affected GC cell behavior thr ......"27078844
hsa-miR-26b-3p

ovarian cancerKPNA2"Our results showed that miR-26b was downregulated ......"26204489
hsa-miR-26b-3p

liver cancerNFASC"MicroRNA 26b suppresses the NF κB signaling and e ......"24565101
hsa-miR-26b-3p

lung squamous cell cancerNFASC"MicroRNA 26b suppresses the metastasis of non smal ......"26827826
hsa-miR-26b-3p

sarcomaPFKFB3"Moreover the binding site for miR-26b was predicte ......"25672572
hsa-miR-26b-3p

sarcomaPFKFB3"MicroRNA 26b inhibits osteosarcoma cell migration ......"26681033
hsa-miR-26b-3p

bladder cancerPLOD2"Tumour suppressive miRNA 26a 5p and miR 26b 5p inh ......"27310702
hsa-miR-26b-3p

kidney renal cell cancerPLOD2"Thus our data showed that two genes promoting meta ......"26983694
hsa-miR-26b-3p

breast cancerPTGS2"Luciferase assays using a reporter carrying a puta ......"23374284
hsa-miR-26b-3p

lung cancerPTGS2"MiR 26b suppresses tumor cell proliferation migrat ......"26744864
hsa-miR-26b-3p

liver cancerSMAD1"Twist1 related miR 26b 5p suppresses epithelial me ......"27027434
hsa-miR-26b-3p

sarcomaSMAD1"Luciferase reporter assay confirmed the interactio ......"25761878
hsa-miR-26b-3p

esophageal cancerTRAF5"MicroRNA 26b regulates cancer proliferation migrat ......"27347306
hsa-miR-26b-3p

melanomaTRAF5"MiR 26b inhibits melanoma cell proliferation and e ......"26872428
hsa-miR-26b-3p

lung cancerADC"SQCC was distinguished from normal tissue and ADC ......"23207443
hsa-miR-26b-3p

lung cancerATF2"Coordinated regulation of ATF2 by miR 26b in γ ir ......"21901137
hsa-miR-26b-3p

lung cancerCDC6"Here it is demonstrated that miR26a and miR26b inh ......"25100863
hsa-miR-26b-3p

liver cancerCDH1"Increased expression of miR-26b inhibited the migr ......"24890815
hsa-miR-26b-3p

breast cancerCDK8"Luciferase assays revealed that miR-26b directly t ......"24753748
hsa-miR-26b-3p

sarcomaCTGF"Luciferase reporter assay confirmed the interactio ......"25761878
hsa-miR-26b-3p

cervical and endocervical cancerFRTS1"Furthermore multivariate analyses demonstrated tha ......"26191262
hsa-miR-26b-3p

lung cancerHNF1B"Concurrent analysis of time-series mRNA and microR ......"21901137
hsa-miR-26b-3p

thyroid cancerHSF2"E2F HSF2 and miR 26 in thyroid carcinoma: bioinfor ......"26985959
hsa-miR-26b-3p

liver cancerIL6"Moreover tumors with reduced miR-26 expression had ......"19812400
hsa-miR-26b-3p

lung cancerINSR"IR in miR-26b overexpressed H1299 cells could not ......"21901137
hsa-miR-26b-3p

prostate cancerLARP1"Gene expression data and in silico analysis showe ......"26063484
hsa-miR-26b-3p

colon cancerLEF1"miR26b is downregulated in several cancers and tum ......"24785257
hsa-miR-26b-3p

kidney renal cell cancerLOXL2"Thus our data showed that two genes promoting meta ......"26983694
hsa-miR-26b-3p

lung squamous cell cancerMIEN1"MicroRNA 26b suppresses the metastasis of non smal ......"26827826
hsa-miR-26b-3p

liver cancerMYC"Moreover miR-26b down-regulated c-Myc and CyclinD1 ......"26191168
hsa-miR-26b-3p

colorectal cancerNAMPT"Nicotinamide phosphoribosyl transferase Nampt is a ......"23922874
hsa-miR-26b-3p

lung squamous cell cancerPTEN"Down regulation of microRNA 26b modulates non smal ......"26068649
hsa-miR-26b-3p

breast cancerSLC7A11"MicroRNA 26b is underexpressed in human breast can ......"21510944
hsa-miR-26b-3p

liver cancerSMAD4"Overexpression of miR-26b also repressed Smad4 exp ......"24890815
hsa-miR-26b-3p

gastric cancerSOCS2"Similar to the restoring miR-26 expression SOCS2 d ......"25561270
hsa-miR-26b-3p

liver cancerTAB3"MicroRNA 26b suppresses the NF κB signaling and e ......"24565101
hsa-miR-26b-3p

esophageal cancerTNF"The association of miR-26b and its downstream targ ......"27347306
hsa-miR-26b-3p

liver cancerTWIST1"Twist1 related miR 26b 5p suppresses epithelial me ......"27027434
hsa-miR-26b-3p

prostate cancerULK2"MiR 26b inhibits autophagy by targeting ULK2 in pr ......"26920049
hsa-miR-26b-3p

liver cancerUSP9X"MicroRNA 26b inhibits epithelial mesenchymal trans ......"24890815
hsa-miR-26b-3p

liver cancerVIM"Increased expression of miR-26b inhibited the migr ......"24890815



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-26b-3p
GPX8
11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.323; TCGA COAD -0.461; TCGA ESCA -0.271; TCGA HNSC -0.161; TCGA KIRP -0.123; TCGA LIHC -0.338; TCGA LUSC -0.122; TCGA PAAD -0.365; TCGA PRAD -0.179; TCGA THCA -0.095; TCGA STAD -0.089
hsa-miR-26b-3p
KIAA1644
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.127; TCGA BRCA -0.102; TCGA CESC -0.279; TCGA COAD -0.912; TCGA ESCA -0.689; TCGA HNSC -0.289; TCGA PAAD -0.522; TCGA PRAD -0.48; TCGA THCA -0.422; TCGA STAD -0.476; TCGA UCEC -0.438
hsa-miR-26b-3p
PRRX1
13 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.819; TCGA COAD -0.6; TCGA ESCA -0.817; TCGA HNSC -0.23; TCGA LIHC -0.668; TCGA LUSC -0.243; TCGA OV -0.522; TCGA PAAD -0.545; TCGA PRAD -0.303; TCGA SARC -0.274; TCGA THCA -0.194; TCGA STAD -0.278; TCGA UCEC -0.461
hsa-miR-26b-3p
CDC42EP3
11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.344; TCGA COAD -0.246; TCGA ESCA -0.32; TCGA HNSC -0.161; TCGA LUAD -0.175; TCGA PAAD -0.163; TCGA PRAD -0.254; TCGA SARC -0.468; TCGA THCA -0.579; TCGA STAD -0.285; TCGA UCEC -0.229
hsa-miR-26b-3p
ZEB1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.692; TCGA CESC -0.208; TCGA COAD -0.691; TCGA ESCA -0.541; TCGA HNSC -0.249; TCGA LGG -0.124; TCGA LUAD -0.123; TCGA LUSC -0.209; TCGA OV -0.169; TCGA PAAD -0.295; TCGA PRAD -0.218; TCGA STAD -0.436; TCGA UCEC -0.332
hsa-miR-26b-3p
FHL5
10 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.589; TCGA CESC -0.287; TCGA COAD -0.643; TCGA HNSC -0.299; TCGA LIHC -0.248; TCGA LUAD -0.189; TCGA PRAD -0.265; TCGA SARC -0.31; TCGA STAD -0.358; TCGA UCEC -0.365
hsa-miR-26b-3p
ANTXR1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.442; TCGA CESC -0.302; TCGA COAD -0.821; TCGA ESCA -0.664; TCGA HNSC -0.206; TCGA LUAD -0.184; TCGA LUSC -0.187; TCGA PAAD -0.533; TCGA PRAD -0.302; TCGA STAD -0.243; TCGA UCEC -0.197
hsa-miR-26b-3p
FGF1
10 cancers: BLCA; CESC; COAD; ESCA; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.423; TCGA CESC -0.284; TCGA COAD -0.734; TCGA ESCA -0.615; TCGA LUSC -0.243; TCGA PAAD -0.496; TCGA PRAD -0.325; TCGA THCA -0.187; TCGA STAD -0.317; TCGA UCEC -0.206
hsa-miR-26b-3p
CD93
9 cancers: BLCA; CESC; COAD; HNSC; LUAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.358; TCGA CESC -0.251; TCGA COAD -0.42; TCGA HNSC -0.208; TCGA LUAD -0.173; TCGA PRAD -0.139; TCGA THCA -0.135; TCGA STAD -0.11; TCGA UCEC -0.255
hsa-miR-26b-3p
FGL2
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.846; TCGA COAD -0.503; TCGA ESCA -0.779; TCGA HNSC -0.186; TCGA LUAD -0.158; TCGA PRAD -0.256; TCGA SARC -0.33; TCGA STAD -0.373; TCGA UCEC -0.352
hsa-miR-26b-3p
SLC18A2
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.698; TCGA BRCA -0.312; TCGA CESC -0.365; TCGA COAD -0.425; TCGA HNSC -0.282; TCGA KIRP -0.653; TCGA LUAD -0.295; TCGA PRAD -0.525; TCGA SARC -0.478; TCGA THCA -0.684
hsa-miR-26b-3p
ZNF521
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.709; TCGA CESC -0.264; TCGA COAD -0.652; TCGA ESCA -0.398; TCGA HNSC -0.371; TCGA LUAD -0.125; TCGA PAAD -0.403; TCGA PRAD -0.214; TCGA STAD -0.229; TCGA UCEC -0.23
hsa-miR-26b-3p
ARHGAP20
10 cancers: BLCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.921; TCGA CESC -0.335; TCGA COAD -0.684; TCGA ESCA -0.879; TCGA LUAD -0.32; TCGA PAAD -0.338; TCGA PRAD -0.418; TCGA SARC -0.588; TCGA STAD -0.404; TCGA UCEC -0.215
hsa-miR-26b-3p
NCAM2
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; OV; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.978; TCGA COAD -1.22; TCGA ESCA -1.08; TCGA HNSC -0.386; TCGA LUAD -0.163; TCGA OV -0.453; TCGA PAAD -0.503; TCGA THCA -0.474; TCGA STAD -0.446
hsa-miR-26b-3p
RASAL2
10 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
MirTarget
TCGA BLCA -0.135; TCGA CESC -0.226; TCGA ESCA -0.205; TCGA HNSC -0.1; TCGA LIHC -0.176; TCGA LUAD -0.166; TCGA LUSC -0.121; TCGA PAAD -0.163; TCGA THCA -0.229; TCGA STAD -0.066
hsa-miR-26b-3p
TGFB3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.678; TCGA BRCA -0.166; TCGA COAD -0.634; TCGA ESCA -0.512; TCGA HNSC -0.228; TCGA LUSC -0.165; TCGA PAAD -0.419; TCGA PRAD -0.167; TCGA THCA -0.174; TCGA STAD -0.228; TCGA UCEC -0.18
hsa-miR-26b-3p
GAS1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; OV; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -1.043; TCGA CESC -0.341; TCGA COAD -0.875; TCGA ESCA -0.675; TCGA HNSC -0.233; TCGA LGG -0.139; TCGA LUAD -0.146; TCGA OV -0.193; TCGA PAAD -0.733; TCGA PRAD -0.359; TCGA STAD -0.42; TCGA UCEC -0.376
hsa-miR-26b-3p
CTGF
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; miRNATAP
TCGA BLCA -0.817; TCGA BRCA -0.095; TCGA COAD -0.42; TCGA ESCA -0.493; TCGA HNSC -0.369; TCGA LUAD -0.16; TCGA LUSC -0.227; TCGA PAAD -0.394; TCGA PRAD -0.243; TCGA STAD -0.164
hsa-miR-26b-3p
GFRA1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.817; TCGA CESC -0.707; TCGA COAD -0.91; TCGA ESCA -0.56; TCGA HNSC -0.398; TCGA LGG -0.448; TCGA PRAD -0.29; TCGA STAD -0.541; TCGA UCEC -0.357
hsa-miR-26b-3p
OSBPL6
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; OV; SARC; STAD
MirTarget
TCGA BLCA -0.491; TCGA CESC -0.353; TCGA COAD -0.487; TCGA ESCA -0.685; TCGA HNSC -0.128; TCGA LGG -0.107; TCGA OV -0.418; TCGA SARC -0.356; TCGA STAD -0.311
hsa-miR-26b-3p
CREB5
9 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.369; TCGA COAD -0.238; TCGA HNSC -0.185; TCGA KIRP -0.423; TCGA LUAD -0.165; TCGA LUSC -0.301; TCGA THCA -0.52; TCGA STAD -0.219; TCGA UCEC -0.151
hsa-miR-26b-3p
EXOC5
10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.062; TCGA CESC -0.083; TCGA COAD -0.129; TCGA ESCA -0.187; TCGA LUAD -0.066; TCGA LUSC -0.088; TCGA SARC -0.102; TCGA THCA -0.083; TCGA STAD -0.096; TCGA UCEC -0.183
hsa-miR-26b-3p
FAM126A
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.169; TCGA CESC -0.343; TCGA COAD -0.514; TCGA ESCA -0.261; TCGA HNSC -0.102; TCGA LGG -0.087; TCGA LUAD -0.146; TCGA LUSC -0.117; TCGA PRAD -0.097; TCGA STAD -0.205; TCGA UCEC -0.284
hsa-miR-26b-3p
CYTH3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.188; TCGA CESC -0.136; TCGA COAD -0.208; TCGA ESCA -0.219; TCGA HNSC -0.146; TCGA KIRP -0.083; TCGA LIHC -0.204; TCGA LUAD -0.163; TCGA LUSC -0.123; TCGA PAAD -0.321; TCGA STAD -0.165; TCGA UCEC -0.102
hsa-miR-26b-3p
FOXN3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.293; TCGA CESC -0.154; TCGA COAD -0.225; TCGA ESCA -0.229; TCGA HNSC -0.153; TCGA LUAD -0.066; TCGA SARC -0.285; TCGA THCA -0.128; TCGA STAD -0.213
hsa-miR-26b-3p
SSH1
9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.057; TCGA CESC -0.137; TCGA COAD -0.08; TCGA ESCA -0.141; TCGA LUAD -0.097; TCGA LUSC -0.079; TCGA SARC -0.093; TCGA THCA -0.121; TCGA STAD -0.086
hsa-miR-26b-3p
NRP2
10 cancers: BLCA; COAD; ESCA; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.707; TCGA COAD -0.577; TCGA ESCA -0.703; TCGA LGG -0.131; TCGA LUAD -0.155; TCGA PAAD -0.412; TCGA PRAD -0.263; TCGA THCA -0.269; TCGA STAD -0.389; TCGA UCEC -0.225
hsa-miR-26b-3p
SEPT7
10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.112; TCGA CESC -0.065; TCGA COAD -0.164; TCGA ESCA -0.137; TCGA KIRP -0.067; TCGA LUAD -0.067; TCGA LUSC -0.077; TCGA PRAD -0.072; TCGA STAD -0.15; TCGA UCEC -0.223
hsa-miR-26b-3p
KIAA1614
10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.526; TCGA COAD -0.284; TCGA ESCA -0.431; TCGA HNSC -0.14; TCGA LIHC -0.414; TCGA LUSC -0.137; TCGA PAAD -0.284; TCGA PRAD -0.289; TCGA SARC -0.291; TCGA STAD -0.268
hsa-miR-26b-3p
GLIPR1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.408; TCGA CESC -0.269; TCGA COAD -0.405; TCGA ESCA -0.476; TCGA HNSC -0.114; TCGA LIHC -0.153; TCGA LUAD -0.139; TCGA LUSC -0.275; TCGA PRAD -0.318; TCGA SARC -0.182; TCGA THCA -0.139; TCGA STAD -0.188; TCGA UCEC -0.329
hsa-miR-26b-3p
CXorf36
11 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.316; TCGA CESC -0.268; TCGA COAD -0.475; TCGA HNSC -0.173; TCGA LIHC -0.477; TCGA LUAD -0.143; TCGA OV -0.13; TCGA PAAD -0.202; TCGA PRAD -0.175; TCGA STAD -0.19; TCGA UCEC -0.328
hsa-miR-26b-3p
ENDOD1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.137; TCGA CESC -0.154; TCGA ESCA -0.389; TCGA HNSC -0.181; TCGA KIRP -0.089; TCGA LUAD -0.163; TCGA SARC -0.325; TCGA THCA -0.404; TCGA STAD -0.146
hsa-miR-26b-3p
DST
11 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.164; TCGA CESC -0.386; TCGA COAD -0.212; TCGA ESCA -0.245; TCGA LUAD -0.174; TCGA LUSC -0.188; TCGA PRAD -0.27; TCGA SARC -0.393; TCGA THCA -0.546; TCGA STAD -0.295; TCGA UCEC -0.331
hsa-miR-26b-3p
PALM2-AKAP2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.444; TCGA CESC -0.198; TCGA COAD -0.369; TCGA ESCA -0.225; TCGA HNSC -0.12; TCGA LUAD -0.227; TCGA PRAD -0.144; TCGA SARC -0.212; TCGA STAD -0.202; TCGA UCEC -0.245
hsa-miR-26b-3p
C1QTNF7
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.777; TCGA CESC -0.424; TCGA COAD -1.006; TCGA ESCA -0.745; TCGA HNSC -0.407; TCGA LUAD -0.254; TCGA PAAD -0.336; TCGA PRAD -0.323; TCGA SARC -0.514; TCGA STAD -0.522; TCGA UCEC -0.36
hsa-miR-26b-3p
HEYL
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; OV; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.312; TCGA BRCA -0.093; TCGA COAD -0.396; TCGA ESCA -0.23; TCGA HNSC -0.242; TCGA LIHC -0.22; TCGA LUAD -0.109; TCGA OV -0.162; TCGA THCA -0.113; TCGA STAD -0.217; TCGA UCEC -0.187
hsa-miR-26b-3p
HSPA12A
10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.579; TCGA COAD -0.196; TCGA ESCA -0.503; TCGA HNSC -0.326; TCGA LIHC -0.359; TCGA LUAD -0.112; TCGA LUSC -0.331; TCGA PAAD -0.394; TCGA PRAD -0.184; TCGA STAD -0.367
hsa-miR-26b-3p
SYNPO
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.452; TCGA COAD -0.315; TCGA ESCA -0.279; TCGA HNSC -0.197; TCGA LUAD -0.196; TCGA PRAD -0.188; TCGA SARC -0.23; TCGA THCA -0.306; TCGA STAD -0.157
hsa-miR-26b-3p
HEG1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.401; TCGA CESC -0.461; TCGA COAD -0.498; TCGA ESCA -0.41; TCGA HNSC -0.169; TCGA LUAD -0.226; TCGA PAAD -0.257; TCGA PRAD -0.159; TCGA SARC -0.196; TCGA STAD -0.18; TCGA UCEC -0.122
hsa-miR-26b-3p
ARL10
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.226; TCGA CESC -0.437; TCGA COAD -0.567; TCGA ESCA -0.298; TCGA KIRC -0.235; TCGA LGG -0.098; TCGA LUSC -0.164; TCGA PRAD -0.152; TCGA SARC -0.147; TCGA STAD -0.264
hsa-miR-26b-3p
FAM26E
13 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.558; TCGA COAD -0.695; TCGA ESCA -0.389; TCGA HNSC -0.342; TCGA LUAD -0.143; TCGA LUSC -0.236; TCGA OV -0.255; TCGA PAAD -0.38; TCGA PRAD -0.22; TCGA SARC -0.213; TCGA THCA -0.135; TCGA STAD -0.205; TCGA UCEC -0.302
hsa-miR-26b-3p
HHIPL1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.404; TCGA BRCA -0.176; TCGA COAD -0.563; TCGA ESCA -0.293; TCGA HNSC -0.282; TCGA PAAD -0.491; TCGA PRAD -0.19; TCGA THCA -0.196; TCGA STAD -0.126
hsa-miR-26b-3p
CYS1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.773; TCGA BRCA -0.149; TCGA COAD -0.729; TCGA ESCA -0.67; TCGA HNSC -0.447; TCGA KIRP -0.191; TCGA LUAD -0.329; TCGA LUSC -0.423; TCGA PRAD -0.217; TCGA STAD -0.41; TCGA UCEC -0.672
hsa-miR-26b-3p
VGLL3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; OV; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.2; TCGA CESC -0.318; TCGA COAD -0.775; TCGA ESCA -0.539; TCGA HNSC -0.376; TCGA LUAD -0.22; TCGA OV -0.518; TCGA SARC -0.828; TCGA THCA -0.234; TCGA STAD -0.286; TCGA UCEC -0.463
hsa-miR-26b-3p
ZFHX4
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; OV; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.773; TCGA CESC -0.486; TCGA COAD -0.891; TCGA ESCA -0.543; TCGA HNSC -0.299; TCGA OV -0.258; TCGA PAAD -0.555; TCGA THCA -0.199; TCGA STAD -0.352
hsa-miR-26b-3p
GNAL
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.897; TCGA CESC -0.306; TCGA COAD -0.568; TCGA ESCA -0.523; TCGA KIRC -0.165; TCGA LGG -0.185; TCGA LIHC -0.544; TCGA PRAD -0.436; TCGA SARC -0.612; TCGA STAD -0.51; TCGA UCEC -0.175
hsa-miR-26b-3p
NUAK1
9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.195; TCGA COAD -0.341; TCGA ESCA -0.23; TCGA LIHC -0.156; TCGA LUAD -0.101; TCGA PAAD -0.537; TCGA PRAD -0.22; TCGA STAD -0.088; TCGA UCEC -0.194
hsa-miR-26b-3p
NOVA1
9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.773; TCGA CESC -0.319; TCGA COAD -0.873; TCGA ESCA -0.693; TCGA KIRP -0.154; TCGA LGG -0.226; TCGA PRAD -0.258; TCGA STAD -0.526; TCGA UCEC -0.346





Enriched cancer pathways of putative targets